OASIS Mailing List ArchivesView the OASIS mailing list archive below
or browse/search using MarkMail.

 


Help: OASIS Mailing Lists Help | MarkMail Help

dita message

[Date Prev] | [Thread Prev] | [Thread Next] | [Date Next] -- [Date Index] | [Thread Index] | [List Home]


Subject: [no subject]


Michael Priestley
mpriestl@ca.ibm.com
Dept PRG IBM Canada  phone: 416-915-8262
Toronto Information Development
--0__=0ABBE452DFC2986C8f9e8a93df938690918c0ABBE452DFC2986C
Content-type: application/vnd.ms-powerpoint; 
	name="CEDROM-SNi's DITA-based project creation.ppt"
Content-Disposition: attachment; filename="CEDROM-SNi's DITA-based project creation.ppt"
Content-transfer-encoding: base64

0M8R4KGxGuEAAAAAAAAAAAAAAAAAAAAAPgADAP7/CQAGAAAAAAAAAAAAAAAOAAAA0QYAAAAAAAAA
EAAA1gYAAAEAAAD+////AAAAAP0EAAD+BAAA/wQAAAAFAAABBQAAAgUAAAMFAAAEBQAABQUAANoG
AADVBgAA1AYAANMGAADSBgAA////////////////////////////////////////////////////
////////////////////////////////////////////////////////////////////////////
////////////////////////////////////////////////////////////////////////////
////////////////////////////////////////////////////////////////////////////
////////////////////////////////////////////////////////////////////////////
////////////////////////////////////////////////////////////////////////////
//////////////////////////////////////////////////////////////////////////8A
bh7wOTUAAB6W8ZE9d3M9Pf6uRt1bVhr/iVBORw0KGgoAAAANSUhEUgAAAXoAAAEzCAIAAACwlV9j
AAAAAXNSR0IArs4c6QAAAAlwSFlzAAAOxAAADsMB2mqY3AAANM1JREFUeF7tfbtuI8nSZmmx7ljz
AhTkyNALjEdBwBkJcjXG2JLTaJeEnkEQ3YYcyj0D/JAriGP0ktaZB1gBS0cQjTV3nJ0H6D8ib5VZ
90rWLYtfGd0UmRkZ+WUymJeIL45+/PgR4QECQAAItI/A/2i/CbQABIAAEGAEYG4wD4AAEOgIgSO5
mfrn721HDaIZIAAEDg+Bn34+pU7H5kb+jQcIAAEg0CwCf/3x6y+//5k0N/Rus81A2vARoHkQ7rgH
qnygavtNZtlZaW4i2kzR8///3/+hf//z73/JP/FUQYBACx2xoMc9UOUDVbvKNyJdJtFZHBX7mWzU
AgJAoDYCMDe1IUMFIAAE/BCAufHDbby1ds9XR+a5et7l9lQXnG9EEfGnej1edNCzvRCAudkLvrFV
3syPju9Ws7XchK9nq7vjXBMyuX1bz8YGAPrTKgIwN63CG5bwzfx8EUWz9eNU6j19ZHuyOK+0ZiHr
8+OHrhlWv6FtVwjA3HSF9PDb2bySsYkuTyexqpPTS/pj8bqRe6Wjo6v5XP7v7rLMxuo5txgtnMRT
yXYNHyxo6IMAzI0PamOuc3Zim5uTM9XXye3TkkzP6v306ZNerF6+7ywUzMbqJLsYmaPz9+Un788q
LpbGDPHh9g3m5nDHPrvn7x+WHdl9vLulLm8upDVabW1zkxSVKLb7/rKK+BzoiHdrTguA/5AQgLlp
brRDv9OZXvPJr2NHdtsVvTW7njaA0iWvbvh5u7XWTw0IJhEO9Gazp/dv8U2b2cmlP0ruD5tRrFhK
ttrNtVxDfjcXizA3DQ3uGO50kkfDyaNjb6gmvCdb3X3bkITNvIXTGz6nFtdk4lKNXtFSar6ZPv7g
jV+kDB29vThXVoU+isvLWzjv3vlXzFbbX16yZrPyd8/PPIB7PQhi8PPOlpEfOohBTlZ9gRxPX/sd
px13rnursG/FDId68QXVj1mRyO+t6OQs9cW8XK7tSm6x+Luu6qtb9n1VT0XexJBKXUXDtrnRNsXW
KHeA9lcvT0IC80y1G2y9KfmMZH20EMSwl3XOrjymOx1xoa2feN9j3n58fEx+Gd5up3Yl8bEppkTQ
ckI+HdyVyy2gc+Ytxy1ju0jv7p7nBd6MLUyXHJG22nqzJ24AzaXe3Nzu8VvqdtC58pPbJ/rEKqCb
y5Vv9qK87sy8gqQ3yR8rXhx6g4LVjfcvSby6SS9u9C+p+D0wv7bxb629utGvM4rJuuLnmEvV/3Up
6VzQ4YJZy4Tkssxd3agtk1zeWNuneBHnPRmqV6ygNqvGOun/pa78jugPT4P1WqwS09NDdWu2XF6a
eZNcrabkKzTk/MqYh5+fS7NVrd5TKonVjbdlLquIO50yhNr/XBvkwuNoa93D5T+X+ra/ff1yWnDV
FotlraQ4up9+1c4HJ2eX7Ae1+fiY8MIs58qPXDVvb99iEMrkp9Vy7xYnk5NGsMFRcRMwBnyn00T3
g5GRsekl3Se3j83flTWMiTxs337bRdf04v3140Q5JKhVj1hytHDll9GN+FKv/pk/zE0j8yLcO51G
uh+GEHnRdrl8GrpxEb7ceq2svLzFLxqpP+UXq8U24sVN5HfllyW/+hCaUzifYzic3dTai9qFk/Ra
4dzpmF5YW+v4KGO2jl9b2//0wZHqcKcnH9YAWMrb0Md6pi+3zWd9Hdy4xxnZanMXtX4WtvSWuWyz
xsL0xDom1Hf/VeXH5axLRnMFGV/xkU2qeXyYOLsBm5+3tbEvwv2F9FvTmQ3W/XHiBvlzuRSHiKkn
cRLbbWcCPecOVG2/scVRcfVl44GVnFzccFSUjIYSf6jXu+9q7X5ggKC7TSOAs5umEQ1YnmNvyOaQ
vRGRUbvo1BxMZgV2v3zJCBIPGAeo3hYCMDdtIRuiXMve7KKTG7oDYe6JzetWRYlnB3avzu7ZV2N1
92UQ3nIhAn8oOsPcHMpIV+qnsTebHd0P82XI+8fm41SFaOZ4eRiGnOIo8UoKoNCoEYC52X94U3G3
JcHFQyaa0vbmNZpMIr4wXd2db0+mFkgFgd0OM9f+uNaRkB6D6kxepcHQpQXqaOqUzeR7VhRl9b1a
vNXorCLMzf5QUziRfUMj9hUUj5wjmL0/LpfsEz5I3hdlb+isWHl1WPR+BV4eIh4nI0ppf3SrSjiL
IxNSQQpVZXReLpPv+eT2vo/w9C46D3PTOMriS5lrSxRh1QVFLHbjBFq3f0J9xXDDLmXGm50EaW9G
Wjm8XstYS/qW32+PiTaLvuMdRF/m9SbDM3j6WFGfUpbl0gJ1Mc7vxcj5nmFumpoqRo4wKLN77brq
bJ02cw6slWwsokJpOG9GgTRhsF6TyxjhPTdr7DUak6MnjGIisFt8y+V7wzSe6Qhp44MvwbK3M3nB
0JJjOYeG2d3GFWXKKZlpiY1VenrsPbKNT/X6AuFV7Oe/JN1DNd+N7b5pO9mmA3YT265EtHcinDen
Oley5OgoYeF2yswz1SPIg3Y5y1LehE6bUXUhtbAyHrJWdH5mUL4h4soKldb0XdUdHnP5buKwbEuj
9Uz78bbLDeD9LSiuCDe/+ia5Yg1lBBRrHVcq5ugtDefNK+BG64pSfEpLq4y3iw+wAmcMl4mQFvui
rx9XHD2V9xTzMVdka644ZwqL8XpHb1pL5lITzXUgA5upRkGeiFM+N9lAMUdvKYNvaQHRAecOulqV
RjsejDD+Cn+JnpriChUJKpj0nTbJDQd/Ls4lo5V96RD6yMLcNPxFcWLDiwN2S8N5SwsI3eVdEvvj
0anNt23LrMANw9W1uM03+gqfnUTJDBP+euy2ZyqerOHTK027TPzKbHGqTQb/fnRTE2c33rtWfXZj
Hdw4V7AumZqePWpY5Y68KJxX6JVdICYMlg1qDdw2KgTvJo8/4q5QZWJw08kT6mBkCOfqVPIpmzq7
yQjz1h3SywIdxD6bKTrj0mBoJ85fDJ4dKp34tALkDsFdZuvmiz9bm88z5pIPZJ3XQUR4Y5AnCSga
E9ydIHc22Pyk6TPXqlr1Z26qathoOXdbVoGMI+jj+brQ4ai4m1VjgK04OexE0hQvUs3OvFSGAPHu
+UFkBxUPGdpePR2HAEixDji7Gf4YdaWhOASikwKdAty4zhU4B12JjOEx9f9G5gjXmcBdhyDqSMIn
yDjBhOqxT5hFnB1UPMfb+4qehV0N6dDagbkZ2oj0qE/sUi8S7MrQr2QUuLx8owKvp+RzciPveOhH
ffp1vX7iDDDx7mL3/OVuRccZ65kkzkkFlBN3sEkv0GO/92nayZMDY1MCJczNPnNtfHWlh7A6oWRK
iU0Z178k0X3d7CiGfOIA4jgEkZN12o2I6pLduvp+8YYv6vjmUkaPYG4aG2bLm522BiW50lJBxmpb
0eemIlZZ/GSzzVltPxifQncPSbT9+u1DsnUnniQphSuKrdv6jJZSezj/Ww0GPwSNTUZ/Qe2Fv5NO
MDf+A2PXlGkG9Xfp+pXcvihyqsYjMgn1/bzTUsNQZHGQ9+z6tjS9t6QZXUQOTQX3xHEIIjua9hwh
G8uZvDmGXtAG7vWMYwj2gqCkcnGS7yZSgJdqD7+bund7pnx8EW6CaWJZ9Z1W7MSa3jrVrJigRic/
G8uRRDuRlDoHcR1V2HYkoQsbxyEo5UZEhzrah6WKw0qyb/m87vqiqK7fUCdD0NdFuDVKGbOk+NOa
0youDr8bb+gyprsM0VRfqqyvjHYrW37qUMF16ksoP5FfvORXXP3tfuMb60Eyp2pzgruQZE/lgIbA
VluO6+WlWNhaCVbopU6saxnp3Mmgp4ed++VSejKqjXDiZ8DMJ9dN1CxOktPQKeZKLh5p+N2ULvg8
C2Ry2YmYGiHQ2i05pEoi2RoN7zUnLZPPGG9wPEGtVy24IZDpV+l+j93HRWyve/FXZTKkrw7FlFu9
nz6J4zeZWePiRv2aUagFOQuJKafbtD51UqdLJjhOVS55qNVkTkiuM0Q4u6mDVmFZffxgE6CUn/wK
3zoRzy1nHk+w1GUQbnCqjVKgQ8C+gU5mS17lqiTfpZOhGm2Ak+Q7FRafnQI8napcjsIeMfEwN9Um
cmEpeSaqCfxsLlH/+91Wb3Aa6PPARIx7CEonQ81I8YbD4qvPBZib6ljll5SrzJLMJ4LON/WoXPO7
KA4haPkGp7jDod4lhzwETFqdR/ZcOhk8IsUrhsXvl0o8e5rhZsr7VDMZomkH61mheiYo2RwIZp7b
qfPCrEjxPW9wCjqYOMlzb9jKozTT0ZhSgs89U/1hyLjiCWEIHLUlxqmjYsvVKckKkDEZKtEGWJeE
qbD4+PbCGAmXXj5xouymDy8aOdxM1Z/XOTXGFhEe2nV+XzfKe06gtLnpxjrvqbZfddxMNbF7GqMM
ceaYyN6iojQ1Z/jzznJ+TlB5y0/mrzY0e5K0jxHlw+4Tzm4Oe/xTvW/xLhlIpxAQlz8JgtAxwwRz
M+bR9ehbi3fJHtqMvYrOo+N/gxkWQjA3YY1Xi9q2f5fcovIQHQQCMDdBDFMnSrZ9l9xJJ9DIkBGA
uRny6HStG7ubsse6pKc7vouWnyq9gAz7pg8e3vmme/HwvGPneXnyQFHkIgEFMQF+eWGdRVqIjAy/
XfcH7Q0MAZibgQ1I7+qYtLx082mlMtGsdW9vRIUjPol57EQxlbpXfizPIhIZfnvvGhToGwGYm75H
AO0DgYNBAObmYIYaHQUCfSMAc9P3CKB9IHAwCBzRRps6+8/f259+PqV/D6bj6KhCIOhxD1T5QNX2
+85QZ//649dffv+Tqjvmht71k4ha4SJA8yDccQ9U+UDV9pvksrPS3ESICPeLPaNaYwvR9Aaip4pj
CNHsCbrOmkWIpp+NRi0gAAT2RQBHxfsiiPpAAAhURCDD3Ji8zSrzsc7eWlFicbE9k2YlSA8ypdVq
gjvbTEq1RuBhIRb+guo4tDzaQesftPKZU3BQPcowN+QL6ubbsSnS/L5UjWXMcnIYJHXxaYVIx2f3
7BQ7nEdkliSSN2JQE865YjyYgSmQsOGg9Q9a+cw5PKgeVdlMTR8tZ3aPryVnptc37MLzvbHvjS3N
tFKxCbVQOl9QpE+jCzgPhFJVOLNkJJJtiDQwr9eNQdaEduUygtY/aOVzTM5AplOJuTFpo4v43K7m
8yvnG6u3PLxLkalUOXrv6nnzLMpRolYJil7nyd2MbiIpzawGE5see2MVt6J2gLKJBJucsy0xebBl
4q/9LGr5F7BuCV7HUfLs+Xz+JXoKzNhwX4PWP2jlM2faUHqUeRFubZ8Mx7dgsuW/bPZrQ29rPlUs
yzJpFhWnLLCp7JAx/bdMmuWm+uNKui1HmqTctjd65rXdin6ThQjt+Q1VU+lvpSOcrb3TlbZ/Ea41
b+3esuW75Hb1D1T5ltUumCvtDkdmw9Uvwvk7+bk8K/9ZdtNcCcpbkaftUcQNT06yJVRMmpVKwZVt
vNOtlOYDkxHLj1NuYYjLB7GJ+ly+M79D+SAMr0TQ+getfOZcGESPSjZTihq79lzWFJS1K6Yr7JWC
qzQfWAMKtiNiIzdRTHmlD3HaaaglqUHrH7TymQM6kB5VOSpO6J+dns0UkhyUgmBpMy9IWlsxaVbF
FFxpjEvzgbX0PWtCLB0yvV5rYithcI7L0/820XBDMoLWP2jlc2zNYKZT+uwm6+CGSxWkZ0ukubIy
aFn15CmJfKonzXJTcMVoXi7XjrRYdtyEm+6r8eRw7ZzdmI5YB0w2aI2e47RwjtCd/oEq34LaBXOi
u+GocnaDmCn/r2875sZfH4+a3U59DwWLqgSqfKBq+w1e9aPihhbWEAMEgAAQEAh4nN0AOSAABICA
DwIwNz6ooQ4QAAIeCIDNzwO0UVUJmlkuUOUDVdtv3oPNzw+3cdYKmlkuUOUDVdvvCwA2P79T9mQt
3Ew1g6OvlECveAJV22+UcDPlZ6NRCwgAgX0RwFHxvgiiPhAAAhURgLmpCBSKKQRqsMNRuFtQsRcY
47YRgLlpG+Gxya/KDke2pg5Tj2FWGhte6I+FAMwNpkN9BMr57ohbcXtfh7Jst32vrwdqBIYAzE1g
AzYQdUvY4SiO/+x6Gm+/5hu5B9PUPZqJUb+xmZ8vVnfHhudxIL2EGg0jAHPTMKCHI276uJ4tFlEW
sfzu450J1vghw3K+IO7Y12umVVy9fN/xe19ebohmkUgGJLXGbnK9vGSWgCHSnB3OiLbfU5ib9jEe
ZwsV2eFk7ozZmg2JoDgia/P9Jbq5YGs0ub2fRe8fO+J8HCdI6JWLAMwNZoQPAnuywxm2R2WBfFRA
nfAQgLkJb8x617iU746YFAvoY5nvcfEgs2+YhU7vnYICHSAAc9MByGNqgg95xWGM8qjZzDmvj0zs
wwZEPtOvy3emj6WHT4FFcU4Etlpx8ixJwHxMR8fH+vqKDRSOisc0UTL7AnMz+iFutoMiMwY/6lSX
3XDk41x7k0U5fRAXTaqAzHihiyWl6GI4Km52tIYmDeZmaCMyFn3IonyePsCreCzj2Ug/YG4agRFC
shAgi4PlCqaGhQDMDaYDEAACHSEAc9MR0GgGCAABmBvMASAABDpCAOamI6DRDBAAAjA3mAMVEVBh
lfPnzWYnYqE45lJHXdKfV88b+R454LgBmYoix3bMoTaTYZqu/IpKoVhQCMDcBDVcPSq7+SbDKq+3
Dx/SHZhCKjnIkqIulQffQ/Qk4jDvjjkgU37Efn4Pp1xxfcYufqYHrgQq5sjvsaNouj0EYG7aw3Zc
kien7Ah89Tx5ZH8+uuN+u93Nj4RLMf/FcZgiOJyioC6XX6ei8xzJQNHh7C98xL7IdmSDK4Hr2fLH
hR16oxCAucFUqIaAcAT+vHkhy8G+e7xBojWMyXhfJGS21p7HthtOQkJCfjWlUCosBGBuwhqv/rTd
PNNOiG3CekaUEZvXhSSVKH0oGmphwqcsJ+OkBFd+qVgUCBGBDHNjjvDkUaB8qjij67M++u0refiH
LXFwWFblcD6vwT3eLSgvX8RUOGdGLdoyUVQmxVjKqMtnHYcpIjb5nQ0HZEYc+E00XBEX5dWQZaAS
EnZRZMvvtmdxa4MF3xuQYfVILnPt7FOfyxkfAtKvGHWRKdb4ZbweLkpvJapUKVpVoF8urY5qtZjW
joGU0IunNbiCTrHWlvItg9+W2gWzvuUeFbRcntZucvvIR372M32stG6uYIHVCuh8IX4bscTJgayc
e7wC1ijih8D4wB9Mj+qd3ZiFmd4JmTcSmy39vj5UNBsyeSC4JBJJ8eNdh6vfb+6EWquEezzUboWh
9/jAH0iP6pib3fPDgrdKtDRb3X3jExo67mOrkb6eYNps3lTRoihVhrf3Z2u+46hyIBTG/GxFywLu
8Vbag1ALgfGBP4Qe1TE3YmXy9YOZ9dUzvWafrqvvFy7RAO+YzLFgqgzzLUmypaZ2aOP8nlTkHh9n
5/vu1fjAH0SP6pgb4XZOmRHFgbB8RErFM+H+tdPvLc7Z98uwS2aW6Xs2Db/9PbnHh9/BIWs4PvAH
0qM65oZyla2is5Pow+Q7pCOa+YbPoS4tf1FxM0UmiQ6D1dFNusyQ59oAdCvlHh+AjqNVYXzgD6hH
6YtwdfVqppO5kFVHNJezGacL4rfpgGYmlzpsY8wRzmxtXl4ul06Zju6oO2mmnYtwC8XESFg34031
r4dL2aZUd703GpLaBfjdYt5Fj6pfhEc55qah4Ru1mHbMTaeQNTH15d6af28sTy01y2fL9Vp4D6kN
uLKYHGC1NNeTvj1uQnnftveoF6jafj0u97sZ7SoZHWsFATq/U8ZEbKtFG4nwbiconGgqOBXMC4eP
wxGilSEZrNA6ZzeD7QQUGxoCbni3GxQeWeHjQ9Mb+rSLAMxNu/geqPRUeHd2UPiBonO43Ya5Odyx
b6Hnuy3FZ5L7phvenRcU3oICEDloBGBuBj08gShHrpwyBu7hnbi1Ptl90wnvdoPCVRpfUAIEMroN
qglz0yCYhytKp+59o4fje6dE9ievMhK5fflPVRjHxIc3X2BuDm/M0WMg0BMCMDc9AY9mgcDhIQBz
c3hjjh4DgZ4QgLnpCXg0CwQODwGYm8Mb8xo9puC+Bi6QNNlaDVGbeY3CNTqEor0iAHPTK/xDb5wu
kXIvkHbPcytLXX5PdARDrZCF6eP99hgWZ+jzo65+MDd1EUN5hcBua4hIijChCAYvyMjS3W/ttJte
UlBpUAjA3AxqOIamjNlMCWYjO/M3++pxdkxJAOtmAefCz5wv/Go+vxKJYAT/WjIpuK6lswqlUolP
r88kSS2ekSAAczOSgWyjG8L9lx6yExzDfc6ZvykFOGf+3k2ul+xALNz48gO+Hx/fKEicy73dRk5a
cRaqcofPRNq7rFTilIuKUui10TXI7AUBmJteYA+jUU0ooVKAi6yZZAFY+clkYvpQMeA7kRR8t41u
LlgI7ZpIcF4q8TCQgpbVEIC5qYYTShUiUCngO5lW3CKcFcIrCcFAhIwAzE3IozcM3SsGfCeSgnPS
Xp07nNKPZwqhAPOzk3gZNYzuQos9EAB5qB8rItUaPXmoJqcmvmm1/DDvECNoTBpquEFjCtE43bOc
m3R842Qjc9KTxZSi7ipnPSukZw6UhTNQtf2+JonOgqvYD0auNXpz4w9NAzXVEXN12u0G2uxExCGb
G2ym9lgZomprCIi8SKCoaA3fngTD3PQEPJotRGD6CFszwikCczPCQUWXgMAwEYC5Gea4QCsgMEIE
juh0jLr1z9/bn34+pX9H2EV0qRCBoMc9UOUDVdvvm0Sd/euPX3/5/U+q7pgbetdPImqFiwDNg3DH
PVDlA1Xbb5LLzkpzg4tw/8tPXIT7Y9dEzUBvlANV22/EkLTXz0ajFhAAAvsigKPifRFEfSAABCoi
AHNTESgUGzoCmqKUsusJEh7zt6TksR8iv0i/OfT+jUE/mJsxjCL6QAhwtjyO41JpPPnv9YyjzFVm
PQ0S2RryWE68CQQ7QQDmphOY0Ug3CDBDT3QnKUfJrLxep6zK7vnL9h4ey90MR6oVmJuegEez7SDA
VGBnd8fzOQddpZcwm293Z9dT2XSSzDRFkKpLzJ83m53am803uhoTt4vXgsE9jz7VcKYKIe30ORyp
MDfhjBU0rYbA9HE9Wyyie05WnniIM/DyVL29c8hMMwhSo823lxti2vhxvX34oL2ZiFH/OiWDJl49
kfzJ7f2SX+TTp97ubCHVOjDeUjA34x3bA+2Z2ER9Lt/PS/LGuGSmGQSpRJQaCVL3iYwXJduiqNp5
lcKMzbS6+Tihj4roUxNCDnRQVLdhbg57/EfXe8Fc8UhLkCdziJPXxySZaaocmaAfPz5vXo7VXVc0
vZ4tHp53m+jkTVie3ffoRO3McplPU0JGB3mNDsHc1AALRQeOABmQ12t1DiwNzrF74U0UpYYhOUFm
mtG1DZGa0prmjW64VEKI6VeW+RpNI3r1fv4luhDWpog+NS1k4CC2qh7IQ/28s8Hm541bUxVdB3nD
TarWGZLblB+HgZSKqQIJMtMMgtQ1HdFIEfHa5XM5ozQ2/MSv+C/dHJdUr2W7KSGHHMSAmCn/yY+Y
KX/smqjp+b1lMxObjyYUqSfDU+16jQylNGKmWl0sQvjgEeCbpdMHeBX3MVA4u+kDdbTZLwJkceBV
3McQwNz0gTraBAIHiQDMzUEO+wF0Wkdolnjf1ESCpDYrsGb7gRdPmxsrsJZia/lpbJsrXL4bkxY4
8lC/TQS0m++PH1Xjo3bPcxFqVfxQ3GdVgWWiOvq8RqB8+xqlzQ0BKq4I9fVhfKHYvjZoAQg0ggC5
+daVs9vWrlK3iV7KVw2U70S58s3U9LGxUzXhYNmYtE7wQSPhIUCL6OO71UrEH9B6JRmJydGU82cT
Wyn7t5mfL7iGZsrRBTZcjh+1hTKbqXQ8Z0GUZt8YlgfKd6Rhobmx1pd6SSaHwexfzdsb0leOK40L
v+uMtAmeNVuzNPeRI6qQHKkjaNBMoAjoGMpP3vcQ4YSMs2RmCvIxVqGYL9GTvc/aTa456vKTfgyd
AhcfLxE761FljpFio8SgZMZzzh9OhVvfGRFgkJWikotEKz3iWRIo35Vm+eaGbP3xnVlfCq4iUuo9
Orlfi3GUoL/zYFAA7jn9LFAIGxWheq+nvBujz7/crcihaj1b0VjJGDj1kAO5k5Q+KSpKFugKD7Qz
LgQ47PvmgiarnJ3vH5GYhrNEuPhkwkXEo2I1ZQE3jFNGhcdl1rxSn5wKz+OiKM1hQFoQKN+Zgvnm
hszB5/LMUoTVJWPy8KGGhkZyxcbl6IhNvgoqofKz9ePt7dvbbcSfc7h/xvEaxbpRzavvF9L/IS0q
UaAzPNDQ6BAwQVLKMNTqYGkYpyUtN0qzVottFa4aKN9W+0Ju4WZqcvsobPxut5OGnw05r1RilUw8
Ss55vRnrRC/EARbRIFnXiq6ojAKtAgHho0RgcnFzyUHc8jdNLXSq97Q8jFPLKorSrN5eayVrBMq3
pgMLzgrRdG6maN+6pLAzFZIm9kPKMMi9kbDpkhRW7reMkZcLTxmzlviY17P0vglfSYlKFhhKDIit
B2Km+h2V3OAjvWmX8zQRu+nET1odMFPQLpAI46RwS57yl8uMeM6CKE0Xpu5jptSXSakh+tRV0Fii
s2lzk7745lFTgzHTpy8q2lX/KbTXYxNH4Op3tGmRhpM+J/ujROl+m2blG+kC/U7trNZhbvodk+6/
t430t1u1KwbKN9KzDCGl5qathscnF+am3zHt9nvbWF8DVduv/4gIb3VvCuFAAAjkIlDu5gfwgAAQ
AAKNIABz0wiMEAIEgEA5AjA35RihxEEiUBT8vZkjLtxnUsDc+KCGOqNHQMcrZHd0+ni/PYbFqT0L
YG5qQ4YKh4CAjlfI6yu5od5vZXZgPJURgLmpDBUKjgiBzDDxjQwTdlYtbiyxqiY5m6bXKsvdiHBp
uSswNy0DDPEDRCAnTPz89ZodTJ0wHbXKoUDAKXWEk1dR4hdFokJBPXGo4AC7OTyVYG6GNybQqGUE
8sLE7QjvWAU2MTruitKGb68zco+3rPBoxMPcjGYo0ZEaCNQKE5cJOb9tiFLl9fQrr3Lw+CEAc+OH
G2oFjED9MHEmy1mcHx2/nAruHPXstquzE+vvgCHpSHWYm46ARjMDQkDlD6dj4ePtPVOniGtv5ogT
lHArwcenXuyk3oLtyWXl2ry+L7HWqTWsMDe14ELhkSAgaLP5kae+zK4k/lDvv91OZYGYxmn3EdnG
he6oHk6fcIxTbz7A3NTDC6UPFAH3jFiwVQWWAWYIAwdzM4RRgA7DRUA53rxe2ylEpo+wNT5DBnPj
gxrqHA4CZp91OF1ur6cwN+1hC8lAAAg4CBzRcRi98c/f259+PqV/Ac+hIRD0uAeqfKBq+301qLN/
/fHrL7//SdUdc0Pv+klErXARoHkQ7rgHqnygavtNctlZaW4yMzH40ZIeXC1wFfc75IGS/gaqtt9Y
g6vYz0ajFhAAAvsigKPifRFEfSAABCoikGFuDBUIc3/oRzJ8lD6ibsWypcJUAcM4onhIUlQlVQWh
HBAoQ8BMNjWNXbqbstr4vASBzNXNmcg+aCXMTKe66xBYcnyQubkoqzhbMvYzXy9JxVxPq93zczXr
2GEv0FQQCIhc0ZSskVIvCrc++lumgLWd/ILoySCVzDA3OjO4pe/0sSLaIuSkYtlaeNyshcnjKLqy
ehxlhwv9MpTweS4CzKgVUZTmjkrQUtr1JwZu+yBQ4+xGbmJoR8MLTLGxSWxz9C6HLYJ6fTWfcyWb
j1FXEnYjJTN/8SpCcjMMjq4ht1ok8PhuRWZJN2k3h5XxPlPlgOrSr+b6jNbScw6NauPX84CwdLpa
w9ww54fY0byeir3N7vlhwanNyQqsmHuIdzlm1yUo0Kj0++kT74Q0HyNZg/N33qqtiT6EDE5S5uZ1
wRnGnUzwRl9jcK6eP/SbzBwgc5gzawAZnIsbNkqkFm+13ObmRcIPdQKg39kI8GRbLKJ7xHw3OUNq
mBvVLLG23t6+0ZdZbJy+flwRU0juc3mj6IgkexqxNq7YYB0dcaWY59XInF6T2Ti++n7xlvmboohj
V3d3L7JJMk9RpCmOuI3J5CRWJtHc6Wmh8CZhhazAERCbqM/l+zmyuzQ5kvXNjfVtpt0VLTbrniPz
YkQ8WUe94qiO1rEuHX7cplo11YDAau62RHgNqSg6ZgQEvwST3zBpKLK7NDfUe5ibzTc6JDk7iT7e
K6szOTnj7RjvvOjgJ+PUl05X5huxhjFksknhjsEhLvx4lXR5OnELJ5qblwuv3BMUHC0CNAdfr9VP
oaL9K7+fGC0aDXdMLjRSjtXWkkUvD/SBSuLvy9mMT3Lo3fjE5XK5Fsc79MxmfJYiC3BLRjDfLppD
Gi2TLh1VefGxeHQNs0zh9/giPPtjrYUUYDeXJVw34vM/ghh8UGuuTgvRAGYKq+kXfw3s2bdfF1pQ
ez+F2qyd6CxipvzBhrnxx66JmoF+bwNV22/EEDPV8PIQ4oAAEKiIwB5nNxVbQDEgAASAgEAA5gYT
AQgAgY4QAJtfR0APtpmgmeUCVT5Qtf3mMNj8/HAbZ62gmeUCVf7//s+7cU6mrF799ttvYPPzO2h3
auFmqgEQ9xAR6BUPqf1f//Vfe/Q7pKqyp//597+k0ji7OZyfGfQUCPSMAMxNzwOA5oHA4SCQYW4s
QjPF5Vfgw21IJ54FPUXjVH40Em0wBB7OAKOnQGA4CGSYG82eJ9y2hVd3AamVIZ04sdgncrrXEsle
S2KHM0bQBAiMBIGyzdTk4oaDn2KuCO9+e5PsFTMEeov17ggqAgEg4IdAmbkRlDGRoK3RBH2Szq90
35Rk7XNJ9lhbWeLqyuX7S7HzybbUZs2lB0xx9/mBgFpAAAh0gUCBuRE0WGQkaFMlwvFj5ofpVx3v
nadikrXPJdlTtYhLi1/dPMWEgGSCXHY+a7OWRQ/ocPd1gRfaAAJAwBuBAnMjQ+6ZlTOX7CrX2iRZ
+xySPbcWc/EZ2poUO1+yBZcesECsNyKoCASAQEsIlG2mIrmS0VzDdbQoZO2rIwhlgQAQGAUCpeZG
Ht4YPmDZ6d2W38t/Sln7rKp8Ci3kOcscLpBi5xsF4ugEEDhcBKRzse0PnuYeNusUQ+h3Kbj6HAY/
A6HehKk3FC+aS7InW5WJ84ws600pnN5I52Rw6QGzxHbl5I0ghq6Qzm4HQQz94l+l9UQQQ69sfsLc
xCyhVdQfUhmYm35HA+amX/yrtI6YqcNdyaLnQKBfBErPblpUT1xDVcrD26ISEA0EgEBXCPRpbjin
FD/IitrVaKMdINArAt2ZG0Ra9jrQaBwI9I9Ad+am/75CAyBQhoBFhyB4EMzfyGxXBl2Vz7szN8WR
llV0RRkg0DYCImk0XZiSG4bY49PflA1xjR1/M8DnmBsnTlL9QcnZ+ZXK0Z6MwORgy7hAssomyYZj
VzevKauuiv3UDeHHpZlhhpQaCHDSaJ0anI4AXq9xuFgDvcKimeYmESc5fRQOMuT1O/26Xj9RuGYy
AnNye08lKLjq9VQGbyarTB02nER1Vfjy9CsnBydPnOvp9Hq9prhQurtib7+0r19T3YccIJCBAAcG
n90dz+fzL9ETjE1zcyTL3KTjJEXs9uJ1s9tFkwnFMCQjMJU+s/Xj7e2bzOaeqGJrnK4uArNEXNbJ
2SU3tPn4UELIhl19v3jDmDc35pBUAQH+DVwsonsxmfE0hEDFsxsZsv367SMy6JdFYGZUsXV2q8sg
q+23XXRNL95fP06IYEeskmgrTb8zegvXUK8hBggUIyA2UZ/L93N1dgC8GkEgy9wYOghuQcZJClK/
1SI6mfJ7lSIw3Sq2slnV5WKI7Au/WC220qzR0c18w1vpy9V210h/IQQIlCOwkZsoZnjShzjllVCi
AgLpEE0TPMnGRsRJ8sPnJ1Z4k4njFO+Z0E1TPFElPn3JDuCU8ZqGHVk3RJcCM0HBNcjIKsRMVYma
aa9MSzFTNBGtiS5PE3mSN/Uccp6pXkM0mxrAnuTA3PQEvGq2BXNjfhaVgYnZEeIf3n07fcjmpuLZ
TYVlEooAgeAREM5hVmCNjrP58UNegODZDwGYm/3wQ20gAAQqIwBzUxkqFAQCQGA/BGBu9sMPtYEA
EKiMQL65Ic8DndRJ5e6VcQqVRVcoqFP+mgby5fsFlJucwhuhjRSiUlaVBN1x/5vtbQVAUAQIjBmB
HHPD+eJebp4eH98kobA4qKdX5OPbZGgsn8w1Jz8je69JU2WP4YkIuSh7yOni5uUYFqcMJ3wOBCoj
kGluOBFutOTgKOcR7n9N5O/N0a5QfmlAeZXsvaVC3P7Cy6vyPEJBIFABgSxzwzFNJn2cJUOme+H8
LDEPiPj1LwjptoqKZZHc3bjB5bqJXPk6XzC5GGsJR/Wz9yY2VqJVJ6499adwpvZJsVUBeBQBAoeH
QIa5UZmlHCwW52QkzheaBiQ7ZDwjpLs8dlw2Uyyf8gW/GYcrlTt49X76xE5ZyhpUyN6btbHiQDzN
ZpJKNKwQgL05vK8FetwOAnlHxXINYx7txS2dnTJCxnNCuqvEjnMjZfLTnW8iey+vdwybSaaqIrwL
DxAAAo0gkGduOLdlnScvpJtllMWO12mnQtmY/7H4VHtxfny3SiSCSKq6+3iv0CKKAAEgUAWBDHMj
QrkLn4yQccVvkwzprhQ7nmorS36VzsgyseN5MUmOvm2jjRzbpVxVs46xqmuDkkAACBgEsiLC+UzE
RGfrkm5UrD5KsSLXskK65fW5fDJix22aviL5dkD5WvIFkjwVLO6q6orJrGj6Plubz0U/XFVVpHt+
bB5CNPeNVtyvfgshmvspVK32IYdo5kSEG4NTDcFxlioDAeam33GHuekX/yqtV0vaS7c4nzcvXw7Z
q5b8eF5uPhEIjJ0AEGgMgfwgBrI4B/1dO/T+NzbFIAgIaAQQoom5AASAQEcIwNx0BDSaAQJA4IjO
ewiFf/7e/vTzKf0LRA4NgaDHPVDlV//rfx/ONPvtt9/++uPXX37/k7rsmBt693BQQE8lAjQPwh33
QJUPVG2/r4zsrDQ3oEavcp2XXQYX4f7YNVEz3Itw6v1//v2vJjAYuozEGOHsxs9koxYQAAK1EYC5
qQ0ZKgABIOCHQJG54YDpmM0ul+izKCRSMXDaReLXFleOxYXDRKL05+55blPpxPylJu4yIUj0H4yf
ftOgyVrxuIhYNMMpJP/Cc9AIZMVMyfdkPJETMuQQfdKHKkBJlEzHFtlBAI4wp/zncsnMpCJgKc6e
abVsl5ZRTbqprHbLIg8a3Ozi7CYXTB4nJ5yu0TyUqlmc3TQ4mVsSVfnsZvc9OqNJk0MuVU4k6jKQ
yjBzJUymD3/5vuP1yHeZD9yheqCg7s9lFtMM02GRmLv88ArkdR7CryfnddfZtWnFaUiFhqAbdOgP
gdzNFFmbk8frXHtjE31map9kIHXsDdkZsjdbYW6i0ws2N+JzQeonN3CT28fMvIVT1knVzYYNjJ/9
Tae4ZeZOPCMi/fn8S/RUzAQyBHWhQycI5JkbtjZTSWIjzUL8JIg+s9VMM5Ba9mYXndzQ2mXxuiFi
wK3iDYy5PSndQ2mOmTL6LzB+djJ9ChvhpehiEd0j3W3/YzEQDfISv3x/uVP0xNIsWI9L9FnUD5eB
1NibzY7WLmzI3j82H6fXUyNCEmMpDpqiHZMmaM9Z3oDxcwizS2yiPpfv50ieM4ThGIQO2eZmtzt5
UmdHfFaSsDeVFU8sQbS9eY0mk4gPf1Z351taQ4lH3UTRK5GdRbCeJ5ZVopzgSY4uTydpLTZzefcB
xs/KI9RewY3cROEorT2IA5Scmfjl+dsHGQT5iP3U4qEu800mA6myN2RRFFenYzbe76wkcnw2NLMW
PkobTgHBdx5WDixtlHbPD++xEQLjZ5+Tke7CX68VfYk0OI1mQ+yza2h7LwRSF+GKQVNeYxo6zehy
NosZjJ1rzbiM83bmjXTittu6K/1czpafFpmokhUL1700jeR91NlVOC7Cs25PzRimRjCfhtXvFhYX
4X64dVkrMUZtxkx19r238euwUZibLiduui2Ym37xr9J6Zb+bvdZMonIPDKRg/Nx/2CABCLSFQMsx
U10zcHbdXlvDArlAYIwItGxuxggZ+gQEgIAfAjA3frihFhAAArURAHlobchGViFQ/k05CoEqH6ja
fjOfOgvyUD/oRlgraCLLQJUPVG2/2Q/y0CpXeOVlcBFejlGbJXAR3ia6zcju8CLczxiiFhAAAiNF
AEfFIx1YdAsIDA+BtLmxuB85lFf/Od+YD1wSyLgA9S6L0NPtdMxBGjOEJmBRRRBIPLzpAo2AwD4I
pM0Ns0DIcKQZM5UQL9t6TeFTj1NBscdxU06AuIjQ5mgYQaHELG6SSDQ7v/hmfnx3JrhCf/y4fj06
vnvPUJ6D+uL4rH16h7pAAAgMCIHszZTk6Fyc0wKEiATi8HCluGVvNh/vNSxDNYbQAcEDVYAAEGgO
gbyzm+lXXmAQcZ8hEpBt3sx44WPszYbeqaFMPkOo3mM5O6jvc8MlKhtxNm5mz/Wsi6mP9WbP7Oyw
LasxRigKBFpDIPeoeHJ7L3ZUSZbOa8EVLO3N7vkjuqilWg5DKNOor4iwYD2zSD9Xd1sigzMc6pzU
5fydaTGIkpLXXUpDU+zu+PVabAO1cg8LTu1A76zuvrG6eIAAEOgVgaKbqdNLTp6Q/KqqdQ8Rbkk+
47pPBkOoIDZmgj76LD7zuVx+ldIVhzoXEjTGzLAVW0FTzLyQGglSwK8fV1waDxAAAgNAINfcbOav
J2/iyDZJ5ac5QL99q2BtNKGn7GoRQ2gmVWgSIcPQlH0S7RTnzRYRWKZZuAYAO1QAAoeIQLa5EeSP
dNUk74iSJOXK3izyrU02oSfjm8kQKgWKPZBrnuwRmTDhuVpr5ZeKa2y+3a2is5PoI+vy6xCHuqs+
I4tmV0gH2E6KPFSTP4qFhEUeulyKsxyR6lJT5llknzIDZgHXp0yykMkQKj6RF1wsJaafFOfS9KhF
jZEu2ooVNZotlRQurz5WpKdNE1dybxDEkOvojiya+TEAgcZe+AU1dEge6qdgOLVgbgrGKiZxpVdt
pOwV5p4U+M+//xXOlFG/UiGq7QcyYqYCXIIGqDKyaAY4aK2rjJip1iE+2AaQRfNghz6v4zA3mBIt
IYAsmi0BG7DYAnOT8NENoJPCz9gNIA1A63GqiCya4xzX/XpVYG6kP98Qnt3z8yZfj+JPh6D/wemA
LJoHN+TVOly0mRKeLv0/HOGwzVXD/lQ4EovIdDy9IcBLTPLkFnEm/DAJwEqE3yF0rbdBGUrDuW5+
FBw5f7W01M5bZs7YQZUxQ421AysNocwJuZzPaUt0pCYnCeHZqidrIurS/nTDOynWWi2EXIW1Mo7w
oQzCqPQQNp8fZfdl0Ao/FTzBR4UEOpNGQM4E53pceNPJ4Eb5Qrrvsaeccd8STnSyjPCg0zQ3yrtO
Oloot7zZWrncaZnyU+OZYRKHy2Ikz0j7QS+VNqqGUUw4BNqfqvbiph2FlWKOcD9XAlMLfjd7Arhn
dfjd7AlgB9XL/W4EKY0ImBTB32JBzBxaZycT8QdHKGQHVWaa87wQSiEiK+Ty5iJuJ5pMTmKpqahL
51O79ZTC6sNLRzh+foAAEOgSgX0uwisFVRZ3pk7IJUlC1GWXcwNtAYGGEcgwNzIWkpcwJrpxckq7
HM35wAuf/KDK3ZbOBas8dUMueZFVOeoypXAVjVAGCACBdhHIOLvRhy6XzHejDm9M8KVZj9hBlfpc
hUqrSvqMhN+JgzvtEMr4bEc1kROZabWTEXUZfxqHi0oVdTyn/Cs37HOP/SvObvYAr4GqOLtpAMSW
RSBEszGAYW4ag9JLEMyNF2ydVio/Km53NQXpQAAIHCoC+xwVHypm6DcQAAJeCMDceMGGSkAACNRH
4Ih2clTrn7+3P/18Sv/Wl4AaYSMQ9LgHqnygavtNdOrsX3/8+svvf1J1x9z4iUMtIAAEgEABAklz
Q38DLyAABIBASwg4q5uW2oBYIAAEgIBBAEfFmAxAAAh0hADMTUdAoxkgAAT+G5V22SmckKDRAAAA
AElFTkSuQmCCoEYd8KM0AQCW5qDgLXeZlz8oD5Ia7+mb///Y/+AAEEpGSUYAAQEBAGAAYAAA/9sA
QwABAQEBAQEBAQEBAQEBAQEBAQEBAQEBAQEBAQEBAQEBAQEBAQEBAQEBAQEBAQEBAQEBAQEBAQEB
AQEBAQEBAQEB/9sAQwEBAQEBAQEBAQEBAQEBAQEBAQEBAQEBAQEBAQEBAQEBAQEBAQEBAQEBAQEB
AQEBAQEBAQEBAQEBAQEBAQEBAQEB/8AAEQgBwwKdAwEiAAIRAQMRAf/EAB8AAAEFAQEBAQEBAAAA
AAAAAAABAgMEBQYHCAkKC//EALUQAAIBAwMCBAMFBQQEAAABfQECAwAEEQUSITFBBhNRYQcicRQy
gZGhCCNCscEVUtHwJDNicoIJChYXGBkaJSYnKCkqNDU2Nzg5OkNERUZHSElKU1RVVldYWVpjZGVm
Z2hpanN0dXZ3eHl6g4SFhoeIiYqSk5SVlpeYmZqio6Slpqeoqaqys7S1tre4ubrCw8TFxsfIycrS
09TV1tfY2drh4uPk5ebn6Onq8fLz9PX29/j5+v/EAB8BAAMBAQEBAQEBAQEAAAAAAAABAgMEBQYH
CAkKC//EALURAAIBAgQEAwQHBQQEAAECdwABAgMRBAUhMQYSQVEHYXETIjKBCBRCkaGxwQkjM1Lw
FWJy0QoWJDThJfEXGBkaJicoKSo1Njc4OTpDREVGR0hJSlNUVVZXWFlaY2RlZmdoaWpzdHV2d3h5
eoKDhIWGh4iJipKTlJWWl5iZmqKjpKWmp6ipqrKztLW2t7i5usLDxMXGx8jJytLT1NXW19jZ2uLj
5OXm5+jp6vLz9PX29/j5+v/aAAwDAQACEQMRAD8A/v4ooooA/Jj4h/s+fCb9pn/gpd8ZPCnxw8Pa
p458MfD79hj9kfxD4M8PS+NfHWgaL4f17xv8ff24tN8W6zZaZ4V8S6HZnVPEGn+CvCVjqd9cQzXN
xaeHdJt2kEVnEq+z/wDDrf8AYS/6IZ/5k34xf/PBpfBX/KU39pb/ALMA/Ye/9aK/4KE19/0Afn//
AMOt/wBhL/ohn/mTfjF/88Gj/h1v+wl/0Qz/AMyb8Yv/AJ4NfoBRQB+f/wDw63/YS/6IZ/5k34xf
/PBo/wCHW/7CX/RDP/Mm/GL/AOeDX6AUUAfn/wD8Ot/2Ev8Aohn/AJk34xf/ADwaP+HW/wCwl/0Q
z/zJvxi/+eDX6AUUAfn/AP8ADrf9hL/ohn/mTfjF/wDPBo/4db/sJf8ARDP/ADJvxi/+eDX6AUUA
fn//AMOt/wBhL/ohn/mTfjF/88Gj/h1v+wl/0Qz/AMyb8Yv/AJ4NfoBRQB+f/wDw63/YS/6IZ/5k
34xf/PBo/wCHW/7CX/RDP/Mm/GL/AOeDX6AUUAfn/wD8Ot/2Ev8Aohn/AJk34xf/ADwaP+HW/wCw
l/0Qz/zJvxi/+eDX6AUUAfn/AP8ADrf9hL/ohn/mTfjF/wDPBo/4db/sJf8ARDP/ADJvxi/+eDX6
AUUAfn//AMOt/wBhL/ohn/mTfjF/88Gj/h1v+wl/0Qz/AMyb8Yv/AJ4NfoBRQB+f/wDw63/YS/6I
Z/5k34xf/PBr5g/aW/Y0/Zz/AGbNX/ZO+JPwP8C6p8PfGzftv/sveFJdd0r4jfFC7kufDXi3x/Do
3ibQryz1jxnqWm3ul65pNxPp+pWd3ZzQ3NrNJDIpV2B/Z+vgD/goP/yLv7J3/Z//AOx7/wCrSs6A
Pv8AooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKK
KACiiigAooooAKKKKACiiigD8bPgr+yH+z9+038cP+CgXjf46+C9U+Ififw9+2nqPgXQdR1L4hfE
vT00bwfo37NH7M2qaX4d0vT9C8YaVpljpdlqGu6xeQ29tZRqLjUbqRizSGvpP/h1v+wl/wBEM/8A
Mm/GL/54NL+w9/yUX/go3/2f/wCJP/WWf2Ua+/6APz//AOHW/wCwl/0Qz/zJvxi/+eDXC+Pf2Av+
Cbfww0+w1Xx18KY9BsdU1FdJ0+Z/iB8db9rrUWtri8W1jg0vxrfXG821pcTbmiWMLEwLhioP6dV8
0/H7/kcf2af+y5WP/qG+Lq+I8ReIM04Y4Sx2b5L/AGf/AGpHH8P5dg55phcRjcvo1M84iynI5YjE
4PCY7LMRioYanmM8QqFLMMHKrOnGDr04ts+l4RyrA51n+FwGZfWvqMsNmuLxEcDXo4bFVIZblGOz
JUqOIr4XG0aEq08JGk6s8JiFCM5SVKbSR8beDv2Mv+CWnj7Wl8O+FvAem3+uywPcW+lXXxE+O2i3
17FFnzTp0GueMtNfUXhUGSeKwFxLDEDLKiRAuPX/APh1v+wl/wBEM/8AMm/GL/54Neu/tfWdrF8H
rjxVCsUPizwV4q8Ea74G1RGji1HT/ELeMNCsFXT5jiVmvrK6uba5tI2xdQn51JhRo+A8R/GjUdb+
JnxJ8Py+Lfid4N0DwFfWnhfRIPht8LL/AMaS6n4gXTbbUtU1nxJrCeEPF9l9khlvoLOy8PW7aTcz
WsJu7mWP7RE8n5tmHjFW4BzzMOFPEStk2ZZtGPDOKyTM+HKGH4Vy/MsLxNhuNa0cPjcJxZxVjMLl
OLyp8A5y69apxLiaePp43KFhqFHE4iphqf2OE8PaXFWWYTPeEaeY4LAOWdUMywWcVaueYvB18mrc
N0nWw1fIcjw9fH4fHLirLlTpxyajPCzw2YOtVqUaUK0uA1f/AIJxf8E8tB1bw3oerfB6Oz1XxffX
mm+HLR/iP8a5G1S9sLCbVLu3jkh8dyQwvDYW81wTdSQI6xssbPJhCvhn/gnB/wAE9PGOlDW/Dfwc
XU9La81CwF0nxG+NlsDd6Vez6dfw+VeeOrecG3vLaaEuYhHJs8yF5ImR26208ZeJvHOtfskaz4w0
u+0zxHB8TPiRo+ovfeH9S8L/ANsf2T4J8TWdr4htND1dI9Q0+11yyjttQW3njjME808CRRJEsa7v
hP4u/ERvB/wx+Ieva2t/4dk+MHjnwB8Q4/7O0SwhXQdQ8U674U8Ga7cXUWmxmwt/DGrWOjw3j2kt
mdQi1KVr9rhlRo+XKfHrAY7OMfPEYbEw4djTo4/L3QydvMaOR1uHvB7NcVmue4qvn1KjgI5BX8TM
Tic2o4TLMequTYCviMPWp4nK1Sz7fHeFuKw2X4aNKtRlm7nVwmLVXMUsHUzOlm3H+BoYHLKFLKp1
MU81p8HUKOAqV8bhXDMcVTpVac6OOc8r5X/h1v8AsJf9EM/8yb8Yv/ng0f8ADrf9hL/ohn/mTfjF
/wDPBrrfiH8c/GmgWnxl8VaJcgeH/D/i7wp8GfANuNFi1eI+N7ye1i8ZeKbyws7d/EGrNod3qiaX
pmlWd1Ja6hc6TLbppc1zLI7L4O+KPiW3+IngTRtJ134u/ELw94nkvNH8Yr47+D2seFR4evxp815p
/ijSNbi8G+FLCw0hr62On6hpGpS6q8MF7DPb3DvDJIvt1PH3gmGf4fh5Us0liq+PweB9pKeS0bwz
LizNeD8tzDCYGvnNPNs0y3GZhk+Kx8cTlWX4x0sinhc2r06dDEQR5sPCviSWVVs2dTBKjSwuIxXI
o5jUtLB5FgOIMZhK+JpZdPAYHGYfCZjQwro47F4dVMzjXwFKc6tGTOR/4db/ALCX/RDP/Mm/GL/5
4NH/AA63/YS/6IZ/5k34xf8AzwaveFdW/aE8ZfC7xl8VtM+K8v8AbGiXHxCsvDfguDwd4VfS9Ug8
F+LNUjhi1Kc6LcX0ur6nZ6XcaNbvp6W0awvYyEfbTd3Uvtth8UL/AMf+OvhNpvgXUfs/hrVvAd18
VfG0qW1jdtLoGpwW+meD/D6X08F2tteXmu3GoXGox2qW16lt4fuY1u7cyNHJ2ZD405HnmHyrET4d
4pyiXEWF4WzDhjDZnSyCWK4jyzirNo5TQzDLKWWcQ5ilSyfnpZnxDRxs8Ji8syivRxv1evzulHnz
Tw4zPLauOpRzfI8wjlNbO8LnVbBVM1VDKMZkeAePq4XGzxuU4NupmHLPBZTUw0cRh8bmFKphvbUu
VTl4J/w63/YS/wCiGf8AmTfjF/8APBo/4db/ALCX/RDP/Mm/GL/54NfQX7Qnirxt4Y0T4fQeAdZt
NB1vxd8W/BXgibUb7TbXVraLTfEZ1K3ujJaXUUoYxvHBcI0JhnLwrGJ0jkkDecpZ/FtPjDqHwcX4
2+IpNDvfh5Y/Et/E0/hfwS3jLTZ08Saj4bm8PaLdRaFFoEGk30pstQuZtR8PanqEKWRs7C4tftlz
dHu4g8VcLkfEdXhqjwnxVneJoY7I8rqY3LHwzRy9ZnxJg8fjMowUZ5vxJlmLnKtDL6tPEV1g/q+E
nUoSq1XTnOdPlyrgatmeT085qZ9keW0KuGzPGww2NWdVMX9SyfEYXDZhiXHAZPjaCVOWLpyo0niP
bV4wqqEFOMYz4P8A4db/ALCX/RDP/Mm/GL/54NH/AA63/YS/6IZ/5k34xf8Azwa6LSviP8VNUtfB
fwoTxfDH4y174rfFvwJqXxPfRdIXUU8L/Cw3t3dX9noP2V9C/wCEo1S1ewsbadrB9OgWC4u57GSe
TzU0vGnxP8c/AbWvGWkav4jufiVpH/CovEnxF8G3HiWz0Gw1zS9f8O61p2kS6Jrd54etvD1pf+H7
uTxBpt0l8+nW1/BFbXVrHPJ5ZkHiLx64YhldfiDF5JxPgeHMteW4biDPcRhsnnheHc4zTIMHxFQy
XMMLhc6xGZ4rFUcFmWVUMTislwOa5UsdmuCoUMfiKax1fBek/C3O5Y2llVDMskxOcYxYyvlWWUq2
YRr5vl+CzWvlFTMcJWr5bRwdChUxOEx1WjQzHE4HHPDYDE1auFpTeFpYnyvxB/wTh/4J5+FRop1/
4Ox6cPEXiDS/CujGT4j/ABrm+3a/rLyppmnJ9m8dzeVJdNDIFmn8q2j2EzTRggnoP+HW/wCwl/0Q
z/zJvxi/+eDW18SfBfxJ0mP4A6x4p+KOo+NjL8cPhTP4p0i+0XwrYaRbavdatObe/wDCc2iafp2o
WVjZyXL6YdPvr3xAL60lgvvNt5raWWWnqvxl1rxN4w+JMD+Ofip4GtvBni3WvBXhbSvh98H7/wAd
aPNeeHJbWG617xVrI8F+JItWOoagk6f8I7Yajor2OlGNZLgXd19qHlYrx5pZHmmaYLivhjMsgm8R
klDh/Kcxx3CeAzTFQx2Q4vO8wxOOzPFcWrhmFLDvDxwNClDNaWLljpOh9XrUY1MZS76HhdPM8Dgc
TkWdYPNYqlmVTNsfhMNnuKwNCWGzXD5bhKOFwVDIHnU51VWeJqVJYCpQWGiqvtadSUMPOj/w63/Y
S/6IZ/5k34xf/PBo/wCHW/7CX/RDP/Mm/GL/AOeDX1v8H/FmveOPht4U8UeKNGuvD/iHUrGdNY0u
8sLzS5or7T7+70ya5GnahHFe2MGotZf2laW1zGJYbW7hRi+N7ek1+5ZJm+Dz/Jsoz7L/AG31DO8s
wGb4H6xRqYbEfU8ywtLGYb2+HqpVaFb2NaHtaNRKpSnzQmlKLR+ZZlgMRlWY4/K8X7P61luNxWAx
Psaka1L6xg69TD1vZVoNwq0/aU5clSDcZxtKLaaPz/8A+HW/7CX/AEQz/wAyb8Yv/ng14Zpf7Nnw
b/Zh/wCCiX7I1h8CvDOqeAdO+JH7P37Z6+OtLtvHPj/W9K8T/wDCIa1+yvc+GH1TTPE/ijW7CWbQ
59d1iXTp0t0mt21G62yYkIr9c6+APjP/AMpHP2EP+yAft5f+nT9kGvTOI+/6KKKACiiigD4A8Ff8
pTf2lv8AswD9h7/1or/goTX3/XwB4K/5Sm/tLf8AZgH7D3/rRX/BQmvv+gD4K+OWofByy/aU0Vfj
b9gfwvJ8DZG0yPUbLWb+3/t9fH0ohdItEt7m4SYac2oKJJEWEoWVmLmMVV+HuseBdP8AixqPiT9n
ex1VvhjpHws8T6h8S0t4fEWl+CNR8SafLDdeD7Syj8QWyhfFCQw6mLu6061bytJmG8uWuo3+m28F
66f2g4viKIrf/hGV+Dc/gsz/AGlPtY11/G1vrixfZP8AWfZzp8bP9p+4JB5R+YivRvFOn3OreGPE
elWYRrvU9B1fT7VZHEaNc3mn3FtAHc8IhlkUM54UZJ4FfyzhvCjPcw4l4u4rqLhzJ6mB8Rsz4myX
FYfgKcfEPHxy3C4OpgKGF46rcQypvIc2r0p4HGYGnwxUjjsmq47KHiOXFTxEf3Ctx3leEyfIMig8
3zGGJ4QwWS5lQq8UxlwlhXjK1eGKq1+GKeUKazTAU5rFYfEzzuDw2YwwuYey5qEaUvmHR/2h/H0n
gTSfiXr/AMNtJtNB8dR+EtM+F/hvTfE9zeeLPE3izxVcW1rY6fqbnRv7K0bS7wG91O2v/MuprfS4
Izd2wunMA7e2+Kvjbwj4x8PeFvjB4f8ACekWPjKx1y48OeKfB2u6nqem22peHNNfWdU0PX7LWtK0
u9tpm0iG6vrHUbE3lvcG1lt3t4mzJHz0vwd8Yv8AAH4TeELG50ey+I3woj+H3iXSY76W4ufD134q
8EWqK2k6hc2ZiuP7M1BXu7F723VzC0sdyIZ442ieWbwh8S/i74w8J6p8SfCel/Dvwf4Gi8TXEei2
Xi5PFeteKfEHiLQb/wALJdJc6bZ6fp2k6PpmkapqU0Ml0tzqk93crD9jtomkmTLBYrxgwEOHcNiM
z43zHiLFZf4aY/A0sXw7ls+HcdiM1zKNbxRw/GGZ5bw5h8DkUsny6piqWBwOIxmSV8Nh8LlkeH4Z
rm1XHUa94ih4f4p5vWo4LhnB5RRxfGWFxVShm+Mjm+Fo4HBunwTV4fwWMzeric0WYYuFGeKxNHD5
lSrVq+NebTwOAhhqlHxb44/Ef4meP/2c/E3jKHwNoNj8NPFtvoU2kyL4mu38cWGhTeJ9Gl0rxNqu
mNpCaPNZassETTaTZ6mNR0y21SCaV7xLK8D/AF5ofxDk1j4q+PPhsdJS3j8F+HfBuupq4vWlfUG8
VNrYktnsTaotstkNKTZKLqczmZyyRbQD81a98P8A9oC6+DN58ArTw54au7LSdDsPD+nfEufxcoHi
Dw7ol7bvpVgnhmSzW/0/XbrS7Oy0zUp77UP7JtsXt3aS3Y+zWj+na94a+Jvg74xeJfiN4G8JaP49
0vx/4V8LeHtSsLzxVD4TvvDOp+FbjVzb6hLJd6dqEGpaNe2mrEzCzDanDcwlEs3h2ySebwxjuPcr
4ow3FuYU/EXH4fE5X4VZV4hVc04IrSxcK+Cy7xsqcR5XkOVZTw9Tx+Z5VlfF+e8J4ieM4cwma4ah
QxtOtgs5xeQQxMsP251heFsdkdXIMJPhDC1qOO45x3CUMFxLTVCVLE4zw2jlGOzXH4/Np4XBY7G8
P5Xn1GGHzivga1Srhp08Tl1DNZUVVp237Q2pavpdla6B4Otrzxt4i+K3jz4YeF9DuNcli014/A1z
qQ1PxbrWpR6VJPaaVYadYrqGoWdtZXFwzyxWVrO0kySpxHxw8d/Gmx+EHxm0nXvCem+G9W0bwpBq
dj468J+I9c/4RzUdB1Nri0v00W/k0a31Sz8XaVdRw29xot79kiutOu31CHUoohBHdR+HPgj8UPCm
i+GfFUEXhzV/iV4G+L3xK8bQ6QdTk0/w/wCKvDfxIlubTxDp9tqDW13Jo99cWVyt7olxeW0n2O5t
Yob+Hy55kHXeL/CHxu+MHgT4r6V4mtdE8BWnibwOPDfgzwANV07xGY9ejmlv7rxH4j8VWGmQPC2o
yLa6NZ6fp813Y2VjHJqFzbyXrBTw4zFeLfEXBXEGV5/LxLwnF2b8GY/D5HlGTcMZXQyXGYXG+G1d
4upxJnM8ohgcoz7/AF2qZhglg8JneEzmCwnD7yrLKuX47Mq2J6cPQ4ByjiTKMblceDa+QYDiPCVc
0x+Y51jqmZYevhuMqPsI5Pl0MwlicflX+rUMJiHiK+W18vl7fNljsbTxeGwdOjPpvjaz0D4j29x4
58K6Pp/ibQv2b9W8Za14s0LXtY1iK28KaV4vXfoFpZX2m6RHdedb21vrdzeyWUF3HqAk02Fp7SNL
qaOX44fEnRfB+jfF3xV4A8N6f8LNZHh68uLXT/FN3e+PfDfh/wAT3en2mmeIdVtH0eDQdRSMX9vd
32kaXqBvraC8hQSSy2l4FZF8L/HHjbxbc634x0iy8IWPiL9m7xF8IdYh07XLXxDcaVrOp+KZjDPb
SLbWKXkcuhbNVDeSkNvdSnTXlmaE3EvO6l4K+P3jT4d6Z8CvEnhvwromiwweHtB8S/Fmy8Wyah/b
Hhjw5e2kjT6F4Q/s+LVLbxDrdpplpFdR6vejS4Hub475Ekijg7auY+J2AwOcf2XR44wbxGD4kxfA
ry3gfCwq8Q8YfV8kXDcOPac+HIVsqwWLheOLx2eUeHsBNVs6jm+a4XG5dlscHz08HwVisTl316pw
ziFRr5Nh+KPrnE1eUMp4f9rmLziXC01nEqeOxOHnrh8LllTNsVB08ulgMBXwuMxssR3k3xV+KfiT
xh8TfB3w38C+EbmX4Zavp1heav4u8V6lp9rrg1Twzp2uWlhptppeg3ktvqTz3dxFNNeXKada28Vq
7TSyXci2vqnwr8f2vxS+H3hfx9aadPpEXiKwe4k0u5njupdPvLW7udOv7P7VEkUd3Hb31ncxwXax
Q/aYFjnMEBkMScz8OfA+u+GPiF8b/EeqJarpnjzxX4b1jw+8FyJpZLPTfB+laNd/a4dqtbSpfWky
Kjbt8YWRWKsKd+z94L134d/CDwd4N8SxW8Gt6LDrCX0Vrcpd26Ne+IdX1KAR3EfySZtbyAsV4Vyy
HlTX6jwPLxEjxVhKvEWOz/F5Tm9DxeqZhhMyy7LMPluT1cg8SMny7w6p4CpgsqwWJw39p8G47NMR
TWKxeKlnOHwkMxlKdTDyqv4fiVcIyyKvTyjC5Vh8fl9Tw/hhcRg8Zja2MzCGa8HZhi+L54qGJx2J
o1vqXEWGwVKfsMPQjl1WvLCJRhWUF8peG7278J/tffEHxg9xINA8SfEDSvhBriSzs1va3niP4ceG
/Engy5htS3yzz+INAudHM6LtX+2lWUfOjLpfG57rxT8ePhjr8dxdLofw0+M/wt+HWnxxTFrG98Se
LYL7xh4xmDQuqNLp+mWPgrTZraZZzFObjJhkDIfSte+CXivWIv2kzG9jZah478S+EfGXwz1KOeKa
a08Q+C/DugyaNdXG9Y20yVPEmhx2zzB962UssqOyOVZzfB3xpJ4M+D0N3Hpdz4ysPjrofxi+KFxB
dRw2rXt3ca/qHiFrFyqR3X9mHU7DRrCG3jjWay0+AxIFUk/gVXgTjl5NxTwe+HM9nkWZ+I/Efi3G
s6FV0a2Oh4nZvgsHwzSoQftuWo8Nw74mYGfIqVdLFYj2k6XLTf6rT4o4YWY5HxB/a+VxzPBcHZNw
FKmqsPaU8NLgrL8RiM6qVZL2XNBVs44MxMeZzpv2FLkjO8zUj+MPxQ8VW/inxb8NfAXhbWvAHhLW
Nb0dJNe8T6tpXirxrJ4Wvbiz8QXPheytfD19ptlbie1uLPSf7YuxJfXVu5kS2RwiTR/HXWvHt74N
0b4L6DoWtah4k8BWfxK1bUvGur3mjaN4a8P6ldS6bpmnXEGkafqurXuvX2qW1/btDFbQ2dpDp0ly
bi5juYimPo/h345/DLTvEHw68EeGfDvirw9qeu+K9T8FeOtV8XnRv+EOtPFep32t/Y/FGh/2fdap
qr6Jqmp3htp/DzEXtssG6KzlLpHV0b4S+PPgle+Ddc+G2m2XxISy+GWi/DXxn4f1PxAPCuo6jdaF
qV9rGl+L9J1G9ivtKIW91nW7e90q9jhnhsbi3ezu7y4Fwr/cUs48WX/ZbxeM8QYYL2OFfitVo8HU
frvDub/2thf9k8MKNHh6vX4kyetSnjMHmGJyahxXKjw9QweY4PG0+IqmLqVvmqmX8B/7asPh+EpY
n2lZcCwqcQ1Pq2b4D6hW/f8AG1Srm1Kjk2YU5ww+IwtHMauRKpm9bE4TEYaeUQw8KfC/Df4rXXw/
0n9onxb4r8OtbeJLv4/p4c03wbHrMDR3vifVvD/hSwsdNtdfntorWHSZn8/WJNYuLKFLfRI7jUZb
Pzka1b2Pwt8aNfTx74b8CeO4Ph5NJ43ttVPhfXPhz4wl8Q2UGraLYtqd7oPiGy1Ky068sri506O5
udK1C0a6tr2S0ntWhhl2tXm918APiB4w8L/EtvF6+EYvFuvfGXw78XfCunXEr694Skk0Pw94csIP
DXiOK604yXulfZ7TUvDl45sc3KxJqUdssMkdue08A+AvEMvjjQ/ENz8DPhL8HNG8OJqpvP7KtfCX
iLxX4i1C7sza6dLomr6H4d03/hHdNsjJcS3U8lympXqSCyNksE0ssPi8HvxgybHcK5NTXE2ByRZt
ha+Dji+GatSWa4DMvEjibFcXYnip4XIJZXkuPrcOV8HilDMM54co4SlWweK4XweaY/67ltf0eIV4
fZjhc8zGTyXE5l9Qr0cRKhnVOCwGKwfB2S0OH6ORqvmqx2ZYWnnFLEUHLCZdnFWvUp4ijneIwWF+
rYyn9TV8Af8ABQf/AJF39k7/ALP/AP2Pf/VpWdff9fAH/BQf/kXf2Tv+z/8A9j3/ANWlZ1/Zh/Op
9/0UUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFA
BRRRQAUUUUAFFFFABRRRQB8AfsPf8lF/4KN/9n/+JP8A1ln9lGvv+vgD9h7/AJKL/wAFG/8As/8A
8Sf+ss/so19/0AFeP/F34X6l8So/BU+i+MJPBWt+BvFsXi7SdXTQrPxEpvItJ1TSVhk0+/urW2ZP
L1SSXdIZl3RhTEd25fYK8i8bfHn4S/DjV00Lxt4xtvD+qyNYRxW11putzLNLqh26fbw3NnplzazX
N4+EgtYp3uJJCIxHvIU+NxBw/lXFOUYvIs7oVsTluNeGnXpYfHY/LcQqmDxdDH4Sth8wyvFYLMMH
Xw2MwuHxFHEYTFUK1OrShKNRWd/RynNcdkmYUMzy2rTo4zDKtGlOrhsLjKThiKFXC16dXCY2jiMJ
iKVbD1qtGpSxFCrTnCclKDOStvgZ4h13XPD2r/Fv4ra18TLLwnrEPiHQfC6eG9A8HeGRrtomNO1T
WrDRUmuNcn0qcteabHdXsdtBdHdLBPCXhk1dZ+Enia28XeJvF/w0+I7+ALjxt/Z0/i3SrrwjpXiz
Sb/VtKshptrr2nQXV5pc2lavLp6Q22oSefeWeom2tp7mzaeMyP6v4Y8T6H4y0Ox8SeG77+0tF1L7
T9ivfs15Z+d9jvLiwuf9Gv7e1u4/Lu7WeL97BHv8vzI90TI7b1fKw8K+CaeGlQjgc2eIlmlPOZZ3
Pizi6pxW8yo5diMno4j/AFxqZ7LivlpZTi8XllPDrOfq1PAYvFYONFYfEVqc/dlxzxJOsqrxWAVF
YKeXLLY5DkEMiWDqYyjmFSl/q9DK45FepjsPh8ZOr/Z3tpYqhQryqOrRpyj4XbfBCG2l+D883jPx
HrNz8Kdd8Q+IZdS8SStrWseK9R8SaTqunXrX+oS3EIsIoptWmntILa3lt7W2httOgiihiElM0r4E
6RZfBzxN8HtQ1eXVNP8AEsvjS4k1ZrEWk9ldeLNc1LxBbXVvax3smZtB1C+gms3+1oZ5bGKR/K3l
F93rkvGvjrwr8PNDPiLxfqo0rSzfafpcDR2eoapf3+qatdR2Wm6XpOj6PaX+saxqd7cyqlvp+lWF
5eSKssog8mGaSPWj4X8B4eeKqU+HqDeOyfH5BjI1cXmWIp4nKMzyThvhzMMFWpV8ZUpTp4rJeEOH
cDVnKDrOOXe1VRYjF46tic6nG3FFWNCMs2qpYbMMLmuHdPD4OlOjmGCzLOM3wuJp1KWHhOM6GY59
m2JhFS9mpYv2bg6NDDU6Pmtn8A/DkXwYtvg9farql5HF/wATKXxfGsFt4ifxgdbbxO3jGCSRbtIN
WHiJ21CLzWusRYsZ5biAyeZc0D4a+PE8UaH4j8d/F/V/F0HhmO/OkaBo3h6z8D6PeXuoWjWMmoeK
rfS9Rvv+EkmtrZ3awtpPsOm2V47XkVl5mxU9ojkWWOOVN2yVEkTcjxttdQy7o5FWRGwRlHVXU5Vl
DAgPqqXhnwXh6uSVcLlWIwf+r+XZBlOXUMDnefYLBTy7hWvPE8OYTNcBhM0o4HP6WS4mrVxGXf29
h8ylhq9atVhJVK1WU5nxnxHVp5lTr46jiP7Wxea4/F1cTluVYnExxmeU40c4r4HF18FUxOVTzKjC
nSxf9l1sHGtTp04STjTgo+N+ENB0H9n/AOGmoxa3r1zeaFo+r+JvE2pawui30s0EXifxLfa1Kg0v
SF1e+lhsZdVFu0sEcx8iFrydYIllMfnn7LHgCDwz4e8X+LIrPV9PsvHni7WL7wdpmuQSWeo6N8M7
HVNSPgnTJNPnghuNPjljv9S1mC1nLTrZ6tZi5xcJIK+p6K5aHhtk+Fz/AIGzLCwwmGyfw44fzHJu
EcnhhMTVxmX180w2FyzEYmpneKzLEVcRhIZLg6OAoYCeDjVdedbHYvMMXNYWlhN6vGOYV8q4mwde
VetmHGGa4PMc+zCVejDD4ulga1fG0aEMtoYOlTo4iWY4ieKq4qOIcPZxp4ahhMPF16lfzv4ifD+L
4gL4IWXVJNL/AOEM+Inhb4gRmO0W7/tCXwxLdSppb7ri3+zR3n2kq12vnNBsBFvLuwAfD+IfFl/i
p/aknnP8O4vh/wD2L9kXyhFH4ll8R/2p9u+0bzIXl+yfZPsu0KvnfaCT5Y63+39H/t7/AIRf+0IP
+Eg/sj+3/wCyst9q/sf7b/Z39oY27PI+2/6Nnfu8zjbjmuO174u/Dvwz4rh8E614iS08SzWmiXz2
CaZrN7DZW3iTWx4b8PSatqdjp1zpOjNret7rDSotWvrKa/kiuJLaOSC2nlj+ixHCPDuLzKpm+Iy2
NTMauY5Rm1TEvE4yLlmGRUMRhsqxHs4YiNFPCUMVXpqmqao1fac2Ip1ZRhKPkUc/zehg4YCljHDC
QwePwEaPscO0sJmlWlWx1HnlRdRqvVoUpObm6lPkSpTpxck+A1D4AQz2clxpXjHU9A8YWHxQ8XfE
/wAKeLtP0+3afQbzxleTS6voN5pdzcy2mu6HeWFxLpmpW1xJajUIhFLi2aPY9iw+BMOrXnirWPir
4om+JOu+KfB998P3n/sSy8M6Ro3g/UpFuL7TtE0a1uNRNtfXt4kN5datPf3V209raG2FqsBWT2bQ
fEOi+KNOOreH9Rt9V01dR1vSDeWrM0P9peHNa1Dw7rdoGZVLSadrWlahp85UFDPayGN3j2u2zXzy
8J/D9V4V3w+p04xpKrl1XNM6rZHjKtDBVMuoY3MuH6uYzyPNMyoZfUWCoZrmWXYrMqOFoYOhTxUa
WBwcaHrvjzit0pUlmzjJufJi4YLLqeZYenVxMMZVw2DzaGDjmeBwdXFw+s1cDg8XQwdSvUxFWdCU
8TiHV+Yv+FCeM9Rk8CW3ir4z6p4m0L4ceKfCvibw3ps3g/SLC9upfCt7HJaL4l1i0v8Aztbv305H
05dRjttORZLm51G6sb66ePytq/8Agx4p0zX/ABdqvwx+KV58PtM8e6lJr3ifQJvCmmeKbVPEt3bx
Wmp+IPDVzeX2nz6Ff6tDBDNqCTDVbWTUY1vYoIQDbn6DorCn4QcB0qbjTwGdwxH1jDYqOaLjTjb+
36VTCZfiMpoQw/ET4iefYbCxyzFVsDPBYfMaeDrYZwpVqFSNGiqekvEDimc054rLZUvY1qMsC+HO
G/7KqQr4ulj6kquUf2R/Zdas8bQp4qOJq4OeIp1lKdOrF1KnNzfg/wAM23g3wzovhez1DWNVt9Fs
ks11PX9SuNX1rUHDNJNealqNyzS3N1czSSSuRshj3iG3iht44oU6Siiv0LBYLC5dg8Jl+BoQw2Cw
GFw+CweHp3VPD4XC0oUMPQppttQpUqcKcbtvlirtvU+SxOIr4zEYjF4mpKticVWq4jEVp2c6tevU
lVq1JtJJyqVJSlKySu3oFfAHxn/5SOfsIf8AZAP28v8A06fsg19/18AfGf8A5SOfsIf9kA/by/8A
Tp+yDXUYn3/RRRQAUUUUAfAHgr/lKb+0t/2YB+w9/wCtFf8ABQmvpXxd8e/A/hHxBqvhhrHxt4p1
jw3b6fe+MYPAfgXxP4zj8F2Gq25vNPuvE1xoWnXUNnLd2IbULfSbZ7zX5tOX+0I9JayaOd/mrwV/
ylN/aW/7MA/Ye/8AWiv+ChNd54X8Sy/Arxj8dNK8W+DviZrSeO/ibf8AxR8Dav4I+HXizx1p/iyz
17wZ4a09/DUd54T07WbXQPEuiaj4U1DTJrbxldeHLGXTv7M1i3vl0mW5l08A+rtC1zSPE2i6T4j0
DULbVtD17TbLWNH1SykEtpqOmajbR3dje20gxvhubaaOaNsAlXGQDkDVr89/FmlDV9YuNT+OnwT8
UTWur/ADwjafDPwd4K0DxL8TtG+HXj5Z/Gl5468M6FL4O0VbTwh8QDFJ4CWx8am00W3Fpo/2XRPF
8Njot9LJ5/d/BLxprnh39ovW/iV4M8QeJvipo/7Lvweg8GeIGt9W1W+l+Mnhv4V+K7nXtS+Hl7px
a2vPGUHjqz0dZtW8Kh9VuLmS0077Q9re/ZJgD9KtL8TaFrWq+JdE0vUI7vVPB+o2Ok+JbRIrhG0r
UdS0TTPEdlaSySwxwyyT6JrOmagDbSTokV5EkjJMHjXer8v/AIn/AA38RWXi39oaDwZ4F1PTLfxf
8efg1428a6nD8MPGvinRvG/wkj+H3hWz8VxxWvhSXQrn4iRWvxGa/v8Axb4A0HxPD4i1XS013zNP
u7K5e2ur3h74Xap4k03wBol3omr6x8Lb39qS01tPDOnfB7xf8HvBWkeD4fgX48tdYm0rwRrvjTxb
4j0X4W674vksILvT/EsPhvw7qevanqsNno11oPiey+2gH6Kar4m0LQ9T8MaNqmoR2mp+MtWvND8N
WjRXEkmqapYeH9Z8U3ltGYIZY4Bb6F4f1a/e4u3t7bFqtssxvLm0t5+W8b/FHw54D1jwn4e1Kz8T
avr3jOXUzo+keFfDWr+Jb9dL0I6YviDxBfQ6XbTm00XQ21rR0v7hy1y8up2cFhaXs8jRp8ZJ8Lbf
R/F3wcvNS+G2tz+E/hp+1t8VpfDMFr4O1/XIfBfhPxR4C8UP4X1LQ9L0/Tr+70jwQfiDJoF1Bq9h
aReGNDuYrW7nutPsLbzI/R/2g/hfb+Kfi54K8Xw+A38QahpPwE/aL0uPxDb+H59Tl07XHX4dyeCN
OGoQ20wtdVnnvvFcvhqz8xLu6mfV5NOjlkhnaMA+lfDPxE8MeLda1zw5pE+oLrvhrR/COua9pWqa
Lq2jX2k2fjixv9Q8PxXtvqtnaSQ381tpt59t05l+2aXPCbXUYba5/dV3FfkP/wAK3+MaeF9QSHwv
4ksNMuPCv7Dln4/t9X8D+MPEp1vwt4U8C+J7Px/oz+D9Bv8Aw/4l8droHiC80BvG3g7QtWh1S70u
PUtLuorgzS6bd9X/AMK/1GfwTBNOmvL4Cs/jNc+JPCnh1f2UPGMvwWs7OP4bS2eoJqv7Pt18RPEX
xRHw21jV3vbvQLqC00TTdA8eve+I7TSYtF1PSNRlAP1Nor5m+Hd74qs/2WftUvw88QaP4o0nwB42
i0r4eWOteM7HX75tG/4SG18M2Ohah4mlk8deFpfFNjZ6Ze+HNL1KQa74Jg1fT9DCxT6LHGn5/wCv
eA/GGoaB8TNO8B/DzW7DTfEn7Ndzpl5afD74C/Fz4PWt946074hfDxbPSNU/4S7WNW1/xx8RdG0u
48RMvjUpYatf6a+oGOe9n0rWX08A/Zmuf07xRomq694j8NWF402s+E/7I/t60NtdRCy/t2ze/wBL
23EsKW119ptI3lP2SafySNk/lyEKfib4ifCafwpe/F/RPhx4H17T/h3q/h39lvVvFXh7wVa63bJ4
w0fTviv8R7f44aboCabLBJq/i7Wvhbp2h2Xi6y0m7TxD4j02402DUXvL7WrP7d6N+zloeh6b47+O
2p+DPBHiHwT8P9d1P4fXHhK31fwdr/gXSb9LbwpJFrVx4W8OeINM0a70vSI9Xe5WWzj0vT4Tfvda
jBam01K1u7sA+s6K/L6T4E3eo6zD4i1H4feJZte1v9ujx2niHWH07X01K4+ButxeNYbmymvECTw/
CbxDHc2I1WziePwnrTX2+/juXuSzMl8K6voOmWPgPXPhfO/gGx+O37RsvhoeK/g78TvjB8OvCPhn
+2rIfD+wh+DPgW80iDWdJ8Q2/iDVx4F1rUXfw34bgtNUg0SJb/VbNoQD9RKK/JLwZpWhW+qfs46J
8ePhx498Q6bp3wk/abtl8I3vw+8c+KrnQzb/ABs8H6Z4Rn1r4e6VH4k119NtfCs0GmeErqfTvEFn
pBvtAutN1GMvpesVB4h8G+PdN8MeAda8V+DfFvjL4iaN8INGt/DXgzxj8MviP41hvZ7bxb4117w3
4c8IfF74b6rceI/gl8ZtO0CTQdF8b+MPELmK5SLRr57y70vQdZmsgD9dKK+cP2mZ9Qf4Y6Zb/wDC
FT+KbXVPGPg638TWn9leLPF+keGdFS9/tLUfEHijwX4EubLxD8QfDOlzWMFpqnha0nSx1FbyK81Z
X0eyvY2+QfAfwluPFupeE/CPij4d65J8Nbb9q7xnr7aInwu8dfCbwGng1/2X5Bpuo2PgTV9S1KXw
x4C1H4mR3a2uianq82nT+Ibs2epWNrqWovpCAH6m18Af8FB/+Rd/ZO/7P/8A2Pf/AFaVnXBWPgTx
9ZfGC8bULXULDxlJ+0a2reHtf0n4B+Ote8Qw/CO08R2t1ounp8ek+KPh34aaX8Kl+GJg8K+JPBz6
U93pxm1HTrfwlrXjh9Nvbzvf+Cg//Iu/snf9n/8A7Hv/AKtKzoA+/wCiiigAooooAKKKKACiiigA
ooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKAPg
D9h7/kov/BRv/s//AMSf+ss/so19/wBfAH7D3/JRf+Cjf/Z//iT/ANZZ/ZRr7/oAK+ZP2nopJdM+
CQijeQp+038DJXEaM5WOPxbG8kjBQdqRqCzucKqgliAM19N0UAfIvjWLUJv2gfHmtXmtfFKTRfhv
+zp4O8Z6B4R8EeKvEOnabqHimfxd8YDfXsXhSyvYfDvivxLcad4f0zS7LTfEVjquk3yyWtvqul3y
R2BtfkDRviHr76Z8Sbrwh461iSO//Ys+Nniv/iS/Hb4lfGDUbT4g+H9M8BL4f1bWPEOv6b4f0Twt
8V9KW/15L/w/4D07TbnQvLjN1b21vHokcH67JJHKGMciSBXeNijq4WSNikkbFSQHjcFHQ4ZWBVgC
CKfQB+d3jzS9e8FxeLtA0T4qfE7w/Y638CfBPirV/EuveJ/iB47k07xND8S9L0/VvEDzDWn8QeD9
M1fRb270vxnfeArzw9B4Y8LtPr+jadYy+HbHyfKwbX4hWXwn0qe98X6hY+Ff2vvBGkQeJPB3x5+J
Pj/4cavp+ufCe+1K+f4d/EOW90HxTqOmaZqFrElzba7da3deCPEN5rOleGfEqaZqU+nwfrLVOXUd
PhvrTS5r6zi1K/gvLqx06W6gjvr2105rRNQubS0dxcXMFi9/YpeTQxvHate2izshuIQ4B+c/hTxZ
rMniT4fGHxt40vv2jNQ+PmtaT8U/hze+LPFkmmaP8LYvEfiyHUmuvhdcateeEtB8D6T4HXRdS8E+
M7bRrJdY1JtLvLHX7zVNd1K2vcT4eeGdd1bw7+xPYa34/wDjZfj4vaZ4m174qzXnxf8Aiet9r9xZ
/CrUvEFjY3V1F4lguNE0u31MWsIsdGbSVu0toftzXd7Lc3Vz+mS6lpz6jPo6ahZPq9tZWupXOlrd
QNqNvp19PeWtlqE9iJDcxWV5c6ff29rdSRLBcT2N5DFI8ltMqXaAPy++FepfEjTo/wBnXxJpnin4
geJfF3j66/aS8Ma7ZeL/ABt4p1vRNbtPh9pfjiH4bWd9o2tau+gWE1ldeGNBz4iS1s9b1Se71O+1
jWb651nUbm54DwH41+OV14fuZ/Afi9Na+Jh+A3xI1fx14at/iL8W/ij4zj+IUHhqzGit4g8AeLfC
EPg74Q/EPSvGZMGj+ErKbR7bVLP7domnaVr2l6ZpKD9bpdZ0eC7tLCfVdNhvtQvZtNsLKW+tY7u9
1G306XWLjT7S2eUTXN7BpNvPqk1rCjzxadDLfPGttG8q6VAHwv8AA68+HV9+0Ffy/C/x14n+IHhy
P4C6Sl5q/iDxj4p8eC312Txq817bSa94tvtT1LT/ABDJbGzn8TeFBdWaaDfNE0+haRqV/qCXHnvj
fSr/AMN/GT9p7xX4c1Xxxp2szeIP2JNLiuLPxp42azbTfE/xf0tPFNnBpTa3JpC28+nLNpzpDYqu
l6DqOtaNY/YtG13WbO//AEqqm2o6emoQ6S99ZrqtxZ3Oo2+mNdQLqE+n2c9rbXd9DZFxcy2drc31
lb3N0kbQQT3lrFK6yXEKuAfk9c674t0PSvh7p2q6tp3hT4X3HiL9rLULjUvEfxa+IfwQ8P33jyD9
pHxXJpFhqnjX4c6fea02rQ+HprzUPB3hzUJ9M0/X7ibVb2xOravothb20/jnxb470nwf8OPE3jj4
pahc61b/AAKOrReEz8QPiv8AA7XfFWqRat4ln0vxB8Mdah0OysviF8ZLrQ49D0zV/h78Qvh/ewzz
/wBlXSWUekeK9XNx+rOoalp2k2323VdQstMs/tNlZ/a9QuoLK2+16le2+m6da+fcyRRfadQ1G7tb
Cyg3+bdXtzb2sCyTzRxsWGpadqkU02mahZajDbXt/ptxLYXUF5FBqOl3c1hqenzSW8kiRXunX9vc
WV/auVntLuCa2uI45onRQD53/aE8broXwq8N6vdL4q0K18SeLPAen6jcHxlJ8KF8PWmp3ceo3J+I
/wAQNI0jxBqngDwvH9kGmeKNV8Oww6itzcwaPa6rYW+oT3ifJvgq+8Q+MdJ8OeDW8deNY/Dc37aE
fhd5vBPxT+J9yZPh2n7NF54wfw1pPxF1e80vx7rPgC88Xw3Ulhqktza2t/GI7vw5PaW0ejz236j0
UAflPqHib4pWfxc8QaFN4xtdC8c6X8dPD3hz4d6Fr3xf+Mk3iPUvhZDqPhu30023wa0vw5r3hLxv
4R8Q+EIdRvPGPxB1O41C9sdUuNX1rX/EWla14esksv1YoooAK+APjP8A8pHP2EP+yAft5f8Ap0/Z
Br7/AK+APjP/AMpHP2EP+yAft5f+nT9kGgD7/ooooAKKKKAPgDwV/wApTf2lv+zAP2Hv/Wiv+ChN
ff8AXwB4K/5Sm/tLf9mAfsPf+tFf8FCa+/6ACiivAf2l/Dr+KfhXd6QD4qWGTxL4Muro+FfCDfEI
fZ7HxRpd4w8UfD+2vLLVvG3gYvDGPF/hvQXm1fUNFNyIbae3juloA9g1XxNoWh6n4Y0bVNQjtNT8
ZateaH4atGiuJJNU1Sw8P6z4pvLaMwQyxwC30Lw/q1+9xdvb22LVbZZjeXNpbz71fmd4U8JSanc/
s9eJPEXwcntND+HP7TPj46Re+HPh38TLbSo9A8TfDHX5dA8eeHvhh4pg1rxh8JvBt18R59DtH0tY
YvCmhalocXilLy10fVIr18vR/B+sJ4V8AaboPw9+IWl/HnTtD+JkH7RnizUPC3iqJvFsd78MfHdj
r1pq3jtrGDw/8Tk8VfFCbwbrXw4sNG1LxQdNsbW0m0YaVY2N5G4B+otFflpc/BzUfB3gf9mWyXwj
Z6b4Gb4Z6hq3xU0bxT8GviP8d7N/jbq3hP4bWFlr/j74d+F/Fvh/xFPriaXp3jDS7LxFq6a7a+H9
YmnguNO0/U9S0/VLbd0TwXqNgvwuk+OXhX4nfEbwDb/BjxDp/hCzl+HXizUtf8NePtQ8danfacmp
+EPDviD4j6j4H8SRfDu+8KaD4H8U+K/E0usaF/Yd3Fqev+E/E82oWDgH31Y+PvD+qeAdI+JOkrrO
r+GNd8OaN4r0g6P4f1rVta1DR9fsrTUNLltfDunWN1rk1xPa31vLJaJYNc2ytI1zHEsMzJ2lfDXi
rwp4xl/4J+aB4O0/w54kbxvB8A/hXox8L2uk6kPFFvrWn6J4ShvtMfRo4BqkGpWE1vcRXlo9ulza
PbzrPHGYpAvLWXweuDqPxV8f3HgTXD4/j/bX+HWr+EPEUmna2ddg+HR8e/BrTvEl94clIMtt4Gu/
DF544PiV9MSPw9qGmx6vfayLhNPa5tgD9Dqp6jex6Zp99qM0N5cRafZ3V7Lb6dZXWpahPHaQPO8N
jp1lFPe395KsZS1srSGa6up2SC3iklkRD8s/tRxy37/DDRrvwPb+KPDd74h1241rW9c+Hfj74y+D
PDd1baDLaaLB4l+EXw/v9OvPF0viC71OW00O91mZtF0HULQylBql9pkkfSfsnWGs6V8DfDula9pO
u6Ffad4l+J1vb6R4i8P6t4Xv7DQT8UfGVx4UtodB1q61C80vSY/Cs+irolgup6pa2OkCysrTUryC
2SZgDQ8M/tI+AvFvim58G6PoPxXOvadqOk6XrVvf/B74k6Zb+HLrXLaK90s+Jb2/8NQWmgW91YTx
X6XOqzWsC2Ei3jyLbkSE8HftIeA/Hx0OXwpoPxX1TS/Ed5BaaT4jX4PfEmDwtOJ7w2AvpPElx4ai
0a30qKdXNzqk95HY28Mcs00yRxswqfC/Qtb0745/tPaxqGkanZaT4i174U3Ggand2Nzb6frUGm/C
/R9N1CXSryWJLfUEsdQgmsrxrWSUW11G0E2yQba+Yv2YILvwf4G+Ffh/xR4x/aw8PeINJlgtNS+H
svwK8XjwBZ3Mmu3TR6Rd+IV/Z/uUi8PzxzRNe6q3jtYre2mmuZddtY42nhAPsu5+OXwzs9J8V6tc
a+6f8IV40j+HWv6Qml6pN4jh8cXl3YWejeGrPw7BaS6vqmo+Izquk3XhsabaXUGuabqdlqmnzTaf
I1ynOeJP2kfAXhXxZD4I1XQfiu3iK9uNag0iz074PfEnVY9fXw75Lazd+HbvT/DVxba7p1hHc2s0
+oaXLdWaw3VtN53l3ETP83eJvDHjnVPjAf2tLH4eaxN4b8Da1YeDrf4WTeG9Ug8eePfCWknXvDmr
fG238MyKt8PHHhuTxHqi/DjRL/SYtf1b4cWuswo1vfeK9BttM+g/Hujazqf7Q37OHiKw0fVrrQtG
8PfG+PWdWi029Njo8ut6L4JXR4dXuDAE0ubUns7uKzhvjbyzzW08MaGWJ0UA6Lwr8QvhR49+KniD
SNI80/FX4aeEtHttZttX0XV9E1zRPC/xPs/D/jCHTzFqltaGQXQ0vw7caxaCOS60XULe2sb9bO6k
kgkXRv2g/hVr8UNxpfiGa5t7n4s3XwStpxo+rrDc/EK106fVjptvIbLbLp0+n27XVpryE6JdRPC8
V+wlQn5N8c+FPip4V+Mvxf8Ai/8ADjwjr194l1Lx7F8OtNMehXctrq3hr4g/s9fCjStI8WrcNGi3
/hzwN8YvBvhVvEOpWxuLTRtHTxpJPNBJY3kRzrv4cal8LtM8Oafp3hHxxfeFPAH7ZXw+1qCXRfBn
ifxTq0/gHw1+zx4e8JP4si0fwvo2qaxq2n/2tZvY3upaZp11E+qi4iZjMsgAB+llFct4R8YaT420
2fVdGtPFNla299Lp8kXi7wN418Aak08UFtctJBo3jzw/4b1e5sTHdxLHqdtYy6bNOlzaw3cl1ZXk
MHU0AFfAH/BQf/kXf2Tv+z//ANj3/wBWlZ19/wBfAH/BQf8A5F39k7/s/wD/AGPf/VpWdAH3/RRR
QAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFA
BRRRQAUUUUAFFFFAHwB+w9/yUX/go3/2f/4k/wDWWf2Ua+/6+AP2Hv8Akov/AAUb/wCz/wDxJ/6y
z+yjX3/QAV8D/E74o+NfB3xq1zUL3xzqkvw80Dxn8KPDp0rwTq/giXUfCJ8VDwjHeeHvG3wy8VaH
YeIvGVp44udZaey8Y+CPFOpatoGnXzR6Fo41Hw1rtpe/fFYN74V8MalrOn+I9R8OaDf+IdIiaDSt
evdH0+61nTIXkMrQ6fqk9vJfWUTSsZGjtp4kaQlyCxJoA/OH4Z65quh3ek/DBfi9r+j+HvGX7TP7
WVn4y8WyXvg+HxPaat4d8aeJLjwp4Ht9WHh2PT/Dl348/wCJp4vuZpdPj1zUZdEvofDl5ptpfNbL
2Xgrxr8T/iV4v+FHhEfFfxRpfhptb/aqik8Y+G7TwLJqXxU8NfCH4keAfD3gHV7i9uPCeoaJBCYN
YvbPUdQ8OaXZW/iFbK8njEdrquIftnWfDvw/mgudK8Q6F4OltvGmpxQXmm6zpmivB4s1mK2nv4Yb
mzvoDHrupx2enXV5FHLHdXSW1jPcIoitpHTooNK0u2awa202wt20qxk0zTGgs7eJtO02b7GJdPsD
HGps7GUafYCS0tzHA/2Gz3Rn7NDsAPzL+H/xx+PWs6l4O8UyPJd654q8V/E/Stb+G2qeNPA89g0X
hTSfHl8PBfhzwBpHhmDx7oPiLwPe6No8N5qOq6tJeapb297F4hmurrW9AW07b4L69P4p+KP7NHi3
UvizqPxC8Q+Nf2efiP4v8SaHe3HhOS28K65q8/wbk1aPSbDw7o2l3vh/Tjqw1DQY9F1ea8NtL4cl
gV/7XtPEFzefeNt4Z8N2euX3ia08PaHa+JNTto7LUvEFtpNhBrmoWcTI8VpfatFbrf3dtE8UbRwT
3EkSNGjKgKKQ2w8LeGNK1K/1nS/Dmg6bq+qT3Nzqeq2GkafZ6lqNzefZvtdxf31vbx3V3PdfYrP7
TLcSyST/AGS281m8iLYAfHHx88d+OvD3jr4kaX4P8TN4Wul8Cfsmx6XrFpougahf6Xd+PP2mvFng
fXrxTq2mXi6hHN4fma1j03UjdaZAWmntrWC5urmeX2b4RXHibTfHXxi8B634y1/xtpfhK/8ABN54
f1HxTHoja7aReKPDTajqlhcXuhaPodteWi6lbS3dkJbES2cd09lFJ9jgtYYfbrjSNJu5pLi70vTr
q4mXTVmnuLK2mmlXRr6TVNHWSWSJnddK1KWXUdNDMRY30kl3a+VcO0hsx2lpDPc3UNtbxXV55P2u
5jhjSe6+zoY7f7TMqiSfyIyY4fNZvKQlU2qSKAPyj8HaDqWq+PvD3huy+J3iTT9ZP7df7RIv7y2H
hC48RaBp6fCv4uz+bY28nh42+m3Hi7T7eVGvtT02/hjgkmuvDttp8kUMsHc6p8U/i+bvwL4CHivX
b2yXxf8AtN6PfeKo/Efw78AeJ/FSfCb4lW/h3wVo174l1/wzN4bW+07wxdXmq6xb6No1jqviePQ/
7RuNthY+JF1D9E08O+H4tRl1iPQ9Hj1ae5ivZ9UTTLJNRmvILG50yG7lvVgFzJcw6be3mnxTvKZY
7G7ubRHFvPLG+R4g0XwFfeG74eKtJ8IXnhC2N74k1IeILDRrjw3bmNrnU9Q16+/tGJ9MiMbSXmoX
uqXG3a0lzdzzgvLIQDw7wh8SPiHffso6n8TpTpPij4iaf8O/iJr2hTaTHDqOneKb/wANr4m/4Q29
8nR4rKyvrjxFZ6Zo13qMWhQ2ul3N/fXSaHHBp72ar8neKPH+veCdU1nx94C+Ld/8a/FGlfsWfELx
tpkuoL4S1aXQdU1Txh8M7mbxNCPDGiWFq2jTJHJrVv4cvrSe10+Dw3cwRSR2N7IkP6lWsdrFa20V
kkEdnHBDHaR2qxpax2qRqtulskQESwLEEWFYgI1jChAFArH0jwn4W0Cae40Hw1oGiXFzLe3FzPpG
jadps1xPqUlrNqM08tnbQvLLfzWVnLeySMz3UlpavO0jW8RQA/M7X/G3xA1PSfEvhPXNcfxB4Zg1
X9lrxYrax478DePvEGma1rH7S/w+hs72DVfAGgaFpsHh/wAYaZHdX1ppl8s/2GbRPO0JLTRtQS2T
0K6+OPjD4W6JP8TNWum1rwPb/F79rH4Z6l4XtNL060Nx4otviL4vvvg1LbyaXpUNx9u1TVPCE/wz
E91cP/a2t+PtFutRM9+JL8fdOmeDPB+iWdxp2jeFPDWkafd6jFrF1Y6ZoWl2Fnc6vBdQ30GqXFta
WsUM2ow3tvb3kV9IjXMd1BDcJKs0SOuqNJ0oW5tBpmni1Oof2sbYWVsLc6r/AGmNa/tMw+X5Z1D+
2QNW+2lftP8AaYF/5n2oCWgD81fiH8S/jx4U17xF4R1vxpeabqXwt+BHw98WTeKYfFXw28FaPrnj
PVrXxUni7xzqmkeKPCd9P4v8L2uvaVbaBF4a0EwWVhFC0M4fX9Z0i7s/RtOvPj14+n/aC1/SfiN4
g0Dxb4Cs/Asfgb4Z6NYeE7nwWviu7+CPwz+I2r6LqE+q+GrrxJqljr/irU7rRY5ZNZtpdM0+9vJb
VTJdPGv2xrHhfw14hn0u51/w7oWuXOh3Zv8ARbjWNJsNTn0i+IQG80uW9t55NPuyI0BuLRoZiEQb
/lGItb0GTUNJ16y0PVrvwbq+upvfxRoFhoM+sW2oJbW1nBqfk67pOsaTqF3DZ2drZA6rpt8v2KCK
3j8rybd4QDxb9n34mX/xrtvFvxZ0++vh8M/EV1oGkfDHR7yxt7QpYeH9GRvFviCSRYhdy32o+NtV
13wxcxT3M1vBb+CLGS2itp7m+V/oquT8CeC9D+HXhDw/4J8OR3CaN4c06LT7R7yVbi+u2DNNd6jq
NyscK3Op6pey3Go6ldLFEtzf3VxOIoxJsXrKACvgD4z/APKRz9hD/sgH7eX/AKdP2Qa+/wCvgD4z
/wDKRz9hD/sgH7eX/p0/ZBoA+/6KKKACiiigD4A8Ff8AKU39pb/swD9h7/1or/goTX3/AF8AeCv+
Upv7S3/ZgH7D3/rRX/BQmvv+gDnPF/i7w74D8N6v4u8WanHpHh7Q7YXWpX7wXV20aPLHbwQ29lYQ
XWoahfXl1NBZ6fp2n2t1qGo31xb2Vja3F3cQwvw3w/8AjT4T+IWr33hu103xr4U8VWOnHWz4W+IX
grxF4I1y98Pi9XTv+Eh0q116xtotW0hdQdLK5n0+4uJdOuZrWLVILJr+w+1L8ddPt9V+FXiuxvfh
9qPxS02WLTH1bwVouqSaR4g1LSbbWtNu9Tv/AAzdQPDcy+KPDtlBN4j8OafZXen6jqutaTY6bpup
WGoXVtdRfIw/4W3qOm/ErQPgj4r+OHirSJvgV8TYdE1z43+Cda8H+JPB3xSln0608F6F4G8aeK/B
3gLxv4jub5Brjamuq3Gu2mh3+g6Jdz+LLO/uhA4B+ilFfkJrPwz8Uav4G+Ium+CND8TRaLfeB/hb
ouseFvBP7O3xK+B9nqOuxfGLwPetfagvjH4n+K/E/ir4i+HfCum+KD4g8SeGNBvIX0i/a88SeN5r
q20W3ufoX4j/AAc1bwl4qsvhr8IvB9/pfws/aA0DSfAfj5/C0N1baT8OYPCHiSbXfE2u3N0srR6R
/wALD+GPiDxp4OtrpGtiPEmleE4YfOubtYnAPvaivy71PwN8Rn+Mviq51SK5svH1x8eNK1X4f+KN
K+AHj7xl4isfhZaap4ek0mHR/javxJ8LfDLwx8Prbwt9r0Xx74KvrKJneXXobjRde17XNEkvfqj9
mD4a6f4O8LeJfEl74Wu9D8deMPiR8YLzxHqWtW+pxa9qelJ8YvH0nhMuNXZriDRW8Oy6Ze6Fb2iW
+lzafdwajZROl79omAPfNf8AFGieF/7E/tu8a0/4SLxBpvhfSNttdXP2rW9W877BZn7LDN5Cz/Z5
c3Nx5VrFt/ezJuXPQV+a8fg7d428FtrHw58e3/xusP2qtY8S+MvH8fg/xdd6Xc/DK58T+LpPB1/N
8QXsX8N3vgLTvBf/AAg+jaR4Vt9WA8O6ppZk/wCEd06XS9XvkX4eeFPEdovwbtPCPgvxn4X/AGiN
HfxmPj94/wDE3hjxJbaZrlxc+AfGdpqr+KPH93p8fhf4labr/wAVpPBPiLwJZ6bqHiqLStJsYJ9L
TS9NsL6KQA/Seivyrl8CW+q/AXxT4b8C/CD4nab8bD+z/Ja/FXxBfeHPGHhw+JPiJpGpeDta1XS9
WvddjtLb4s/EDXtSs/EeoeF/FGjXHiqe20xpbO11u10rxZp0N36L8S4NS+NHirxdcaT4L+KTeCtV
1X9iHRHm1PwX8RfAs2saXovx6+IevfEG6sINT0vw94httO0Pw5r9k3ifUI4rMadp4W9u549Nktbq
UA/Q+ivzpPwXXw/qvi7WvDPw61TS9R8O/tj/AAeX4fS6Voerww+HfhReT/B248dyeB7KCIWOh+Ar
+bX/AIjP4yuPD1taaDfbdXXXpJk0SNdP5zw54J+Iv/C37K51xdRtPiIv7RPiLX9Q8RaR8AvHl34h
vPhgPE+s3emWN9+0Dq3xV0r4czfCu7+GMWk+GR4ag0OS70a6a2sNL8Bal4y09Li9AP05rh0+I/g2
b4dTfFe11hbvwFF4Tu/G4122tL51m8M2WmTaxPqUFk1smoSqdPgkuIrdbX7TMAqRws7qp+HPg98D
YNL8N/ADWNX+HWrWnizW/i38ctJ+Kl7qmla0NYu/hz4n8LftBiz0rxo16DcR+Cr29tvh+NF0/VhH
odrf3Ghf2RDb3eqRfa+y+GfhK8sf2BL/AOH2leCPEOgeKNP+AvjXwnfeDrrwhrXh/WrjxvJ4O1W2
1K3sdHv9NsrrWJNW1u5c2OpaXFe2Osy3Ctp11cg4UA+2dJ1Sx1zStM1rTJjcabrGn2WqafcGOWEz
2OoW0d3aTGGdI5ojLBNG5jmjjlj3bZEVwVGhX5Y6doMmg+Cmn+EvwX+JNvBa/s2XHhn4zeF7zwv8
Svh/e+MPiBquq/Du28PS3EaRaL4k8eeM/Cekf8LK1TxFq3hh9V1bVPDN5H4Z0/xBNLrujrax6J4L
u7jRf2h9IsfDPirQvA3iTRv2d73S5vhf+zV468A+E9Tv7Dxx4suPGGoaZ8H/ABTrd/q/jHS4tKHh
eD4qWOj3Fn4j8c+FYbuCw0K7jmsZtQAP1Sor8pbvw94+1HwH4U0618C6Hofwh0H4663d+J7a1+B/
xn1rwP418LXnwxW48O+KP+GZb/xDofjjR/Aen+Or6TTdS8I6TqVz4JHiDTrXx/Doup6VJeXVv9pf
sw6Jreg/DOWy1abWDYv4w8W3Phaw1nwHqvw0/sbwrNq0n9m6Xo3gzxF4u8Z+KdC8MRzpe3XhjTfF
GoafrGm6Hd2OltoWlWNjYwsAfRFfAH/BQf8A5F39k7/s/wD/AGPf/VpWdff9fAH/AAUH/wCRd/ZO
/wCz/wD9j3/1aVnQB9/0UUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFF
ABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQB8AfsPf8lF/wCCjf8A2f8A+JP/AFln9lGvv+vg
D9h7/kov/BRv/s//AMSf+ss/so19/wBABRRRQB+bOh+K9X8b+J/2ffFviv4lanL4v1L9p/4naBq3
wgmm8Lx6X4Th8G6F8cdB061s9EttFtfFmm3nh/RLXRf7R1DU9UuTqsniSO91JZU1Hw6llqeBfi18
QLjSfgV44sviRffEXx18VZfGkPjz4MyL4VsNN0GXRfh5458U3WmaNpNlotr4l8K3Pw58ZaBoHgPU
LjU72+uNUl1c2viBr3XL/SbqH7uuPD/g+x1O88ZXeieG7PWIrdJ9Q8VXGm6Xb6nHaaZaXUMc15rk
sKXSW+n2FxexJJPdCK0tJ7pFMcMsobzLw/8AEv8AZrn8USXXhX4gfA6bxp4subXTZbjw/wCK/AUn
ijxLeXE0UNlYSS6dfnVtZuZ7gQRWtqzXMsswiSKNn2CgD451H4v+JtF+CHh74iaR+0TqfiDx/wCL
vhb4F+Ivibwpd6X4Q1Ow8PiT4gfC2x8ceIrCXTNAtbbwDonhqy1/xD4R1DQvET3Md5G09yhTxB4Y
17Up/Rfid8Y/FOreLviJ4a+G3xMh0+00zxh+x34PtdY0Cz8N6+PDd18U/irrmjeNjatqFhqGnX1/
qHhuTR1KagNQtLRkgUW6k3lvL9B6N8R/2bp9X1LSPD3jz4ITa9441JLTV9M0bxR4Dk1fxfrF4W0+
O11Kysb43uv6ldNO1kkN1Fd3U5ma2VXMhQ9fplv8K9L0HUbrRoPh/p3hjwxM1vq1xpkXhyz0Hw9P
4Jvri/eDUZbRY9P0mbwlqQur1orlrd9BvhcXJW0n8x6APjaPX/ih4c1XxNen4veNNZ0/4f8A7WXw
m+C2i6Nq9p4Qlt9U8F+P5fg/J4mTxbeW/hm3v9e1Qr8SNTt9F1KO40640WDTNKMBmuDqdxqPN/Dr
40fGfXvHXg/VdS1GS0m8T/HTxx8Pta8F6z4z8CNpNt4a8P8AiDxjp83h3S/AFh4at/Hmj+JvCHh/
SrLxG2t6hqwn1g2ktxrLzaJrmj2lp9j6l8YP2edNvdS03WPij8GbDUU1e3vtXsNS8beCLW9TX9Ka
yS1vNStbrU4511fTW0vTlt7i6jF7Ztp1kI3jNpAI+o0O4+FuueKtR1rw3P4A1fxumjaLNq+raHJ4
d1DxUvh7WbRLzw7LqN/YNNq66NqtgqXeivcyixvrRUnsTLCA9AHxX8GPEnxW8QeG/wBmvxR4h+MX
jTV7r46f8LB8NeLbGTT/AARaadpcNl4E8e674e1bwpDZ+EoJdK1zQ7zwrZyC9vJtUi1WW7vDqtrd
Wy2NnZSeBDbj/gmXqUVv4gm8RmD9lTxzFcXdxcaXcz2V0fhxrUs+iyHSbSyghGjtL9ghtZ4TfW0E
MUV7NPOrSv8Aa9lrXw3ijsbPTtW8ERRaL4on8Iaba2V/oKR6T41Fnci58L2MEEoWw8UDT7q8E+iW
6xasLO4uRJbeRNLu6CDw/oNrp15o9tomkW+k6j9s/tDS4NNsodOvv7RVl1D7ZYxwrbXP29Xdbzz4
n+1K7CfeGOQD89br4w6l8PNJ1z+x/jjrfjzwtc/s6WHj298VW2jeAvFWoeAvG2q+KPCnhDwdd+HY
La38N+GrWx8aw65rM2n6D4vvZfD2hy+DW1i7mj0s6/8AbK1p8Ufihb2X7QPhqy+JUei3/hGH4AX2
iS+OfHngXxBqmh6h8QviF4p0bxT4av8Axz4d8Bal4c8Jat4w0vS9F0zRBqOj+NdE8Daj4g0/UReW
Gn3P2XRPtTSde+B1t4m1z4b6HrXwpt/GWtSXs/iTwFpOo+EIvE2rStZvJqU2ueFrOZdVv5Dp5ke9
kv7GVjZl2nPkFjXZWHgzwfpemS6LpnhTw1p2jzWA0qbSbDQtLtNMl0tZLqZdNlsLe1jtZLBZb6+l
Fm8RtxJeXTiPdcTFwD85bj43fFCe38GfD/T77x3FPdfFnxt4J8bX+r+L/hVp+u6ZfaL8OPDfjDw3
8ONG+Lthp2seC9Zi1iLxFc65DrjWWlfEO4i0C68N3Vvp2ow3dzcfV/wT8bePdc+B2p+Kdbay8X+J
dLvfiTbeHLnTtT0rXG8VWPhjX9esPDcN7qPhfTtL0TUdZI0+LQdVvvD2n2+mapqNjPqemRLb3sSj
2f8A4QfwX/wjn/CHf8Ih4X/4RHy/K/4Rb+wNJ/4RzyvM87y/7D+yf2Z5fnfvdn2Xb5nz43c10Fpa
Wtha21jY21vZ2Vlbw2lnZ2kMdva2lrbxrDb21tbwqkUFvBEiRQwxIkcUaKiKqqAAD8xtV+M3j/QP
hp4X8WeF/jDqfxB8Q/ET9mT4yfEnxlbTL4PuLXwB4i8K/C2PxNpHjHQNJ0vw/Z3nhiz0PxwIvAr+
H9Ze70+W41GKHVrW48R6deXdx9RfDK48baF8Vl8JeIPiL4k8e6br/wAG9F8e3X/CS2Xhi2ew8VHx
C2k6hPog8OaDoaadpF/aTQgaJILu3s5LSOa3lE095Lce+weD/CVrJr81r4X8O203isynxRLBommQ
yeJDPE8E51947VW1gzQySQynUTc+ZFI8b5RmB2RZ2guhei1theC2FmLsQRC6FoJPOFqLgL5othL+
9EAfyhJ8+3dzQBZooooAK+APjP8A8pHP2EP+yAft5f8Ap0/ZBr7/AK+APjP/AMpHP2EP+yAft5f+
nT9kGgD7/ooooAKKKKAPgDwV/wApTf2lv+zAP2Hv/Wiv+ChNff8AX5E+P/2pv2Y/2X/+Cofxuv8A
9pf9o34D/s72Pjj9gj9jq08FXnx0+L3w++Elp4wu/DP7Q37eU3iO28LXHj/xD4fh8QXHh+HxBoMu
tw6S93JpUet6Q9+tuupWRm93/wCHsX/BLL/pJZ+wB/4mR+zr/wDPGoA+/wCivgD/AIexf8Esv+kl
n7AH/iZH7Ov/AM8aj/h7F/wSy/6SWfsAf+Jkfs6//PGoA+/6K+AP+HsX/BLL/pJZ+wB/4mR+zr/8
8aj/AIexf8Esv+kln7AH/iZH7Ov/AM8agD7/AKK+AP8Ah7F/wSy/6SWfsAf+Jkfs6/8AzxqP+HsX
/BLL/pJZ+wB/4mR+zr/88agD7/or4A/4exf8Esv+kln7AH/iZH7Ov/zxqP8Ah7F/wSy/6SWfsAf+
Jkfs6/8AzxqAPv8Aor4A/wCHsX/BLL/pJZ+wB/4mR+zr/wDPGo/4exf8Esv+kln7AH/iZH7Ov/zx
qAPv+ivgD/h7F/wSy/6SWfsAf+Jkfs6//PGo/wCHsX/BLL/pJZ+wB/4mR+zr/wDPGoA+/wCivgD/
AIexf8Esv+kln7AH/iZH7Ov/AM8aj/h7F/wSy/6SWfsAf+Jkfs6//PGoA+/6K+AP+HsX/BLL/pJZ
+wB/4mR+zr/88aj/AIexf8Esv+kln7AH/iZH7Ov/AM8agD7/AKK+AP8Ah7F/wSy/6SWfsAf+Jkfs
6/8AzxqP+HsX/BLL/pJZ+wB/4mR+zr/88agD7/r4A/4KD/8AIu/snf8AZ/8A+x7/AOrSs6P+HsX/
AASy/wCkln7AH/iZH7Ov/wA8avlD9qf9vP8AYa/aF1X9kP4Z/AL9s79lD44/Ee//AG7/ANlLVrH4
f/B/9or4QfEvxve6VoXxFg1PXNTtPCngvxhrWvXOn6NpsE+oarew2D22nWMMt3eSQ28byAA/a6ii
igAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKK
ACiiigAooooAKKKKAPgD9h7/AJKL/wAFG/8As/8A8Sf+ss/so19/1+LvwG/bj/Yp/Zu+On/BRT4f
ftE/tgfsufATx9c/tx6p4ntvBHxp/aA+E/wt8X3HhvV/2Xf2W4dJ8QweGvHPi3Qtal0PU5rC+i0/
Vo7JrC9ksrtLa4la3mCfUf8Aw9i/4JZf9JLP2AP/ABMj9nX/AOeNQB9/0V8Af8PYv+CWX/SSz9gD
/wATI/Z1/wDnjUf8PYv+CWX/AEks/YA/8TI/Z1/+eNQB9/EAgggEEEEEZBB4IIPBBHBB618o/DLS
NJT9p/8AaYVdL05VsvD/AOz9NZhbK2AtJX0bx5I0tsBEBBI0kcbs8Wxi6IxJZVI8v/4exf8ABLL/
AKSWfsAf+Jkfs6//ADxqqRf8FU/+CUkF3d38H/BR/wD4J6w31+ltHfXsX7YH7N8d3epZrKtml3cp
8QxNcpaLNMtsszuIFllEQQSMCAYH7H+ra5H8LPg3bSfET9nSDSwkER8OX/hq8/4Wb5L+ILxV05dW
PxKitx4hmLCPT7r/AIRcosj2zDTJSBG9X4pS6GfjH4k8a21hqc37NGh+PfBmn/tNpbXqHwvrvxP0
ODULXSfE0uhSWE/9q+Gfh/qZ8D6f8aDp+oWtrqdza6F/a2l6pF4E8Vx3CW//AAUY/wCCNlpdQX1p
+3b/AMEy7W9tbiK7try3/af/AGWIbq3uoZFmhuYLiPxws0VxDMqyxTRuskciq6MGAI6SP/gqV/wS
bh02XR4v+CjH/BO+LSJ47uGbSo/2u/2bE02aLUHmkv4pbFfiELWSO9kuLh7tHiK3LzzNMHaVywB7
B8StM0e4/ac/Zkcafps8WoeHPj9cXDi0tZY74jRPAUkM8zeWy3JBkaSKVy5BdmRvmJPy74m8S2/w
R/au+Ovx6eyluPD+lXvgv4V+MtPsYZBJcab4o+CHh3xH4AMQhieNLpviN4R0PwPo3nI0cNz8RpY4
lBuHV/RF/wCCpn/BJ5JdOmX/AIKNf8E8Fm0i3ltdJlX9rz9m0S6Zazxwwz22nSD4hBrK3mht7eKW
G2MUckcEKOpWJAsUv/BUb/gkxO95JN/wUV/4J2TSajc6feag8v7XP7NUj313pL28mlXV4z/EEtc3
OmSWlq+nzzl5bJ7a3a2aMwxlQDzTTfD5+GEPhvS/FmqWUWqad+3v8Ldb8da7eXkNvYXPjLxH+yf4
L8S+OtalvLh44YrfU/F2sazqCyTS4VLpQ8sjZdv1H0XxBoPiO1kvvD2t6Rr1lFcPaS3mi6lZ6pax
3SRxTPbSXFjNPElwkU8Erws4kWOaJyoWRCfz61P/AIKc/wDBIvWobi21n/goT/wTi1a3vL6LVLu3
1P8Aax/Zlv4brU4LKLTYdRuIrrx9LHPfQ6dBBYRXcqtcR2UMVqkggjSMTaL/AMFQv+CSnhy1ksfD
3/BRH/gnToNlLcPdy2ei/tbfs06XayXTxxQvcyW9j8QIInuHiggieZkMjRwxIWKxoAAcNpOreFfC
Hhrw5P4f1v4WfFrwJJ8cdN1e0+HPiTSrrwZ+0/4U8da78Xrec6faajpviO6m8Q+MPBni3Ubu9utM
1Twz4du9W8P2N9pOoatdaJcvPN1Xh/4x/GO/+JNlez66tquo/tG678Lrjwlqvi/wEuhQ+DtL8Y6t
ojaDaeArbQF+IEHiq08GWUfjq08RS6yJNUnMV9dKPBeo2ljA9f8Agpj/AMEhE8Qnxcn/AAUC/wCC
bq+LGhNu3idf2rf2Yl8QtbmN4TAdaHj0akYTDJJEYjc7DG7pt2swMo/4Kcf8Eihr58Vj/goR/wAE
4h4pa2+xt4lH7WP7Mo182ewRfZTrP/Cff2ibbywI/INz5WwBNm0AUAXfBPxC+JOgfBnwv+0V4v8A
in4i1/Q4fixqo+KOi6zp/haDw1ofwrs/Hnj/AOGNxd6LBoHhSx1izi8KnUfDXj3X7681TUJ57Pwf
eqjRWkr2MnO6t8WfjjqOp/DzS9Z1LW/Den+NPhd4t+Nsb2Hiz4d/De+tRrXjWW+0Dwlc65438M6r
p93F8IPAFz4aj8QaVap9o1O/1mfUvFEt7pEMdo3Qp/wVI/4JNR6ZNosf/BRb/gncmjXMV5BcaSn7
XX7Na6ZPBqLTPqEM1gvxBFrLFfPc3D3kbxMl008zThzK5arr3/BTv/gkd4ptYbHxP/wUL/4JyeI7
K3uYr23s9e/az/Zm1e1gvICTBdw2+oeP7iKK5hJJinRFljJJR1NAHd/CHxL8VviV8RPAj+K/iLqW
kWOlfs4fBv4la14b8GQeGD4Z8a+K/Fvif4l6dea1e32peGrvV49D1rRPD9hcf2PpFzo6Rm6t5Ipb
e40+GRvuCvz4X/gqt/wSnS7lv0/4KRf8E+Fvri3t7Oe9X9sL9nBbua0tJbqa0tZbkfEQTSW9rNe3
stvA7tFDLd3Ukaq9xKXsf8PYv+CWX/SSz9gD/wATI/Z1/wDnjUAff9FfAH/D2L/gll/0ks/YA/8A
EyP2df8A541H/D2L/gll/wBJLP2AP/EyP2df/njUAff9fAHxn/5SOfsIf9kA/by/9On7INH/AA9i
/wCCWX/SSz9gD/xMj9nX/wCeNXz5Zftbfsp/tQ/8FJP2N7X9mf8Aab/Z7/aIuvBP7O37b994ztvg
X8Z/hx8W7jwjZa3rn7Jdpot54nh8AeJPEEmgWur3Vje22l3GqraRahcWd1DaPNJbyqgB+wVFFFAB
RRRQAUV+bfh39oj9tf47T+LfHX7MXwc/Zb1L4A23jvxf4K+Gnjb40/HP4s+EPGHxMsPh/rE/g3xJ
8QbDwz4H+APj7RNP8Da3450XxTbfDzUV8U6i/jHwVp2h+PLcW+l+KdOt4+l/4SP/AIKm/wDRG/2A
P/Elf2iv/oT6APv+ivgD/hI/+Cpv/RG/2AP/ABJX9or/AOhPo/4SP/gqb/0Rv9gD/wASV/aK/wDo
T6APv+ivgD/hI/8Agqb/ANEb/YA/8SV/aK/+hPo/4SP/AIKm/wDRG/2AP/Elf2iv/oT6APv+ivgD
/hI/+Cpv/RG/2AP/ABJX9or/AOhPo/4SP/gqb/0Rv9gD/wASV/aK/wDoT6APv+ivgD/hI/8Agqb/
ANEb/YA/8SV/aK/+hPo/4SP/AIKm/wDRG/2AP/Elf2iv/oT6APv+ivgD/hI/+Cpv/RG/2AP/ABJX
9or/AOhPo/4SP/gqb/0Rv9gD/wASV/aK/wDoT6APv+ivgD/hI/8Agqb/ANEb/YA/8SV/aK/+hPo/
4SP/AIKm/wDRG/2AP/Elf2iv/oT6APv+ivgD/hI/+Cpv/RG/2AP/ABJX9or/AOhPo/4SP/gqb/0R
v9gD/wASV/aK/wDoT6APv+ivgD/hI/8Agqb/ANEb/YA/8SV/aK/+hPo/4SP/AIKm/wDRG/2AP/El
f2iv/oT6APv+ivgD/hI/+Cpv/RG/2AP/ABJX9or/AOhPo/4SP/gqb/0Rv9gD/wASV/aK/wDoT6AP
v+ivgD/hI/8Agqb/ANEb/YA/8SV/aK/+hPr5x+KH7ev7Xf7Mvxe+FfhL9o74D/s3aj8N/Eenav44
+M/i74B/HP4n+LfEH7PvwP0bxN4O8A6t8d/G+jeP/gR8PtFfwJ4d8a/ETwq2u2sfiKDXH8EaZ8Sf
Gmi2WqWPw18SwQgH7G0UUUAFFFFABRRRQAV8F/tbfEf9oTT/AIyfspfAr9n74g/D34V6j8ctU+M1
z4o8dePPhTqHxg+waV8LfAFr4nsdL0fwxZ/En4ZQQzavf36peajdaxdNBDaxrb2uZJS/3pX5/wD7
RH/J9v8AwTp/7u6/9U7olAHPeL/hp/wUf8L+E/FHiWP9ub9n68fw74d1vXUtH/YR1WFLp9J0y61B
bZpl/a7kMSzm3ETSiOQxhiwRiNp88/Zy03/gpJ8dv2evgR8b7v8AbV/Z68N3Xxk+DPwv+Ktz4dt/
2GtX1K30G4+IfgjQ/F02iwajL+1rZyahDpcmsNYxXslnavdJAs720DSGJP0k+LP/ACSv4l/9k/8A
GX/qOalXgH/BPb/kwX9h7/s0D9mn/wBUx4KoA8//AOFMf8FHP+j7/gB/4gbqn/0X1H/CmP8Ago5/
0ff8AP8AxA3VP/ovq+/6KAPgD/hTH/BRz/o+/wCAH/iBuqf/AEX1H/CmP+Cjn/R9/wAAP/EDdU/+
i+r7/ooA+AP+FMf8FHP+j7/gB/4gbqn/ANF9R/wpj/go5/0ff8AP/EDdU/8Aovq+/wCigD4A/wCF
Mf8ABRz/AKPv+AH/AIgbqn/0X1H/AApj/go5/wBH3/AD/wAQN1T/AOi+r7/ooA+AP+FMf8FHP+j7
/gB/4gbqn/0X1H/CmP8Ago5/0ff8AP8AxA3VP/ovq+/6KAPgD/hTH/BRz/o+/wCAH/iBuqf/AEX1
H/CmP+Cjn/R9/wAAP/EDdU/+i+r7/ooA+AP+FMf8FHP+j7/gB/4gbqn/ANF9R/wpj/go5/0ff8AP
/EDdU/8Aovq+/wCigD4A/wCFMf8ABRz/AKPv+AH/AIgbqn/0X1H/AApj/go5/wBH3/AD/wAQN1T/
AOi+r7/ooA/Hn4D3X/BSf4yeJf2ltAuf2zf2eNBT4A/tEan8DrO5g/Ye1jUG8TWmn/Cf4RfEpfEV
zFJ+1laDS7iWf4nT6SdNie9jSLSIbwXjPePb2/oereJ/23fgH+0F+xZ4Y+Kv7RnwW+Nfw5/aV/aE
8cfAvxV4d8Pfsu6v8IvEeh2+j/sd/tV/tHaR4n0Pxb/w0L8RLb7VB4l/Z90TQ7zS73wxcW97o2v6
o8d1Z3lvayj0T9h7/kov/BRv/s//AMSf+ss/so0ftkf8nFf8Enf+z/8A4j/+usv+CllAH3/RRRQA
UUUUAFFFFABRRXz3+098cp/gB8KLvxdofhqLx38RvEniPwp8Mvg38OJNVfQx8RPjB8R9ctPC3gLw
vdaxDp+sXOh+Hhqt9/b3jvxRb6NrH/CFfDzQ/Fvje60y70/w5eREA+hKK+AP+Ej/AOCpv/RG/wBg
D/xJX9or/wChPo/4SP8A4Km/9Eb/AGAP/Elf2iv/AKE+gD7/AKK+AP8AhI/+Cpv/AERv9gD/AMSV
/aK/+hPo/wCEj/4Km/8ARG/2AP8AxJX9or/6E+gD7/or4A/4SP8A4Km/9Eb/AGAP/Elf2iv/AKE+
j/hI/wDgqb/0Rv8AYA/8SV/aK/8AoT6APv8Aor4A/wCEj/4Km/8ARG/2AP8AxJX9or/6E+j/AISP
/gqb/wBEb/YA/wDElf2iv/oT6APv+ivgD/hI/wDgqb/0Rv8AYA/8SV/aK/8AoT6P+Ej/AOCpv/RG
/wBgD/xJX9or/wChPoA+/wCivgD/AISP/gqb/wBEb/YA/wDElf2iv/oT6P8AhI/+Cpv/AERv9gD/
AMSV/aK/+hPoA+/6K+AP+Ej/AOCpv/RG/wBgD/xJX9or/wChPo/4SP8A4Km/9Eb/AGAP/Elf2iv/
AKE+gD7/AKK+AP8AhI/+Cpv/AERv9gD/AMSV/aK/+hPo/wCEj/4Km/8ARG/2AP8AxJX9or/6E+gD
7/or4A/4SP8A4Km/9Eb/AGAP/Elf2iv/AKE+j/hI/wDgqb/0Rv8AYA/8SV/aK/8AoT6APv8Aor4A
/wCEj/4Km/8ARG/2AP8AxJX9or/6E+j/AISP/gqb/wBEb/YA/wDElf2iv/oT6APv+ivgD/hI/wDg
qb/0Rv8AYA/8SV/aK/8AoT65D9hf9ufx9+0l40+KHwv+NXws8HfDHxf4Zu/FeufB/wAVfDrx3rfj
z4YftFfCzwB8QtW+DXxH8ffDfVfFPgrwB4l8j4efF3QZfDuvxX/h1bHUPDPjP4UePPD+pan4e+Ie
lyxgH6XUUUUAFfFn7cPjnxbZfDvwf8Cfhbrt94b+Mf7W3j6z/Z+8B+KNIkWPWfh5oOsaDr3iv4z/
ABf0uRlkjtdY+E/wQ8K/ELxf4OuL2M6XefEy08BeG751PiKBZPtOvgD4Vf8AF9/24fjp8Zbj/SvB
H7J3h+L9kf4TBv3lrcfE7xtY+CvjD+1D40smP7m6jS1f4DfCLT7qOMXfh/xB8OPi5o63kkWu6jZW
4B9p+AvA3hL4YeBvBvw18A6FY+F/Avw+8K+H/BHgzw1pkZi07w/4V8K6TaaH4f0WwjZnZLPS9Jsb
SytlZ3cQwIGZmyx6yiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigCKeeC1gm
ubmaK3treKSe4uJ5EhggghQySzTSyFY4ooo1Z5JHZURFLMQoJr87v2PPCejftFeCvjZ+1Z8TNBtP
EenftxCfTPCfh7xBZC606P8AYk8NReJ/Cn7PHg2Szu0zJoXxP8FeI/Ff7Q3iHSryN3tPFP7Q3izw
+891pmk6YY+o/b/1fVPEXwv8F/sveFdQu9N8Y/tq/EnTP2cBqWmzyW2peHfhRqmg+IfHH7Sni2yv
Ldhc6Pqejfs5+CfifYeD9eTZHp/xN1zwBbNNFcajaiT7d0fSNL8P6Tpeg6Hp9ppOi6Jp1lpGkaXY
QR2tjpul6bbRWen6fZW0SrFb2lnaQw21tBGqxxQxpGihVAoA+Lf2FfE3iDSfBHxA/Zh8e6xqGu/E
P9jjx83wPm8Qa3cyXWu+OvhG/h7RfGn7OnxJ1S9uC1xrereI/gr4l8JaB458Tb5INY+MHg34oQq8
V3pt9ZWf3HXwB8bP+LGftm/s7fH61/0bwh+0VYj9i741svECa/GfFnxR/ZR8Z6i3Aih0Pxy/xY+D
dsIxLPqGu/tGeGUmRbTSfPtfv+gAooooAKKKKACvz/8A2iP+T7f+CdP/AHd1/wCqd0Sv0Ar8/wD9
oj/k+3/gnT/3d1/6p3RKAPsD4s/8kr+Jf/ZP/GX/AKjmpV4B/wAE9v8AkwX9h7/s0D9mn/1THgqv
f/iz/wAkr+Jf/ZP/ABl/6jmpV4B/wT2/5MF/Ye/7NA/Zp/8AVMeCqAPr+iiigAooooAKKKKACiii
gAooooAKKKKACiiigAooooA+AP2Hv+Si/wDBRv8A7P8A/En/AKyz+yjR+2R/ycV/wSd/7P8A/iP/
AOusv+CllH7D3/JRf+Cjf/Z//iT/ANZZ/ZRo/bI/5OK/4JO/9n//ABH/APXWX/BSygD7/ooooAKK
KKACiiigAr4A8Pf8ZHftxeKvFNx/pXwq/YOt2+HfgyBvnsdc/az+LvgTTtc+Jni9VPySXHwZ+APj
Lwr8OPC2q2ckkR1P49fHPw5qUSaj4ct/I+mP2ivjTon7OnwJ+LXxz8Q2F3rOm/C3wF4j8Yr4e05g
ur+K9U0rTppdB8G6EvlymbxD4y106b4X8P2yxSyXetavYW0cUkkyo3Hfsf8AwW1v4C/s9+AvA/jS
/tNb+KepJrnxG+OHiayUi18V/Hf4r+INU+JHxm8Q2ReSaVNGvviL4n8Qp4YsZbm5Gi+FYND0C2ma
x0q1VQD6YooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooA+NP24fiF4w8O/C
rw/8JvhTrd14d+Nv7U3xC0D9nP4VeINN2NrHgmbxlZ6trXxR+LekxuskT6p8D/gX4Y+KPxh0SG7h
k07UvEngnQ9Bv2ih1nzF8q/at+Eei/s8fs+fB74xfAbwk+l3P/BOnTtL8W+DPBnhu2nurvXP2Z/C
vhW38H/Hz4L2NpF5uoa6+vfAuy1LW/BeiZupL/4zfD/4Ta3NBf3uiW8UnQ+Af+L8/t4/Fv4kz/6T
4D/Yu8I2v7Nnw9U82118dvjDongv4w/tDeJYwN1vfL4Z+Gs37PXw+8N6rCWudF1nU/jh4akaFrrU
IG+/JI45o5IpY0lilRo5YpFV45I3Uq8ciMCro6kqysCrKSCCCRQBn6LrWkeJNG0nxFoGpWWs6Fr2
mWGtaJrGm3EV5p2q6RqlrFfabqVhdwM8N1ZX1nPDdWtxC7RTwSxyxsyMCdOvgP8AYJkk+Guh/GH9
jXUZHE37HHxHHgP4brMzNJe/sxeO9HtfiL+zTLasxMk2neBfA+s3n7P7Xs4juNR8QfA3xFfPG0c8
Nzc/flAHk3x6+MHhr9nv4IfGD48eMkuZvCnwa+GXjn4oeILWxVpNQvtJ8C+GtS8S3mnaZCkcslzq
upQ6a1hpdpDDPcXmoXFta28E080cT+ZfsVfB/wAS/A79mT4W+CvH721x8WdT07V/iZ8ctQtGWS11
X49/GTxHrHxZ+OGpWcvmTPJplz8U/Gfiv+xVluLqS20RNNsvtM6WyOfJv29/+K9t/wBl79mGD96f
2kv2p/hja+Lrdfm2/CL9n19Q/an+KEeoJwP+Ef8AF+n/AAX0r4Paw4ZZD/wtWztoGjnuY5ovv+gA
rwL49ftPfBT9mey8IXvxi8T6xoj+P9evPDXgvSPDHw/+I3xP8UeJNY03RL/xHqdvpXhD4W+EvGni
q4t9M0PTL3UtT1IaMNM063iQ3t5A9xbJN77XwB+0x/yep/wTX/7H/wDad/8AWY/G1AB/w85/ZE/6
C/x//wDEKP21/wD6Huj/AIec/sif9Bf4/wD/AIhR+2v/APQ919/0UAfAH/Dzn9kT/oL/AB//APEK
P21//oe6P+HnP7In/QX+P/8A4hR+2v8A/Q919/0UAfAH/Dzn9kT/AKC/x/8A/EKP21//AKHuum8C
/wDBQ/8AZR+Ifj7wT8MtC8X/ABF0vxj8RtauvDfgiz8f/s5ftJ/CnSfEfiK08P634qk0Gw8VfFH4
R+D/AAn/AG1L4f8ADeu6nZ6XPrcN9qEOl3aWEFzOgiP2zXwB+3D/AMlF/wCCcn/Z/wD4b/8AWWf2
rqAPv+iiigD87dP/AOCjvgzxJceJn8A/sy/tpfEzw94Y+IHxL+GknjbwF8A5tZ8Ha14m+EnxC8Tf
C3xwvh/VrjxPYS6lp+meNvB/iHR4702cCXL6e8sSGJ0ZtL/hvv8A6sq/4KAf+I4//hlS/wDBMz/k
1zWP+zv/APgo5/68S/amr7/oA/P/AP4b7/6sq/4KAf8AiOP/AOGVH/Dff/VlX/BQD/xHH/8ADKv0
AooA/P8A/wCG+/8Aqyr/AIKAf+I4/wD4ZUf8N9/9WVf8FAP/ABHH/wDDKv0AooA8F/Z0/aI8GftM
+A9S8e+CtE8deF4dB8deNfht4k8LfEnwvN4P8aeGvGfw/wBbn0DxNoutaFNc3gt5rS/gPlyQ3dxD
NDJG6yBt8ae9V8Af8E+P+Rd/ax/7P/8A2wv/AFaV5X3/AEAFFFVr28tNOs7vUL+5gsrGwtp7y9vL
qVILa0tLWJ57m5uJpCscMEEKPLNLIypHGjOxCgmgD4J8G/8AF6f+ChvxZ8aS/wCk+Ev2K/hLof7P
nhgH5oY/jl+0bZ+C/jt8bJ5Yf9U194e+DOkfst22gakQ93ZWvxE8eaZbPaW2q6kmoff9fBP/AATZ
s7vWP2XdH+OesW09v4i/a78d/Ej9r3UReRPBqEPhz4/eLNQ8Y/B3Q9Rt5Qk0F74J+AUvwn+H0sVx
FBeKPCafbra2vTcQR/e1AHzT+2J8F9Z/aB/Zp+LXww8J31tpHxE1Dw9b+KPg/wCILwgWvhX45fDf
WdM+JPwM8YXHKkweEfi74S8F+JJ0SSF5IdLeJJ4GcTJ1v7OPxo0b9oz4BfBv48aDY3Ok6b8W/ht4
Q8epod8CupeHLvxHolnqOqeF9WjIDQ6z4Y1Sa88P6xbuA9tqmm3du4DxsB7TXwB+w1/xb3xJ+2F+
zFN+5h+B/wC1H438beBLZuDcfCT9q+C0/ag0G8sk+ZoND0L4m/Er4x/CrRbR2Asrb4XvaWUMGkQ6
ZGAD7/ooooAKKKKACvz/AP2iP+T7f+CdP/d3X/qndEr9AK/P/wDaI/5Pt/4J0/8Ad3X/AKp3RKAP
sD4s/wDJK/iX/wBk/wDGX/qOalXgH/BPb/kwX9h7/s0D9mn/ANUx4Kr3/wCLP/JK/iX/ANk/8Zf+
o5qVeAf8E9v+TBf2Hv8As0D9mn/1THgqgD6/ooooAKKKKACvHvjNoPjq/wDD9l4j+Gmr31n408E3
w8QaboI1G9t9B8b2kARtV8H+ILCCZbS8TWbKJ4NKvLqCSfStTMM1pPZLPdT17DXh3xli8e+J49G+
Gngi0vNMtPGbzQ+NviAFC2vhHwfCpOqW+mM0iG68T+IIw2kaZFGJBYR3M2oXAiVYbiL4jxH9hLgv
PaFXC55ja2Kw1LCZbheGp1aOfVM6xGJo08jllWLpxlDL8ZQzeWCxNPNcZy5ZlSoyzLNalPLcLi6k
fpeD/ariTK6lOvlmGp0K06+Mr5zGFTKoZbRo1J5nHH0JuMsXh6uAWIozwOHvjMc6iweBjPGV6EZe
f/DXx5rv7RPirSvHGh3Gu+EvhH4HWOP+zUvrnS9W8dfEK50+0udQsNbSxuIZT4W8Di6Wyl064C22
u6+ZjdRXen2htl8vvvEHgi8+JHj7Sfj/APE74keAPEo8aaxa/DvTR4r8V/D/AMGR+Bg8Nv4X1bQL
3Q5LPw3qN7erbSXOo3Ot31zNLeAx3FkscUkZ9X0v4caj8CviLoV58LfD13d/CjxxHpfhvxz4S0uN
Jj4R1vSrBLDQ/iDYRvNHNJa3Vlbpp/i8qLm7uDFb6k4u7nykhjl8a+P/AAwNd8E/GD4R+Mfi7pr6
5qL+G/Fng3wr4Y8S6V4i8NXl5cTaTB4j8Pfa9KttC1bSbZ1068E1oba6WGO7WVzNJK/804vCZ68j
wGD8QqmMXGeA4uznFcZ5jnPCef8AGHhdn2YSyrCw4fdPCZBjslxWW5BXyOthY8H4ynha+W8P57lm
cYPiCji+Lq1PEZx+y4fEZYszxWI4Shh3w7ishy2hw7g8uz3KuH+N8rwkcdWlm3NiM0w2ZUMZmtLM
6dZ8QUJ16WMzXLMZl+IyqpQyClOll/OeL774geD/AIQ/D9Lr4lf8JbcTfHL4e6Ro/jrw9qkqXvif
4fat4ytLaxg8Q32ni3tNQ1C60uaSw1o2jXGn6gsaTPLcTSTOftGvz3m+FnjnQPgzGLPwFqVg11+0
Z4c+KWkfCrQJ9O1a88FeCbLxHpd8+jWognh0xLwwabc6vcafaai+nWt3qYtopLeX7Sq/V/hn4p3v
iPXLLRZvhP8AFnwzHefad2t+JtC8P2eh2X2e0uLsfbbmx8ValdR/aWgFpbeVZTb7u4t438uN3lj+
58KuI62XZzUwfEeB4lyOeb8H+GmEyXLs3o8V5zGOJp1OJ8FXg82zPLYYuFacZ5bVxM+II4HOqNCv
hP7fpYfGwrRh8xxzlFLF5dHEZPicmzKOA4h4yxGZYvL6mRZc3RnDJMTSawOCxkqEqcJRxtOjHKZY
rLalWliP7KqVcNOk5es0UUV/Sh+OBRRRQAUUUUAfAH7D3/JRf+Cjf/Z//iT/ANZZ/ZRo/bI/5OK/
4JO/9n//ABH/APXWX/BSyj9h7/kov/BRv/s//wASf+ss/so0ftkf8nFf8Enf+z//AIj/APrrL/gp
ZQB9/wBFFFABRRRQAUUUUAfAH7W3/F2fjz+xt+ynF++0jxH8RNX/AGs/i5a/eiuPhR+x5qPgvxF4
V02bP7lLjVP2qfH/AOzRfpaXYlTWPDHhvxvbW9rMLW6u9N+/6+AP2f8A/i6P7bP7a/xtk/f6L8LL
f4OfsW+ApT81sJ/h/wCGbr4+/GLXtKfhj/bnjL9oHw18PfEBYMg1X4HQ28Ija1uXuPv+gAr4i8af
8FFP2TvAfjrxp8ONY8YfEfVvFnw714eFvGlv4A/Zv/aX+KmjaB4lGk6Xrk2gXXi34Y/CHxf4Sl1i
00zWtLuNQ0601y4u9Na8jtr+K2uhJAn27XwB+wj/AMjF+3v/ANn/APxZ/wDVW/A+gA/4ec/sif8A
QX+P/wD4hR+2v/8AQ90f8POf2RP+gv8AH/8A8Qo/bX/+h7r7/ooA+AP+HnP7In/QX+P/AP4hR+2v
/wDQ90f8POf2RP8AoL/H/wD8Qo/bX/8Aoe6+/wCigD4A/wCHnP7In/QX+P8A/wCIUftr/wD0PdfQ
3wF/aZ+C/wC0zpfi3Vfg54n1bXU8BeJofB/jPS/EngP4h/DPxP4Z8RXPh7RfFdnp+s+Dvih4U8G+
LLJdQ8N+ItF1nTb6XRV0/UrG/imsbu4CTCP3mvgD9lf/AJO7/wCCnf8A2X/9n/8A9Yo/Z3oA+/68
N/aJ/aA8GfszfDOX4o+OtK8Za/pbeMvht8PtJ8O/D7w5N4t8Z+I/Gfxb+IXhn4X+A/D3h/QYJ7U3
19rXjHxdomnr5l1bwwR3D3E0qpEc+5V8Af8ABR//AJIx8Ff+z/8A/gml/wCt9fs60AJ/w33/ANWV
f8FAP/Ecf/wyo/4b7/6sq/4KAf8AiOP/AOGVfoBRQB+f/wDw33/1ZV/wUA/8Rx//AAyo/wCG+/8A
qyr/AIKAf+I4/wD4ZV+gFFAH5/8A/Dff/VlX/BQD/wARx/8AwyrH1v8A4KR+C/CFvYav8Qv2Yf22
Phv4SuvEnhHwzqHjjxr+z9c6b4S8OXXjbxVo3gzRL7xDqFn4m1G6stLOva/plvdXMFjdyQpOZFt5
Su0/oxXwB/wVA/5Mr+Iv/Y//ALN3/rTnwcoA+/6KKKACvOPjF8UvCvwO+EfxS+NXjq5ey8E/CH4d
eNfif4wu41Dy23hfwF4b1PxVr08SEgPLFpWlXTxJkb5Aqjk16PXwB/wUI/4rjwZ8Bv2Y4P3s/wC1
j+078J/hpr1qvzC4+Evw5uNU/aU+PVjepwItJ8V/Bj4HeNfhxdXkrxRwXvjvS4IHk1O706zuwD0f
9hj4W+KvhR+zF8OrH4kWyW3xi+IJ8S/HP46KrGXy/jf8evFGsfF74qaZFcOBJNpXhjxh4y1Pwh4Z
jcJHp3hPw9oOkWUFpp+nWdnb/XFFFAHwB8Yf+LM/t1/szfGaH/R/DH7TPhPxV+xl8TXXhJfGnhiw
8WftDfsx69qDjaINP0EaF+0r4BgeUS/a/Enxp8M2ULW7vsu/v+viL/gov4U8QeIP2P8A4seKPBWn
Tat8RvgUvhP9qP4Y6XabVv8AWviF+y5408P/AB98MeFbKV2SOJvHd58PT4CvROwsrrSvFGoWGpLL
pt3eQyfXfhDxXoHjzwn4X8c+E9Rh1jwt4z8O6J4r8Navbhhb6poHiLTbbV9G1GAOquIb7Try2uYg
6q2yVdyg5FAHxFqH/FxP+Cnvh2y/1+m/srfsVa54iu4etvF4v/bL+MdjoHhbUHz8p1bRvCf7HXxE
sLURMZLPS/G+oG8jSPVtOeT7/r4A/ZM/4qr9p/8A4KSfE5v3kMX7RHwp+Avh66+8t14Y+DP7LnwZ
8TXwik5Xy9P+K3xk+LGkPCrMIrzTrtn2TSyxp9/0AFfAH7TH/J6n/BNf/sf/ANp3/wBZj8bV9/1+
cP7bXibSPhV8eP2Ffj34+e/0D4MfCj4jfG9Pir8S20XWtS8IfDCx8c/ALxl4X8N+JfiPq+j6fqFv
4F8EXHiCa20rUvH3io6T4K8PXV3ZL4i1/SkvbR5gD9HqK5vwj4y8IfEDw7pfi/wH4q8N+NvCet24
u9F8UeEdc0zxJ4d1e1YlRc6XrejXV7pt/blgQJrS5ljJBAbINdJQAUV8YePf24fhfpvivV/hV8D9
F8UftYfHLRrg6frXwt/Z+XRPEdt4C1E8CL41/FfV9X0X4O/A7yUZL99F+JHjrRfH2taStxdeBPA3
jW9hXTJuP/4RP/gpX8Tf9O174wfstfspaRP8yeCfhh8LvG/7UfjyzK/NA8/xw+JPiv4H+CGWQHZq
Wjw/sxXbRvlNP8WuiC5nAPv+vgD9uH/kov8AwTk/7P8A/Df/AKyz+1dSf8KN/wCChOi/6f4d/b5+
GfiTUouE0j4tfsW6Hrfg+6jPzSJcW3ws+OPwc8W294xVY7a/g8XvaWayTSXOi6q3lRx+E/FE/ts+
PfjR+w74M+L/AOzLoEtl8OP2trH4p698fvgB8RrTxj8G4/B+hfs9/tC+FLq78b+EfiBZ+BPiz8Lf
Eep634y0ODStA07Rfi74NHnGzuPi0dZuNN0u/AP12ooooA+AP+CZn/Jrmsf9nf8A/BRz/wBeJftT
V9/1+Sn7K/7Qnwv/AGP/AAt4h/Zz/ay1t/2bPHU/7Tn7XvjDwZ4i+MkK+Dvg98UvDPx2/a6+Nnxl
+Gt58NfjldzSfCLxHruseEPiJ4divvh3J4y0/wCKOg67JLpWueCLB5tNl1D9WdH1nR/EOmWWtaBq
um65o2owi40/VtHvrXU9Mv7diVE9lf2Us9rdQllZRLBLIhKkBsg0AaVFfMHxd/bQ/Ze+B+qxeFvH
/wAZPCY+Il7JNb6L8HvBst78S/jl4nvLfaJrHwl8EPhxZ+Kviv4qvInkhimg0DwhqDW8txbpcmHz
4i3j/wDwkX7dv7Q3+leAtF8I/sOfC24+W11z4yeFdP8AjZ+1F4nsn+YalpXw08M+OrD4NfA1ZEEF
1ot34+8VfHXxJd21xdWHjH4P/D/WbIQOAff9FfAH/DDHjPVf9L8bf8FAv29fFust876jY/EH4LfC
6yikbmRLTw18F/gJ8OfDSWqkRpbxX2l6jcxwwp517c3M19dXh/wz5+2t8L/+Jh8G/wBuLUvjFbwf
vZPh5+2n8Ivhj4s0zUIk+dtJ8PfFP9mvwt+zp418FTXz7v8Aip/Geg/HX+yjK7ReFdRtYrXToAA/
4J8f8i7+1j/2f/8Athf+rSvK+/6+H/2C/ht8Z/hz8Nvi1N8efBPhz4d/ED4lftQftBfF+bwj4T8d
xfErw/pWi/EPx3d6zoo0vxmnh/wlca3ZXNmVurO51Pwn4W1lrOa3OseG9C1I3OlWn3BQAV8Qf8FJ
PFGt+Gv2G/2jbLwreyab43+JngeH9n34dajCWE+n/E79pnxFon7PHwyvbcIyO9xaePvif4cuLeJX
Rppo0iDqXDD7fr4A/bo/4qTxb+wR8Ix+8T4n/t3/AA01W/h6hNN/Z1+GHxk/a2gvZx/DbweJ/gH4
XtUkPA1K/wBNi+/MlAH2/wCE/C+ieCPCvhnwX4aso9N8OeEPD+jeF9A06IKsVhomgadbaTpVlEqK
irHa2NpBAgVVULGAqgYA6CiigAr4Au/+Ld/8FPtHuB+5039qr9ijVdKuHHy2z+Lv2MvjLZanosDq
MJ/bGueFP2yvFU8Uu0z3mk+A5oppPJ0a0jX7/r4A/bJ/4pj45/8ABOP4pp8kHh/9r3Wvhj4km7t4
V+Ov7Mnx/wDAun2it/C1x8XV+EExLbleK0lhCiWWKWIA+/6KKKACiiigAr8//wBoj/k+3/gnT/3d
1/6p3RK/QCvz/wD2iP8Ak+3/AIJ0/wDd3X/qndEoA+wPiz/ySv4l/wDZP/GX/qOalXzn+wPqWnaP
/wAE+P2J9T1e/stL02z/AGPP2aZbvUNRuoLGxtYv+FM+CV825u7mSKCCPcyrvlkVdzAZyRX0Z8Wf
+SV/Ev8A7J/4y/8AUc1KvnP9gfTdO1j/AIJ8fsT6Zq9hZappt5+x5+zTFd6fqNrBfWN1F/wpnwS3
lXNpcxywTx7lVtksbLuUHGQKwxX1n6tiPqXsPrnsK31T617T6t9Z9nL2H1j2X732HteT23sv3ns+
bk96xrQ9j7aj9Z9r9X9rT9v7Dk9t7HnXtfY+09z2vJzez5/c57c2lz6I/wCFvfCb/oqHw7/8LXw1
/wDLOu6sb6y1OztdR028tdQ0+9gjurK+sbiG7s7u2mQPDcWtzA8kFxBKjB45YneORCGViCDXyGvw
1+HP/DVU+i/8IB4J/sY/s+2uqHSf+EV0L+zDqY+I15aDUTYfYPsv24WpNsLvyvtAtyYfM8sla6K5
8XfFS6+LXiH4R/DCy+Gnhvwv4B0DwJrT3utaPrExTTdbXVIZPD9jpWjarptpGHXT91jcwLaQ6bBa
yW7w3L3cMtt+JZP4m8R4V4ufF+VZdiFPjXMOAMky/gvD5lj80zLPsvwmMzOpVnDM6uFwuHwM8sy3
H4iVSrXprDuh+9q8j5j9JzDgvJ66w8eH8fjKPJw3hOK8zxfEdXB4TA4LK8XXw2ChCMsFCvXrYqON
xmGoqEKU3VVVezhzKx9SUV8Z/ET40fELwhp/jjX7vx18D/B974ZudVm8P/C/xBN/bPinxDo+kSSy
wvqeraR42hk03VvENpH/AKBYWfhy4i02Wa2XULli0/k9Fd/Fn4neL/HfgnwZ8OrHwdoln4w+C2m/
Fi81zxXa6prVz4dGoalHZpZRWGm6ro0Wsktd2NssZew2Mbq9e5ZEis29GXjfwisfispWC4hnnFHE
ZThsLk9LL8LVzPMZ53mWOyjLnTwdPMJVcqdTHYCrDEUOJVkWLwNCpSxmOw+GwbqYilyLw0z94Whj
3iMpjl9Sjj61fMJ4uvTwWEjluDwuPxfNiJ4SMMeoYXF05UquTPM6GJqQqYfDVa2JUKU/qqmsyorO
7KiIpZ3YhVVVBLMzEgKqgEkkgAAknFfGF7+0D8QdD8A+NJta07w2fFngb4v2Xwr8QeLrDRvEN14K
0XSb6y0y+X4h6n4etL67102FrFqMNpeaXHqsCLqN1asl+IGa3a9qvjPx54v+FfxnGneNfhR420CD
4danf6L478JwXLBkuNH1Y69oGueE7fxXeXWlasNMi+0aJqa609qsk8b3djcNDNbDnl468KYhV8Pl
WBzrMc0o8P5hnkss9hg8LiqFTAUM+lUy/F4evjljYOOL4czLLcRm2EweN4fwePhSwuIzaFetSpz1
XhhntJ0auOxOXYTA1c2wmWRxvtcRXoVY4urlUYYvD1aWGeGknh84weMpYCviMNmuIwrqV6OAlTpz
nH6k8P8Aizwt4shubjwt4l8P+JbeznFteT+H9Z07WYbS5Khxb3MunXNykE5QhxFKySFSGC45rfr4
o+HXiDx9oHhj4KfCnwTp/gK28Q+Lfh/Z+OdU8TQ+F9R0/wAP+GfBGmaH4b063nv9DttdefxH4x1T
U7+2s3vBq+lWLhDLJaRptKbPir44fEb4daJ8Z9J8U6V4Z1Hxn8NvBulePvC2u2Fjqtp4Y8X+G9Wv
Z9LVr7R5NTlvtL1LTdTsb2zvbe31u4hnDwT27okbibDLPG7J6HDlDOOK8DmmXTw+X1Kmd4/BZVVq
ZHg86ocJT45xPD+HrrGYrE18ZQ4cg6scYoTyjEY+P9kxzGnnU1lUNsb4aZhVzerl+RYrA4uNXFwh
luExOOhDM8RltXP4cMUc1q0/q1ChSw9XOJKDw7lHH0sLL6+8JPLY/XpfX1FfI+vfEb4+eEbb4fJq
8Hwtv9Y+KvxA07w3olja2PiWK08K6ZqvhvXNXK6tfHWd2tXWk3NjZmWeytrNNQgiv4oYoJLu0lsz
SfGf7Qmq+PPGfwkh1T4XLrXhDSPDfiW4+IMnhnxCNPmsfEiXgs9Dj8Fr4p89b83Gn3Zk1g+JZbWK
zhIOmNdXELRei/GjI/rtDLY8M8byzHE5jh8mpYJZLhIV/wC2sfkeI4myzKantc0p06OKzHIMJis0
hWq1IYDAYejy51jMsxFWhRq8S8Ocy+rVcY864aWDo4StmM8T/aVeVL+zcLmdHJsbj4cmBnOpRwma
4ihgZU6cJYrF1qnNluHxtKFWpD64or5asPi78QNc+Gnw98Vhfh54Lk1/VvEuk+PfGXinUki8JeDv
+Eb1PWtDEul6Rfa/ouoazea/qel/8Sm0OtCGxQSnUppowsh8d8ZfF3xX41+Gf7T3gqPxZ8PvFEng
bwENVtfHHg7TdQXSdd8N+IdM8RpqOm/ZovFWoR6d4isDpZgg1C01TVNLIkWSWzmO5T5+d+PfCWVZ
fQxuHwOcY2pmfDWI4h4fo1qOGytZ04cE4vj7DYChTx+Jp5nFYjIcFiPaZtTyrEZJhMwo4jJ6+Yf2
1h6mWrry3wsz7HYuph6uKy7DQwec0cozWpTqVsc8uU+JcPwrWxVWeFoywUnSzTE0eTATx9HMsRhK
tHMKWF/s6tDGH3u+r6VFfWOmSanp8epanBcXWm6e97bJfahbWgia7uLG0aUT3cFqs0LXE0EckcIl
iMjKJEzoV8jaP401Dwv4h+BOjeKdL8G6tJefCPxz4kufFFj4cu7fXdG0vw1pXh24ttO0Ke81jUp7
YXunXkSa8BK0Wp3VojwQWURSJIv+FofHX/hV3/C+P7G8F/8ACL/2Z/wmn/Cr/sGsf8JT/wAK9/4/
/tX/AAmH9qfYv+En/wCEd/4m/wBl/wCEZ/s7d/o+7f8ALXVh/GfJYU8z+vZdnFTFZVRr5lmmXZTl
lXH4rIcly/hjhDiHNsdms1WVDEvAR4twUYYfKJ47MMxjKdPKsux9bA5j7DCr4c5lKWCWGxmXQo46
pRweBxeOxkMLQzTMsZnOf5TgMLgIum6tFYp5DiJSq5hHDYTBtRnjsXhaeKwntfr6ivlWD4kfF74h
fEXx94O+HEvgLw/4d8I6J4B1yz8TeKNF1vWtSu28b+Hl1q102bR7LX9KhGRHdPJfieIWUSQQfZL2
aV5o/Ufgj8QdS+Jvw60vxTrdhZadrZ1LxHoes2umGc6Z/aXhrxDqegXM+m/aZp7pbK6bThcwx3Mr
zRCUwu8nliV/o+HPE7h7ijPHkeW4fOIyqf62LLszxeAjQyrOZcD8QYbhjihZXiPbzrVY5Zm+MwlF
Vq+Gw2Hx1Ov7bLq2LhQxf1fyM44LzfJMsWZ4yrl8lBZC8ZgsPinVx+XR4mymrnWSPHUfZRp03jcB
Qr1HTpVq1XDTp+zxcKEqtD2vyz+w9/yUX/go3/2f/wCJP/WWf2UaP2yP+Tiv+CTv/Z//AMR//XWX
/BSyj9h7/kov/BRv/s//AMSf+ss/so0ftkf8nFf8Enf+z/8A4j/+usv+Cllfoh8iff8ARRRQAUUU
UAFRzTRW8Us88scEEEbzTTTOscUMUal5JZZHKpHHGil3d2CooLMQATUlfHn/AAUK8e6p8MP2Ef2x
PHWgFj4o0H9mr40SeDIUcxy3vjq+8Aa9pfgbTYHHzLcap4uvtF0632BpDPdRiNJJCqMAcP8A8EyI
ZdW/Y4+HnxbvIpE1L9p/xN8WP2vLmW4Ro7p9M/ap+K/jP46+CrO4SQLNEvh74d+OfB/hSwtrlEur
LSdB0+yu0W5tpRX33XB/CzwFpfwq+GPw5+F+iBRo3w38B+EPAWkBEEaDS/B/h/TvD1gFjHEa/ZNO
i2oOFGFHSu8oAK+AP2Ef+Ri/b3/7P/8Aiz/6q34H19/1+Xv7KvxY+HPwh+Pn7YHwL+LPi3Svhf8A
Ff4oftfeOPir8KPB3xFebwTd/F34e+J/hx8INO0zxR8IL/xNDpmj/Fawg1TStQ0jXk+Hmo+JLvwp
rNudI8U22jalJFayAH6hUUVx/j34heAPhX4U1fx58T/HHg/4ceB/D9ubvXvGfj3xNovg/wAKaJag
4Nzq/iLxDe6dpGm24PBmvLyGMHgtQB2FFfAH/DWHxo+Of7r9ir4AN4w8IycD9o/9pTVPFPwE+Bt9
C/y/bvhf4XPgvxJ8cfjasOUvbDVrLwB8PPg74w0uWC88IfHXU45WaIPwO/4KF65/xMPEf7e3wv8A
DGpS/e0f4R/sW6Po3hC0i6xxww/Fb45/GPxXd3iAmO61GXxVbWl8yCe20LR1c2qgH3/XwB+yv/yd
3/wU7/7L/wDs/wD/AKxR+zvR/wAId/wUq+Gv+n+H/jZ+y5+1NpVt+8bwN8VPhF41/Zn8camzfNMk
Px0+GPjT4x+DNOjTLLp9jN+y5dSELFDf6+xaW+XI/Yesvi/qnxf/AG7/AIpfFr4FeOfgFN8Uvjl8
Kr3w54W8dat4I1+fVbTwT+y58E/h/rmveHdf+H/ifxToGv8AhK68TeHNWh0HWVvNP1G7tIRHreg+
HNet9V0DSwD9Fq+AP+Cj/wDyRj4K/wDZ/wD/AME0v/W+v2da+/6+Iv8AgoF4L8d+M/gP4YuPh54J
174i638N/wBp39jb446p4N8KPo58V614I+BH7Vvwe+L3xDj8L2eu6toenax4itPA3g3xBf6NoH9q
W194gv7WHRtJW51W+srScA+3aK+X/hF+2j+y78cdXm8KeAPjL4Sb4i2L28Ot/B3xjNefDT45+F7q
68xYLLxd8D/iNaeFfix4Vu5pIbiGCHX/AAfp5uZba6S1Mxt5in0drGs6P4e0y91rX9V03Q9G06E3
GoatrF9a6ZplhbqQpnvb+9lgtbWEMyqZZ5Y0BYAtkigDSor4S1j9v34U+KNVv/BX7KWj65+2n8Sb
K6m0290z4AXejat8KvB+owsYblfip+0bqV7afBDwB/ZU+Tq3hg+MNd+K81vb6gPCnww8Wajp9xpi
5v8Awo79ub4s/wDEw+L/AO2JY/s86ddfvE+Gn7Fnwz8CXd3pNtL88mieIfj1+1B4L+LuqeP5omLW
/wDwlvgr4Kfs9XVxaBHtvDukX4N4QD7/AK+AP+CoH/JlfxF/7H/9m7/1pz4OUf8ADCniyx/0vw1/
wUA/b98N699466/xL+DPjlGl/wBYZG8I/FX4BePvh0qvciO5a3h8Gw2yiP7DDFDpc1xYTfP37UHw
F/4KLeJfg9f/AAXtfGvwV/ay8FeLfHfwYlm8Ua34fH7OHx08B6L4N+NHw+8c6v4l159G1DxV8F/j
R5Wk+Gb77dp3hzwv+zpd2UT+fo2neKr+OHRbwA/YCiiigAr4A8U/8XD/AOCmvwn0EfvtL/Zi/ZA+
JfxP1m1PzJB41/ak+J/hf4bfCrWSDkQ3Fn4O/Z6/aM0e3cASTweItQVZESGVJvv+vgD9mL/irP2y
P+CkXxHPzp4c+JH7Of7MlhcHkT6b8KP2cPB3xznWBv47ez8UftY+KNPcjhNStNShPzxPQB9/0UUU
AQ3Fvb3lvPaXcEN1a3UMtvc21xEk9vcW86NFNBPDKrRzQzRs0csUiskiMyOpUkH4M/4JkXFxp/7G
nw0+Fd/PNPqv7M2vfFT9kS+a6lea9ktv2UPit40+AHhrUbuaVmlnbxF4M+H3hvxTa3UzNNe6frln
eynzLlgPvmvgD9kH/il/2if+CkXwvb5ILL9qXwP8Y/DcHTyvCvxt/Zb+A91qDsP4mu/i74M+L94J
FCqYp4oiplhlllAD/gm//wATT4KfF3x0/wA0/wAR/wBuP/goF4j87r9p0jQf2zfjb8NPBt2snPmR
3XgPwD4WnhcM6CGSOOF2gSI19/18Af8ABLb97+wd8AtRPMniGx8feLp2P+se68ZfFXx14qu5J26P
dSXOsSvdyD5ZblpZFAVhX3/QAV8z/tFftTeC/wBm64+GWka/4M+LHxH8W/F/xJrnhnwH4H+DfgW5
8eeLdWuvDHhXVPGfiG+fT473TbW00vR9B0m4uLu5uL5JGeWCO3t5x57QfTFfAH7TH/J6n/BNf/sf
/wBp3/1mPxtQB8R+LvD/AOxb4t8Rap4xt/8Aglz+3Z8NPGeu3BvfEHjX9nv4O/EL9mLxp4j1AgKm
q+JPF37Onxf+FviPxDrEASIWusa1qd9qdn5Ft9lu4fstv5XN/wDCv/2P7/8Ad+Nf2Cv+CuXxksD8
smhftFeOv2y/2lvC88Xe1uvCf7QH7V/xJ8NXdixLl7C50qWydpZ2aAm4mMn7/wBFAH5n+Av2ufAH
wr8KaR4D+GH/AATy/bQ+HHgfw/bi00HwZ4C/ZL0Xwf4U0S1ByLbSPDvh7xLp2kabbg8iGzs4YweQ
tdh/w33/ANWVf8FAP/Ecf/wyr9AKKAPz/wD+G+/+rKv+CgH/AIjj/wDhlVzw5/wUA8F6n8Rfhb8N
/F/7P/7WnwfvfjF40l+HfgbxN8W/glc+FfBd940Xwf4s8c23h+71221/VzYXmo6B4J8RTWLz2gtp
JrLypp4A4kH3pXwB+3D/AMlF/wCCcn/Z/wD4b/8AWWf2rqAPv+iiigD8wNF/a+/aC+PWheObz4Z/
8E/5fin8HYviX8cvg3BrHjL9oL4P+GovG/8AwpX4u+O/gd4yu7/wNrmm6w9no2q+KfAGvtYafqk9
y93o0lpPdRRtcPbx/KOsfsg+Ate1O91nVv8Ag3p/YyutT1WYz65eDxF+x1byeJWIA8rxWLX4aQp4
rtQVV1svEaapZrKiTLAJUVx93f8ABMz/AJNc1j/s7/8A4KOf+vEv2pq+/wCgD8n/AIRP8cP2ftKl
0H4C/wDBHj4P/BLQ544YZ9G+EXxv/Zp+G2lTRW2428UuneDfBWi2ckduXfyUeErFubywu459g/4a
I/bt/wCkdP8A5t18Hf8A5SV+gFFAH5//APDRH7dv/SOn/wA26+Dv/wApKP8Ahoj9u3/pHT/5t18H
f/lJX6AUUAfNP7K/7Qt5+0h8PvEninWvhxq3wm8W+Bvit8Tfg5448C6t4h0Lxb/Y/i/4X+KLvw1r
Dab4n8Ov/ZmuaTeGCG8s71Leyk/fSW72uIFuJ/pavgD/AIJ8f8i7+1j/ANn/AP7YX/q0ryvv+gAr
4A+Nf/E9/wCCiv7BvhX/AFi+Gvgp+3L8bXjb5ooJfCrfswfBq3u9vIS8MX7Ql9a2rkBmtLjVUjJX
zhX3/XwBq3+m/wDBU3wD5n77/hGv2APi79l/i/s3/hN/2ivgj9v/AOuf9t/8K/03rjzv7A4z9nO0
A+/6KKKACvgD/gpd/oH7M+geMl+ST4ZftZ/sD/E+W5XiS20TwP8Atxfs9a14z8t/+Wf27wHB4p0q
d8hfsuoXCyHy2cH7/r4A/wCCqf7r/gnT+2JqQ+WXw78EPFni+2uen9n3vgyKHxXY6vu/5Z/2NeaN
BqvnHAh+x+aSAhIAPv8AooooAKKKKACvz/8A2iP+T7f+CdP/AHd1/wCqd0Sv0Ar8/wD9oj/k+3/g
nT/3d1/6p3RKAPsD4s/8kr+Jf/ZP/GX/AKjmpV4B/wAE9v8AkwX9h7/s0D9mn/1THgqvf/iz/wAk
r+Jf/ZP/ABl/6jmpV4B/wT2/5MF/Ye/7NA/Zp/8AVMeCqAPaR4C1MfHGT4ofbLH+xn+FMPgIWG64
/tManH4vn8Qm8K+R9l+wm1lWEN9p+0faAQYBHiQx+H/h/qekfGH4jfEae8sJNK8Y+GfA2h2FjCbg
6hbT+Fv7cN5NeB4EtlhuDqsQtvJnmciOQyrH8oPrVFfIQ4H4fhicJi40MQq2B4vx/HGHf1qq4x4g
zLKczyXFV5RvaWHlgM3xsIYV/uoVJwqRXNTie/LibNZUcRQdSl7PE5BhOGaq9jC7yrBY/BZlQpp2
vGqsVl+GlKsvflCMoN2mz4q0/wCAPxQ0bwT4z+HGj3HwntrbxQPHEE/xQm03V5/iHrGn+Lp9QuZI
9d099M+wtq1xHqEuk3etDX7+O2sRFdW+kz3UCxP6p4F+Euv+GfHPgnxXqF/pEtr4b/Z/0T4S31rZ
y3ss82u6ZrOm6lPqFo09lbRvpLxWUkcUkxgvDIyb7NFLMvuOr38mlaVqWpxabqOsS6dYXd9HpOkR
20uq6m9rbyTrYabFeXVjaS394Yxb2kdzeWsD3Ekay3EKEyL5Z4e+OvgDxdL8N7fwpdah4iuvifpO
peIdItNLs1kudC8O6Kjw61rfjGOaeD/hG7LSdd8nwjdw3hOonxbcroVtY3Fza6kbH5TJfBXgnIcT
lWKwUM3nLI45XRyejic2r1cNl+EyXF1MZlmFo0EoU6iw9arVdbGYlV8zzFSj/amOx0qNCVL3sx8R
+Jc0o46hiZZfFZm8bUzCpRwNKFbF18xoQw+Nr1KrcpQdanTp+zw9H2WCwji/qOFw0alWNTjLf4T/
ABI0I/E/U/CPi3QdK1rxd8Xrf4jaXb3lpeXuj6poUOh6TpF14R8VbYIb20t9UNhLLcXeitNPbFLQ
o9xE1zbSc7pXwG8WXOq/E7xTrUHw08Jaz42+FOs/DSy0H4d2eqQeH7i41R7y7HinxNfXlhp1xe6r
Hczx2cbW+jmSHTvPDT3UjIi+tw/GvwfP8KfCnxjSDWx4T8Y/8K//ALJhaythrKf8LJ8SaB4W8P8A
2yzF8beHytS8Sae+p+Vez/ZrVLmWD7VJGkUvK+Iv2gpPDvje28AP8FfjNqut6pH4ovPD8ulWfw2f
T/Eek+D7zR7LWta0qe/+Jmnzpp0UniDRJIRqtrpl/NDqUDCxV0uY4KreDHBWIq4OVeOc1cNgMRme
Nw2XVc5xlTL6WYZrVziriswo0KkpSwmJlLPcwTjgquGw1eLw/wBcw+KlhaEoKn4jcSUYYhUnl1Ot
iqWCw1bGQy7Dwxc8JgIZdChhKlSKUa9FLK8I08TCtWpNVfq9WhGtUUqt58JfG2jW/wAJPEfgbWPD
kXjz4ceBrbwBq9l4h/tY+EvFnh+XTNKg1C1kudPiOp6dPZ6tpVtquj6hFYTOSr215atDO6pzHiX4
DeOvHXhv4x6h4s1zwovxF+KHhHS/BGlxaOmrx+EPCnhzRbmW9tLFLq7gk1fVbi71G8v9S1DUJtPg
YzTRWtraQW0XPqvgL44eEPiF4++Jfwz0y017S/F3wobwuvimw1200+1jkbxVoya1bf2NcWWqaimq
x6XFJFZa3cQbbay1GWCCOa5jngnkw/Bn7SXw88eaT4V1vQIfEbaZ40+KOsfCfw/c3emW1uLzXdI8
PeIvFP8Aa5T+0ZJI/DWp6L4avLrSr8qby5W608y6bbpcSPDWO8GeCcxpYzCYqlm88sxuFxFKvk8c
4xkMr+u4nhSpwRWzmGFUrQzWXDVSeBVRT+qRxD/tVYP+2P8AbxYXxF4kwdTD16E8vjjcNXpVKWYP
L8PLHfVqGew4lp5dKu43lgVnMI4pwcfbukvqLxDy/wD2U2/Hvw31XxXf/Bm7sb7T7dPht4607xTq
q3RuVa+srPw5rGiy2+n+Tbyg3TT6lFMguTBEYo5N0qvtU2vD/wAP9T0j4w/Eb4jT3lhJpXjHwz4G
0OwsYTcHULafwt/bhvJrwPAlssNwdViFt5M8zkRyGVY/lB9O1G7ksNPvr6GxvNUls7O6u4tM04Wp
1DUZLeB5ksbEXt1ZWRvLtkFvai7vbS1M8ifaLq3i3yp4D4S/aGHjDxlq/gez+DXxi07VfDWqaFpX
iy51a0+G8WneFZPEWn2+r6bdavLY/Eu/upLR9JuodQkbSLPVLhICUFu9yPIr6N8BcOvOKeeewxP9
oUs/wXEsJ/Wqvs1muX8KYvgvDVXSvyulHIcbXoSo/BOu44lr2sUzxlxRm6y6eV+1o/VKmVYnJpR9
hT5/qOKz3D8R1oKdrqbzTDUqqqfHGkpUU+R2OEf9nvxdY2XwlvLV/AfijU/htqvxQubvwx4v/tM+
EdVt/iF4kvdZtdStLqLRtSubLX9EtJY7aG4n0S7iMlxciJ4kiV7q6nwF8c63d/G678W694SiPxj+
GGm+C4rbwxaala2XhHUNKtvEGn2dtaQX0Mr6ppK22q293c6jLPZXlzfC9SLSrG2ktlg6i5/ab8Jw
2uq+JYPBnxL1H4XaHqF7p+rfGPTvD+lXPgC2XS57i11nV4Lc+IY/HureF9Gu7S7g1DxdongjUvC8
a2txew6vPpkZva6nxV8a9K0PxI3g7wv4P8c/FXxRa6BZ+KdZ0n4c2fhy5i8O+H9VN8uiX+ta74s8
T+EfDEE/iB9L1L+wtEttbu/EWqw2NxeWmjyWCrdP8dT8CPD+nKilh82eFowwq/s95tiVg61bCcCr
w2hicSocmIxNWXBq/sp062InhKM5VMwwuGw+ZVauLn9DLxQ4rlGo3WwHt5yrv619QovEU6dfij/X
KVGi5c1KjTXEX+381OlGvUio4SvWq4OnTw8eL0n4P+NdQ1/4Ua546vPCEo8E+APH3gPxDY+HJNbS
31Gz8Sw6Np+kzaa2oW4n3rpmk41ZriW1K3czNZI0QVV59vg78aJPh+/wPl8V+BG+GTWR8LHxc1tr
8nxFfwCZgn9iPpLRjw5/bJ0XPh465/aTR/Zsaj/Zpvjx9GeA/HGgfEfwppXjHwzLdSaTqovI1iv7
OfTtS0/UNLv7rSNZ0fVdPulSex1bRdYsL7SdTtJAfIvrOeNHljVJX6+uqfgvwbOliYe14ghUzHD4
jA5zi6Oe42hi87yzHZFw3w7mOWZnXoum6uFx+XcJ5L7apRWHxtDEUcTiMBi8HPHYz2+MfEbiGE6M
vZ5TKGEq0cVl9CpleGq0MtxuFzPOM2weNwVOopKnXwuLz3MfZwqOrhqtGpRpYrD4iOGw/s/HvAfw
0uvBnxD+J/ihLixOheMdP+GunaBp8El099p1v4G8OXmhzpqBmhWIiYzwtaNDcXDPEjtP5UmFaf4K
fD/U/hn4GHhfV7ywv73/AISbxlrhn003DWog8SeKdW161hBuoLaUzQW2oRQ3GYgnnpJ5bPHtdvWq
K+pyjgPhzI8bl2Py3C1aFfKpcbvAx+sVJUaK8QeJMNxXxJFUfgcK2cYSjUwkLcuCw8XhqCjTdjw8
w4ozjM8PjMLjK9OrTx0eGo4l+yiqlT/VPJ6uRZO/aayUqeX1qkcRK98TVarVG5o+AP2Hv+Si/wDB
Rv8A7P8A/En/AKyz+yjR+2R/ycV/wSd/7P8A/iP/AOusv+CllH7D3/JRf+Cjf/Z//iT/ANZZ/ZRo
/bI/5OK/4JO/9n//ABH/APXWX/BSyvsT54+/6KKKACiiigAr4A/4KX/6f+zNoXg0fMfif+1j+wT8
LbmAcm40Lx5+3D+z3oPjNQnJlWDwNc+JryaLa6PBayiZRB5rL9+SSRxKGlkSNS8cYaRlRTJNIsUU
YLEAvLK6RRqDueR1RQWYA/Af7fH+kz/sR6M3MWs/t/8A7PvnK3MTf8Izpvj/AMeW/nL1bZe+ErWW
3x/q72O1mb5I2BAPv+iiigAr8zPjL+1j+z58WdR+LvwE8XfsbfHz9rPwV8OfHE/w3+I1rYfsw6P8
YPg9eeNNO8PaJrup6F5HjG/XSdcuNI03xXYW95LJoz2yzXU8VtNcW7edL+mdfAH7CP8AyMX7e/8A
2f8A/Fn/ANVb8D6APz//AOEB/ZHsv3XhD9hr/gsP8JtPHyx6B8BPil+2/wDs9eFIIR/qrO18I/A7
9rv4feGLTT7bLGy0610iKwsTJKbO2g82Xf2HgLTf2NPh54r0jx9p/wDwS3/bi8YfELw9cC88OfEX
40fA7xp+0H8RfDV6OPt3hvx98d/iv8R/F/h++K5ja90bWrK6aJmiaYxOyH9z6KAPz/8A+G+/+rKv
+CgH/iOP/wCGVH/Dff8A1ZV/wUA/8Rx//DKv0AooA/P/AP4b7/6sq/4KAf8AiOP/AOGVe2fs6ftR
eC/2kx8TbPw74P8Aip8PPE/wf8ZaZ4H+IHgb4w+B7nwJ4w0PWNc8E+GPiFokzabJeajb3Om6v4V8
XaNqNld219KT5ssU8UDovmfSlfAH7K//ACd3/wAFO/8Asv8A+z//AOsUfs70Aff9fOP7VP7QMv7N
Pwnh+Ilj4A1b4oa/rXxO+Cnwg8H+BdH1zRfDNxr/AI3+O/xf8E/BnwdBd+IvEEi6Voek2/iPxzpt
5rGp3EdybXTbe5kitbiUJGfo6vgD/go//wAkY+Cv/Z//APwTS/8AW+v2daAPH/i7L8cf2gdIh8P/
AB6/4I9fCD43aDbpcR2+ifF344fs1fEnSII7vZ9qjh03xn4K1qziS58qL7QiQqs3lp5gbYuPnHR/
2QfAWg6nZazpP/BvT+xla6npUwn0O8PiL9jq4k8NMAR5XhQXXw0mTwpaksztZeHE0uzaV3maAyuz
n97aKAPzt0f43/tq+HdKsND8P/8ABNTTdD0TSrWKx0vR9H/as+CemaVptlbqEgs7DT7Lw/BaWdrC
gCRW9vDHFGoCoigYrS/4aI/bt/6R0/8Am3Xwd/8AlJX6AUUAfn//AMNEft2/9I6f/Nuvg7/8pK4n
4gfttftQfBrw9b+PvjH+wVq3hL4aWfiz4f8AhzxX4n0P9pb4S+MNU8P2nj/x74a+H9pq9r4XtLHT
rnXPsGp+KLG5n0+C/tJZreOYJPGRuH6bV8Af8FQP+TK/iL/2P/7N3/rTnwcoA+/6KKKACvgD/gnf
/wATbwH+0t49++fiD+33+3HMLhuZbqL4V/tE+Nf2drWWR/8AlpHHafBe3tbFwSp0y2sVjPlKlff9
fAH/AATA/e/sZeBtSPzy+Ivif+1H4vubnr/aF74y/ar+Nfiu+1fd/wAtP7ZvNZn1XzgSJvtnmgkO
CQD7/ooooAK/I74j/Hbwv+y5/wAFEf2g/E3i393ofxc/ZC/Ytj0uFZUgSXxR8P8A4uft3WfifUGL
lVkuJ/D/AIl8AWEjDLiDSrVHIVYhX641/G3/AMHQnxF1L4S/F79k/X9H8RDwnceMPhv8R9Ivb83C
2n9rw+EPE/h+9srTzGZRN/ZD+Mb2bYCTD/bG4gecMgH9Ev8AwSt4/wCCdv7Icb83Nv8ABrw9aakx
5aTWLOS7tdalkk/5eJpdWhvZZ7ss5vJne6Mkhm8xvv8Ar4A/4JdfuP2GvgzozfLL4Q1L4wfD66i6
m1vfhx8cviX4DvrEsfmkawvPDk9k0smJZWtzLMBK7ivv+gAr4A/aY/5PU/4Jr/8AY/8A7Tv/AKzH
42r7/r8+v2y4fE3g/wCMf7GX7Q1v8P8A4gePfhv8B/H/AMYLz4tn4XeFr74g+NPCXhv4h/BHxZ4H
0nxba/Dfw59r8feN9J07xFf6fb63pnw58O+MPGFraXi6la+GL7T7XUbiyAP0ForwT4NftT/s3/tC
xTN8E/jh8MfiVe2Uk1vq/h/wx4v0a88X+G7+1UNfaR4u8FNdReLfB+vabuC6roHijRdI1rS5Mxaj
YW0oKD1Pxh438F/DzQrrxT4/8X+F/A3hmxx9t8ReMNf0nwzoVnlJJB9q1fWruy0+3zHFK4864T5I
5G+6jEAHUUV8BP8AtyR/GJ20X9hf4a3n7V13KzQt8ZxrU3w7/Y+8PFiVS/vf2ibzQtfg+J9uRiRN
O/Zr8IfHHUUZ7Ua+PC+nX8Gsq3/hmr9sT4i/8TH4x/t++OPh7LP+8fwL+x18HPgt8L/Bdmo+a2s7
nxR8f/Bv7T3xW1u4sm2Ndazo/jHwFa65cwrK/hfSdKuLnw+4B9/18Aftw/8AJRf+Ccn/AGf/AOG/
/WWf2rqP+GJvinov+leA/wDgov8Aty+GdRj/AHsaeI9S/Zm+LGhXd03zXH9raT8Uf2avFF69jeuE
M9loGt+G3skQxeHrrQklm8zyHx38H/2/PE/xh/Y50b4lN8AvjX8MPg/+07afGXxH8dvh/Fr/AMD/
ABvonh7RvgZ8c/AkGk+LvgR4m1v4l6J4ivtQ1j4haFbnxl8P/ivZLd3wuJ2+EfhjRme508A/V2ii
igD4A/4Jmf8AJrmsf9nf/wDBRz/14l+1NX3/AF+TfwL+Ll3+wX4S8XfB39qP4YfFHwl4QHx+/ao+
KXhL9o/wJ4K8Q/GP4B674Q+Pn7Tfxd+PPh2Lxfrnw10vX/GnwU13wvo3xK07w74wm+M3gXwT8Pxr
9oyeD/iH4wtrgSwfSmlf8FH/APgnrrljDqWl/t1fse3dnMZUEi/tKfBuOSKe3le3urS7tpvGUdzZ
X9lcxS2moafeQwX2n3kM9ne28F1BLEgB9oUV8EXf/BSn9lLXLu50H4A+LtY/bJ8bw3E1hF4M/Y50
KX4/iPVYJGt5NN8T/EvwrcD4F/CvZeI+nz6x8Zviv8OfDVlqSnTtQ1u0vf3FV/8AhXX7bn7Qn/Ex
+J3xdj/Yr8AXP/Hn8JP2cD4L+JPxwvbB/m/4uR+0P8TPBHiLwR4cvNQgMcGo+Efgt8Kkv/Cd0t8P
D/7Qni4T6dq+nAH3/RXwB/w7Q/Zkvf8ASfFGs/tU+Otbl+a98SeMf26/219U1i+kPUkQfH2y0rTL
VTkwaRoOl6RodkXk+w6ZaiSQMf8ADDvif4d/6d+zD+2B+1D8Hru1+ex8HfFT4i63+2J8Hr4r86aV
4g8NftNap46+Kln4ZEwjdNK+FPxw+Euo6fbRR6ToOu6Lou7TmAD/AIJ8f8i7+1j/ANn/AP7YX/q0
ryvv+vjj9iX4I/F74G/Dr4k6b8ctZ+G+ufEX4j/tEfG/40ape/CiPxPb+C1tPid4yudf02GwsfF8
X9uaVcLaPHJfaPcahr8ekXMr6dB4m8RRWy6vd/Y9ABX5/j/lKc2f+kf67ccYx+0W+/d13bsptxt2
bXzv3jy/0Ar4A8Qf8S7/AIKm/CP7R8v/AAmH7AH7RX9kZ483/hW/7RX7Lv8Awke3P3/s/wDwtXwt
u2/6r7Unmf66OgD7/ooooAK/P7/gq8HP/BMf/goAEYI5/Y+/aFCOyl1Vz8L/ABKFZkDIXCnBKh1L
AY3LnI/QGvgD/gqf++/4J7/tUaQnN34s+Gz+AtKTqZdd+IWvaL4H8PwBRy7T634gsIVjX55GkEaf
Oy0AH/CmP+Cjn/R9/wAAP/EDdU/+i+rB0HWf+CtHgcax4a1f4U/sBftHWthr2pN4a+Ll3+078ff2
T9d8SeGLl47nS4vE3wQ0n9i39rDRPC2vaUZbjS7mfRfjb4l0/V7W1s9SFvpd1cXVmn6O0UAfAH/C
xv8Agqb/ANGb/sAf+LLP2iv/AKU7R/wsb/gqb/0Zv+wB/wCLLP2iv/pTtff9FAH8vn/Bcn9o3/gs
Z8K/2ENS8XfCv4L/AAa+CPxHg+NPwSsPBfjD9kT9sX45/tC/G2+1/UvG1pa2fhLRPg3r3/BPj4La
N490jxSXbS/EOhal4xuLO60uWdZ/DXiJN2nSH/BPf4v/APBWP4wfGz/gnfrP/BVT9n/4afBjxtBB
+0+PAGt+H9Yj0f4neP8ATZvgvpx1HVfip8HNJTWvDXw41dAljKgsvE2hX93dXN7Z3nwt8Hx2EE+p
f1B1+f8A+0R/yfb/AME6f+7uv/VO6JQB9gfFn/klfxL/AOyf+Mv/AFHNSrwD/gnt/wAmC/sPf9mg
fs0/+qY8FV7/APFn/klfxL/7J/4y/wDUc1KvAP8Agnt/yYL+w9/2aB+zT/6pjwVQB9f0UUUAYviP
V5dA0DWdag0nVNfuNL028vrbQ9Ft/tWr6zc28DyW2l6dCzJGby/nEdrA9xLDaQvKJry4t7WOaeP4
7+Efw0+JHwg+Jp8da1oNjrg/aJee8+Ldt4asdNMfwi8dw3viDxDoEek3lpDb3mseArux1m58OeIr
u4W6n/4TW0XxvJcqni7WI7b6j8e/EPQvhva6HqnieHUoNC1jxJpXhm78Q29vBLo3he61yVrPSNR8
VXMl1DLpWhXurvZaIdXW3urWy1LVNPOpNZWMk19Byd58dvBVrf6/Zxw65qFr4b+IngL4U6hrmn2N
rPocnjzx9relaBb6FY3z38LXs3hi91zSB4xkhhMOivemwR7zWLLUtMsgD5J0f9m7UbD9mH4OWq6f
8VP+FkaNe/s53+seE7v4tfFS90PTp9D+J/w71TxRHceAL3xzceA7ey0PSLPVL+TTV0BdO0hbEz2V
rbT2Vu0X1h4o8Pa1e/H/AOD3ia1064m0HQfhz8b9M1jVEVfsun6h4h1f4NS6LaTuWBE+pR6Hq8ls
iqxdNPumOFjJrrfEHxE03QfFEPgyPR9f13xNd+A/FfxB07StFg0xpNS0vwhqnhjR7/TbS41XVtKt
F1q8vvFmlR6Zb3dxa2Uyi6a51C08qMS+W+H/ANpG21+48XRn4P8Axh0ez8A3Wsaf4z1bWLL4dx6d
4e1HRPCdn40uLC7/ALP+JGo31xcT6JqekvaNp1le28lzqlpBJPDtu3tgD558W/C34tab4/8Aib43
8BaBf2uuePvi74r+Gd1qkIhhktvhf8U/g38GtItvidDcrvmmtfhr8QfBMGoIkP8ApKQjxLbwoHnl
WTYfwFr/AMN7DwO+jfD3xRfeHvAv7XPiDxRaaF4X0oanqUHw7Hwh8d+ENE1SwsBcQmXTUu9S0mwR
jKjKJVJUAGvcIv2pvhjN+zwv7TEcXiY/D97P7SNPOkW6eLxcjxKfCTaS+ivqKwR6qmuA20lvJqKx
RorXElwsKs49Z0Lx/ofiLxX4g8HWEeoLq3hvwz4J8Wag9xbxR2baZ4+l8URaGltMlxJJJdxt4R1Q
38TwRRwK9mYprgyyCEAt+DfFf/CY6VLqv/CN+LPC3lXs1l/ZvjLR/wCw9Vk8qG3m+1xWf2m632Uv
2jyoZ/MG+aC4TYPLy3lXwz8M6/pPxs/aV8QalpV3Z6L4s174X3PhvUZkC22sQaP8MtH0nU5bNgxL
pZalBNZzkqu2eNlGQM16l458a6P8PvD/APwkuupeyaf/AG94R8O7dPhiuLn7f418W6H4L0hvLmnt
k+zR6vr9i97J5u+GyW4miinljSCToRqemm7jsBqFib6ZLiSGyF3AbuVLRxFdPHbeZ5zpbSkR3DKh
ELkJIVYgUAfC+h3PxI8D/Ae3/ZpT4N+NPEPj/TvAWr/DLSPEVnZaWnwk1mxW0uPD2l+M7/xpPq3k
6TpNxpFza63qug6jZw+K1uE1HSLDRdQljt7q51PBug+I/wBmLxf4lS48D/EH4oeEvGPgv4N6Xp/i
nwDoln4g1W18SfDbwVafDi/0vxDoX9qW+qWUOq2elaV4gstcEc+jQtf6pbalf2Rs1km+rfEPj/w5
4a1nwroF9ctPqvi7xPb+FLCzsWtbiey1C78PeJPE1tcatA1zFcWWnz6d4W1RIrkRTNJdeRGkTRvL
LD06appkkl/FHqNjJLpW3+1I0u7dpNN3RGdft6LIWs90AMy/aBHmIGQZQE0Acx8PdT8Z614T0/Vv
H/h208I+JtQudZuZ/DNpew6kdE0qTW9RPhqw1DULW6vLK71yLw2NJPiGbTriTTTrjagumsbFYCe1
qFbm3aRIVnhaWSE3McSyoZJLcMimdEDFmhDSRqZVBQM6DdlgDNQAUUUUAfAH7D3/ACUX/go3/wBn
/wDiT/1ln9lGvP8A/go1qXxT0j4n/wDBLrUPgp4N+H/xA+Jtv+3/AOM/+EZ8I/FL4l+I/g/4E1fz
f+CZX/BRyDWf7d+IvhP4T/HHxB4d+weH5dV1PTP7P+Fvij+19YstP0K6/sSy1O58RaR6B+w9/wAl
F/4KN/8AZ/8A4k/9ZZ/ZRo/bI/5OK/4JO/8AZ/8A8R//AF1l/wAFLKAD/hY3/BU3/ozf9gD/AMWW
ftFf/SnaP+Fjf8FTf+jN/wBgD/xZZ+0V/wDSna+/6KAPgD/hY3/BU3/ozf8AYA/8WWftFf8A0p2s
HQPh/wD8FT/GUeq+JPG/7Rv7InwB1HU9e1eTSvhJ8OfgL8QP2mfD3g/wzFdNB4es5vjf40+I/wCz
PrvjvXLvTootR16/f4JeBbG11S7udP0zTprC0gvLj9HaKAP54/8Agrl+y3/wU6+KH/BOX9qXwB4W
/aQ8CfHvxJ4o8G6Bp2h/CP4T/saaz4J+IfjTVP8AhP8AwjcWVn4Y8Xw/tM+Lz4ZvLCeBNZn1yTw9
qFvpthpt3dXZs7WKa/tfhT9gX9mD/gsn+zd4d/4J9Wf/AAVB/ac8M/EvwM37bPw8tfAXwO14j4s/
Gv4a6hcfAT9oaz0eXxt+0PbanFba3a6ffvb2a+CpJfi5bW1xPoms6N8QvDMPh260PUf7B6+AP2/v
9Ctf2NfEbfJB4b/b/wD2YvtFweRb/wDCbax4g+FVplD8j/bNR+IFlpq7/wDVvfLPHmeKIEA+/wCi
iigAr4A/YR/5GL9vf/s//wCLP/qrfgfX3/X5P/C745+AP2Lvil+1l4Z/auutT+Avhz4v/tVeK/jH
8LvjT8QNLn0/9nrxZ4O8Y+APhdoNjDefHO0N98N/h54rtNf8Naro0/gv4ta/4A8U6ncxQ3fhfSvE
OkXEWpMAfrBRXPeF/F3hTxxo1r4j8FeJ/D3i/wAPXwJste8L61pviDRrwAKxNrqmk3N3Y3ACujEx
TuAGU9GGfG/jN+1l+zV+z3Jb2Xxk+Nvw78DeINRkit9D8EX/AIis774k+K76eE3NvpXgn4Y6M2pf
ELxxrVxarJd22ieEPDOtatcWkU11DZPbwSyIAfQtFfAH/C0f20f2hvm+BHwz8P8A7KfwxuOLb4v/
ALWPhLWvE/xe8S2UnAv/AAR+yl4Y8WeDNQ8GWdzblnsNZ+PnxL8F+NNF1FI01/8AZ91Cx3Cc/wCG
KPixrv8ApXxB/wCCjH7b/ibUJPnkt/Ct5+zP8IPDtnKnzW8ekaZ8L/2bvDmtJZ2kxkmSLxD4n8TX
d6ZWtta1DVrCGzs7UA+/6+AP2V/+Tu/+Cnf/AGX/APZ//wDWKP2d6P8AhmX9r74e/wDEx+Dn/BQT
4heN7mH95/whX7YXwb+CXxd8B3oHzTWtvrXwI8H/ALLXxa0W6v8ABji1e/8AiH4w07Q5pFvIfCOq
2lv/AGJcu/Yv+Hf7RXh34m/tn/E39o34e+Bfhzr/AMavjL8Nte8M6Z8OviPL8TfCus6D4E/Zx+EP
wtvPE2k61qHhXwR4gsLHWPEHg7V5bbRfE/hTRtb01UaCVNQtFs9Z1MA+/a+AP+Cj/wDyRj4K/wDZ
/wD/AME0v/W+v2da+/6+O/25vhX8SPi18EdC0/4T6HpXirxv8Pf2hf2VPj1Y+EdW8QQeFV8Y6Z+z
v+0p8LPjd4j8I6V4gvbS70vS/EviXw74D1XRvC0+uGx8Pt4ivNMh17WdD0iS81iyAPsSivge1/4K
VfsqaDc2+iftAeK9b/Y18ZyTw2M/hH9sbQJfgHD/AGnNItvHp/h34n+J7l/gR8TBJesNNttX+EPx
Y+IPhzUNTxp+ma1e3bLE3U6r/wAFHv8AgnrolhPqeqft1/seWdlbeUJJpP2lvg0xaW4mjtrW2gij
8ZvPdXl7dzQWdjZW0c13fXs8FnaQzXM8UTgH2fRXwB/w2j4s+NH/ABKP2KPgR40+MhufkPxz+L2k
+Mf2eP2XNEhfgarYeN/Gvg9/iJ8a4yhefR1+APwy+IHgzWLy0n0TxD8Tvh/JKuqQn/DF/wAS/ib/
AKf+1F+2X+0N8QJrr57r4efs8+J9V/Yy+DeltJ801p4e/wCFH61ZftHXVjIT5MkXj79pjx2JLeKJ
IktPNvhdgH3/AF8Af8FQP+TK/iL/ANj/APs3f+tOfByj/h2Z+y1bfv8AQ7v9qHwpq0Xz2HiDwp+3
d+3Foeu6ZcLylxZ31r+0OA65+W50++ivNI1S1abTdZ07UdLuruxn8Y+P37EH7XHif4az/CP4bftf
y/Ff4Y+I/G3wl1DxF4S/a28L6Hq3jXwp4b8DfFrwR8QdRuPhx8c/hB4X8H+INRv7ax8K3MVrofxl
8EfFTUvFF3dw2Nx8TPBtrGNRiAP1mooooAK/P/8A4Jb/APJiXwK9dvxLDHsXHxg+IAdgP4VZslVJ
YopCl3ILn9AK+AP+CYn7j9kDQdIfi78J/HX9szwFqqd4td+Hv7Z3x/8AA3iCBl6o0Gt+H9QhaNvn
iaMxv86tQB9/0UUUAFfwx/8AB5B/yNX/AAT8/wCxf/aY/wDTj8Cq/ucr+RP/AIOOvhJ4r+O3x3/Z
18L+B7V73U/APwk8Q69r0ccEtwYLDx74xuNP0J2SEFoxPcfD/X1Vn4kMDBOY3oA/e3/gnZ/xKPhz
+0V8PX+S4+HH7e/7dlpLbdrK0+KX7TXxD/aK0G2jH/LO3Xwx8adDls4R+7trKW3t7dY7aKGJPv8A
r4A/Zl/4pL9sz/gpD8N3/df8JN8QP2bv2otPtG+UxaR8Wf2dfC3wCkurWPgJp+oeK/2QvF1wSibJ
tc/t+4aR7iW4WP7/AKACiivza/be8MyfE74/fsG/BTV/HPxm8IfDz4kfEf453Hjqw+Cfx6+Nn7Ov
iHxOvgr9n7xn4k8M2OqePvgB8QPhp4/l0fTtdig1VtDTxPHo1/eW1rLqVheG1t/KAPqL4y/sk/sp
/tFywz/tB/syfs9/Hae2jhht5vjL8GPhx8T5YIrZi9vFDJ428N648UcDszwojKsTMWQKSTXlfg//
AIJsf8E8/AGu2vivwf8AsN/slaH4usciy8ZW/wCz38KpvGVpGHjeOC28XXfha48Rw2tuYohaWkep
rbWccMMVrFDFFGi8v/w7T/Z1/wCijft//wDi2L/gqb/9GRR/w7T/AGdf+ijft/8A/i2L/gqb/wDR
kUAffqIkaLHGqoiKqIiKFREUBVVVUAKqgAKoAAAAAwKdXwB/w7T/AGdf+ijft/8A/i2L/gqb/wDR
kUf8O0/2df8Aoo37f/8A4ti/4Km//RkUAff9FfAH/DtP9nX/AKKN+3//AOLYv+Cpv/0ZFfP3xa/Z
t8I/stfGv9hDxX8IPil+2DHfeO/2wbH4YeM9I+J/7fP7cnx+8D+J/Aut/s5ftHeIr/Qtb+G/x8/a
I+Jnw91BTrvhTw7q9lqFx4YfVtK1HSLS70q/spldnAP2AooooAK5DVfh94C16+m1TXPBHhDWdTuB
ELjUdV8NaNqN9OIYkghE13eWU1xKIoY44Yg8jCOJEjTCKoH48fsUfsF/sa/Hv4PeN/ix8af2b/hV
8UPiX4p/a9/4KCp4j8ceNfDNtr3iXWU8P/t6/tJ+F9Cj1DVb5pbm4j0jw5oukaHp0buUtNL02yso
FSC3jRfrf/h1X/wTj/6Mw+AH/hBaX/8AE0Afe9paWlha21hYW1vZWNlbw2lnZ2kMdta2lpbRrDb2
1tbwqkMFvBCiRQwxIkcUaKiKqqALFfAH/Dqv/gnH/wBGYfAD/wAILS//AImj/h1X/wAE4/8AozD4
Af8AhBaX/wDE0Aff9FfAH/Dqv/gnH/0Zh8AP/CC0v/4mj/h1X/wTj/6Mw+AH/hBaX/8AE0Aff9Ff
nB/wTK8K+HvAPws/aE+Hvg3SbXw74I8Bftv/ALWvhTwV4X00PFo3hbwzpvxT1FtP0HQ7NnePTtJs
mnma2sbYJbwtNKyRqZGJ/R+gAr4A+Pv/ABT/AO33/wAE9vGDfuk8S+F/2y/gGtw3CTT+OPAXwx+O
aaWjDk3FzB+zBc6lHGfka30W7kb54o6+/wCvgD9v3/inLX9jf4w/6tfgx+3v+zhdzXY4NjaftBXH
ir9iq+uTIcJBbmw/aiube/mkZI49NuLwuwXNAH3/AEUUUAFfAH/BSP8A4mnwK+GPgKP57j4n/tq/
sB+DGtxy93oVt+2d8EPGvj62jT+Jm+Gvg/xm5YhkgSN7qWOaGCSGT7/r4A/ax/4qv9qP/gm18MY/
3iWv7QXxc/aB8Q2n3xdeFPgz+y78YvBto8sa5ZIdO+LHxy+EmrLdMohivbCxt3dZby3SQA+/6KKK
ACiiigAr8/8A9oj/AJPt/wCCdP8A3d1/6p3RK/QCvz//AGiP+T7f+CdP/d3X/qndEoA+wPiz/wAk
r+Jf/ZP/ABl/6jmpV4B/wT2/5MF/Ye/7NA/Zp/8AVMeCq9/+LP8AySv4l/8AZP8Axl/6jmpV4B/w
T2/5MF/Ye/7NA/Zp/wDVMeCqAPr+ivlLS/2tvC1/4W0j4g3nw1+LmhfDLV7iyjX4kato/g1/C+nW
d/qi6Nb6xq0Wj+OtX8SWOjrqDpDdXz+H2Wwjf7TfJb2ySzR/UL6jp8d9Dpcl9ZpqVxBLdW+nPdQL
fT2sDKk1zDaM4uJYIXdElmSNo42ZVdgWAIB478ebLxT4o8GP8NPCegpqN18UTd+Ddb8QajZW194e
8DeEdRspo/FHirVbW8DWup39rpTzWvhbQZI5E1fxLdact6i6PbarPD8zz/CPxxpfwss/2drnw94h
1Tw/8P8A42/BDV/Cfjrw9dy+Hr/xV8LLj4xaF4n1fVr7WvCd5oup6R8QvBcNvrS+NdX046NqepGG
y8cWMhudZu3tfvqPUdPlvrjTIr6zk1K0hhuLrT47qB762t7gsLee4tFczwwzlHEMskapKUYIzbTj
mfFfjzw54Q8JeOfGV9eC/wBM+Hega94h8TWujSWt/qdpa+HdHudcv7MWn2mFU1J7C2dra0u5rXzH
eLfJFG/mAA8R0L4QjwX+0V4X8TaAnjzUfDT/AAV+JWhaprHi/wCI3xB+IkFlrl745+EmoaRptrce
P/FXia40iXULDS9ZuvJ0w2cN+mnSPciZ7OHy10fwf4mt9E/a8tptGvI5/G/jvxVqXhKMohbXrC++
BPwz8PWlzp5DkSRz63pWo6YpYoRd2c8TBShr6Rs9Rs76zhvoZkEE0VvLl3jVojcxQzRRTgOwimKT
xZjLZzImMhlJcmo6fJfTaXHfWb6lbwRXVxpyXUDX0FrOzJDczWiubiKCZ0dIpnjWORlZUYlSAAfl
XYfAf4qW/wANdR+FL+Cb9fBX/CiD8XrKBRvc/G2/+AX/AAqi5+FcthNPzqA8ZDUfimzRCS1t/Ec9
jKrxzuoi+o7PVPEHwy+M3jfXdS+HHxG8SaR4p+E3wO0XTdR8F+HE8QW0eq+DLz4qnX7G9kS/txbX
FsviXSmRSHEqTM6naoLfWlxe2do0KXV3a2z3DpFbpcXEULTySTQ20ccKyOpld7i5t4ERAzNNcQxK
C8satj614o0bQ9O8R6hc3cVw3hbRrvXdY06xmtp9Ut7C0sp7/cbJp43je5gtpfsn2hoIp2AAlC5c
AHlfx50bWvGfwrtLLw/o+oXmpXXj74Ga2NLMKxahb6fo/wAZvh54i1mW7heTbAdI0bT7++1ANIRb
xWdwSzbOfmvRfgRd21v4n8Vv8N4IfH037cEXj2x8SNpdkvidvh8/xf0p59XtdXP/ABMV8Ov4OvNc
kls4rhbV9NvdUke0Ju7ppftnw1468OeJ/DPgnxVa30en2PxB0XRtc8M2msTWlhqd7BrukQa3Z2a2
huZBNqMdhcLJc2lnLdGIpKVeSNPMJpPjzwvrfiXxn4T07URNrXw/OiJ4rheKWCHTJdf0v+2tOiNx
OscVwTpTQXk8tu0tvbrcRQyTC5S4hgAPg3wt8MPEWn+I/hNpV/8ACnVE+LPhP49/FTxf43+NH/CO
aRJpWp+GPFOm/GGbQPEDeOFlN34ht9Yi8QeDbRfD06yXugvpEOlazpukJp+gxX/OfAv4UeMfB+vf
DqbxP4R8ave/D7wT47j+KscHwx8KaPY+K7i98N3mn6p4fufGNnf3Oo/HD/hNvE00fivSstftc31h
Z6n4gl0jVJ5dNk/TNdZ0h9MGtpqumvoxg+1DV1vrVtMNsDg3AvxKbUwZBHmiXy8/xVh+EfGuj+NU
8RSaMt2I/DXinV/CN9JdRwIk+paMLZrm4sWgublZ9PlW7ia2ncwySjcWgjAXcAfLX7LHw58b/DfW
fEtt8QfDF2t74j0DR9W8Ca42sXXiSD4dfDi1uJodH/Zzn1O8cta3Pw0kuxeQXdir2Hi0aze3SXV0
/h7Mf2nXk3w4+MXh74oaZoeueH9I8S2eg+IPC1v4p0/W9astOstO8m513UNAi0eeSDVryWPXTc6d
JdG0WGS2NjPaut61xI9tHr+Lfid4W8H2fhm+vZ5tTtfFXj7w38N9Om0I2eopD4j8T6n/AGRYrfP9
shSC0tr35NReNprm1AOLSVwUAB6FRWdc6vpNlC9zeapp1pbx3aWD3Fze20EKX0siRRWTyyypGt3J
K6RJblhM8joioWYA6NAHwB+w9/yUX/go3/2f/wCJP/WWf2UaP2yP+Tiv+CTv/Z//AMR//XWX/BSy
j9h7/kov/BRv/s//AMSf+ss/so0ftkf8nFf8Enf+z/8A4j/+usv+CllAH3/RRRQAUUUUAFfAH/BT
j/Qf2R9V8Y/cT4TfHz9jP443dyOHstI+Bv7ZPwE+LXiG6V+qxp4c8Hasl2v+rnsZLq1uFktp5on+
/wCvmD9tz4XXfxv/AGNP2sfg5psVxNqvxS/Zu+N3gHRRZhvt0eueK/ht4l0XRLnTmRXkj1K01a8s
7rTpolM0F9DbzQjzUSgD6forx/8AZ6+KNp8cfgF8DvjVp8tvPYfF/wCD/wANPijZT2hU2k1p8QPB
ei+LLaW1Ks6m3kh1ZHhKu6mMrhmGCfYKACop4ILqCa2uYYri2uIpILi3njSaCeCZDHLDNFIGjlil
jZkkjdWR0YqwKkipa/Hv4L/s0+D/ANqT4oftr+Nfi/8AFP8AbFm1bwl+2L46+GnhbTPhr+39+3T8
BvBHhvwP4Y+GfwiutF0HQvht8B/2i/hr8O9Jht7zWdVvbm7sPC0Go6pfX91e6reXt1K01AH1N4o/
4Jnf8E6vGms3XiTxP+wl+yHqviW/IGpeJZP2dfhNb+I9WgJZpbDWNfs/Clvq+r6VdFj9u0jUry60
u/GBe2k4VQPZfgz+yt+zB+zlHcw/s9fs4fAX4ERXkcsN3F8Gfg/8PfhfHdRTzC4miuU8EeHdDWeO
a4VZ5UlDLJMBK4LgNXzz/wAO0/2df+ijft//APi2L/gqb/8ARkUf8O0/2df+ijft/wD/AIti/wCC
pv8A9GRQB9/0V8Af8O0/2df+ijft/wD/AIti/wCCpv8A9GRR/wAO0/2df+ijft//APi2L/gqb/8A
RkUAff8ARXwB/wAO0/2df+ijft//APi2L/gqb/8ARkVzv7C/h6b4cfGf9vz4L6Z44+MXjD4f/C34
8/CW1+H9p8avjp8Z/wBofxN4XsPGH7KPwM8beIdK0/4hfHvx78SfiG2i3vivXNY1yHRbnxTcaTpt
7qd6dLs7KO4ljYA/SGiivzo/4Kh6Bo/i/wDZv8AeCfE1hDrPhLx1+2v/AME8vBPjHw/eGRtM8S+E
PFX7c37P+ieJfDWs26Oi32i69o95d6ZqunzFra+sbma2uI3ikZSAfohdWttfW1xZXtvBd2d3BNa3
dpdQx3FtdW1xG0U9vcQSq8U8E8TvFNDKjRyRsyOrKxB5bSvh54A0O/g1XRPA3g/R9TtfN+zajpXh
nRdPv7bz4ZLabyLy0sobiHzreaWCXy5F8yGWSJ8o7KfjD/h1X/wTj/6Mw+AH/hBaX/8AE0f8Oq/+
Ccf/AEZh8AP/AAgtL/8AiaAPv+ivgD/h1X/wTj/6Mw+AH/hBaX/8TR/w6r/4Jx/9GYfAD/wgtL/+
JoA+/wCivgD/AIdV/wDBOP8A6Mw+AH/hBaX/APE18hft1/sB/sX/AAM/Zu134s/Bz9mr4UfDP4me
Cfib+zlqfhHx34L8M2+geKPDmoTftIfCbTprzR9XsGhvLG4ksb27tHlgkRmt7maIkpIwIB+3lFFF
ABXwB/wT9/4k+k/tffDw/u5Ph1+3/wDtX+ZaNxLaf8Ln8aWn7UcPmqPlX+0bb49Qa1Bt/wBZaapb
zP8AvJHr7/r4A/Z9/wCKQ/bw/wCChfw+b9yPHln+yV+1XBF9xLuT4gfCjX/2Yb69jDYM1xEn7Gmm
Wd7JGGWGCPSkkZTJGCAff9FFFABX5gw/DPwn8dv+CjH7WUfjCyfU/D3w0/ZZ/Yc8GaWsTRD7J4y1
H4gftveOfF0bvLDOm+Xwt4s+GU3kKkckaMk0kkqXUKQ/p9XwB+xT/wAVP8Vv+Ch/xaP7228cftq3
/grw5c/eEfhr9nz9n34CfAfU9MimGUlhtPi14E+LN8wRm+z32q31nLsuLaaNAA8bf8W7/wCClnwK
8Tr+40j9pb9lb4w/BnX7j7ovPHn7Pfjvwb8X/g3pYxgSMfBHxP8A2otTG8s8K6e3kIEnu3X7/r4A
/wCCi/8AxRnwk+Gn7TNv+5vP2Ov2hPhT+0Fqd+PlOm/Co32o/B79pLUZJOi2+mfsx/Fv4yas6Sg2
7zadbGZrfYl5bff9ABXwB+0x/wAnqf8ABNf/ALH/APad/wDWY/G1ff8AXwB+0x/yep/wTX/7H/8A
ad/9Zj8bUAff9FFFABRWVrmu6J4Y0bVPEfiXWdK8PeHtDsLrVda13XNQtNJ0bR9MsYXuL3UtU1S/
mt7HT7Czt43nury7nht7eFHllkRFLD4WP/BR74H+KiV/Z68D/tC/tdQEn7P4m/Zq+CXi3xb8JNTX
PDeH/wBozxfH4D/Zq8UnaGklh8MfGHWLi1i+zyXkNumoaY16Aff1fAH7cP8AyUX/AIJyf9n/APhv
/wBZZ/auo/4b01HSf9M8efsM/t/+AfDyf8fXiL/hRnhb4u/Zf+5N/Zt+KPxt+J9//wBwjwJqOOhw
eK8I+OX7TvwB/aP8dfsAT/BX4p+F/HN94U/4KD+E7Lxp4WtZ7nSPH/gHUbv9lX9q+a10r4i/DjxF
baR4++HusXEIMsWkeNfDeham8QMi2hTmgD9dqKKKAPgD/gmZ/wAmuax/2d//AMFHP/XiX7U1ff8A
XwB/wTM/5Nc1j/s7/wD4KOf+vEv2pq+/6ACiivkD4n/tvfBP4feMtU+FXheLx9+0B8bNG8lNY+C/
7OHgjVfi3418MXF1GJbGD4latpBtvhx8EV1KIiTS7/46+PPhnpOpqV+w6jOzoGAPr+ivz/8A+Glv
219S/wBM0T/gmz440rTJvmtrH4jftQ/s1eH/ABhAh6JrGk/D/wAWfFrwnaXAGN0ekePtftw24LdM
ArMv/Dcnif4f/vP2nf2OP2n/AIAaDDxefE7RtC8GftK/CO1C/wCuvdQ1b9mfxf8AE/4n+EfD9llZ
dU8W/E74QfD7wpo9iz6nqus2emWep3dgAH/BPj/kXf2sf+z/AP8AbC/9WleV9/1+bX/BMbxp4P8A
iN8Mv2kPHnw/8VeHfHHgjxb+3T+1tr3hbxf4S1nTvEXhnxHomo/E26uLDV9D1zSbi70zVdNvIHWW
2vbG5nt5o2DRyMOa/SWgAr5B/b/+HGvfFf8AYp/af8F+D1B8fTfBrxp4k+GEpRpRZ/FvwHpcvjz4
S6l5aMkrHS/iT4a8LaiBBJDc5tR9muLefy54/r6igDz74S/EfQfjH8Kvhn8XfCzF/DHxU+H3gz4j
+HHLrKX0Hxx4c03xPpDGVFVZC2n6pbkuqqrk7goBAr0GvgD/AIJzf8UZ8HviN+zPcfur39jf9oL4
sfs7afZH5f7O+FkOoWHxd/Zr09Yzyq6f+y38Wvgnp8ki4gnu7S6mto4IHS1g+/6ACvgDQ/8Ai4f/
AAU68e6qf32mfst/sZeCfBOl3B+eKLxj+158XPEHjL4g6VCDnyb7S/CP7KXwV1S/fCCWy8X6SkUk
xjuUt/v+vgD/AIJ8f8Vx4P8Aj7+05P8AvJv2sP2n/iv8SfD9yfmW4+E3w2l0j9mj4E39g/3Y9H8W
fB74GeDviTZ20OIVvPHmp3jq1/f380wB9/0UUUAFFFFABX5//tEf8n2/8E6f+7uv/VO6JX6AV+f/
AO0R/wAn2/8ABOn/ALu6/wDVO6JQB9gfFn/klfxL/wCyf+Mv/Uc1KvAP+Ce3/Jgv7D3/AGaB+zT/
AOqY8FV7/wDFn/klfxL/AOyf+Mv/AFHNSrwD/gnt/wAmC/sPf9mgfs0/+qY8FUAfOPg39mnxp4U+
Bfwl8S30fxY8Zan4U1XSda+In7OPiLxzrt14P8R+H4PEdxc3mnaN4K/tjTNEOt+HXGn+MNB0HVbi
88Na3c6ZNo2qaReNqVpJZaOrfBz4k6h8VvFjapaeKJtb8TfH/wAO+P8Awr4x0f4beEbyOy8Cabq3
hvUdG1Kf4uazPDrHhSHwT4Z0yfwpqXga4htdX1mG0vdH0PStWsPE11qD/p5RQB+Z3/CqfiNY/Evx
bb/Dzwtq+l6pruv/AB9uk8R+MvBejWN18Prnxzofj2XQ/iD4O+PPhe60q+8V2PiTxPe+G2s/A3iT
SPGfiTw5pepxWeo3Ohv4QstRGbqvws1/W/BU+nfDj4La98Nb3w3+yT8cPhp8Q7G68N6Ros/jXxr4
m8IeH9O8IeDtNv7Kd2+IV1F4i0vXNej8X2LahoytdEJrZ1DxLf2dfqHRQB8Q6l8JfHJ+LmjeG7LR
Lg/B/wCIWq/Dj4wfEnUBdWAstK8bfB7SItOm8OSWJImkfxzrWifBPUQsKzwXtl4M8dfbC4vAR4/8
Ofg58TtL+JXhGLxDZeJY/F+ifHHxz478S+MNN+HXhDTtIu/DGra54t1FNVm+MSXA1jxRpfjPw5qe
meGpvBKR/wBt6UtzFp+o6LpOmeGNPuR+kuq6yul3WgWp07U79tf1ltGSXT4beWDS2XR9X1ltR1Z5
7q2aDTBHo72XnWyXdwdQvdPhFqYppZ4Llvqem3c8lra6hY3NzDBb3Utvb3cE08VreKXtLmSGORpE
gulVmt5mURzqpaJmAJoA+efG3wq0zxr+0l8LfF/ibwVp3ifw74N+E/xPj07VNa0201TTdB8a6j40
+ElzossEN4s0VvrUml6brs+mXfkedAlpeSWs0UqMa+KPAXwQ+JWnpoOlar4e8X/8Jz4Y8NfGJfG2
t2/w88J6Bpuvah4j8GeLtGmkvPijFeyat8VLb4heKdU0rX7LSlF5qFteQWGteIIfD97oVtbyfp6P
HHhpvHT/AA3W/LeLovCkfjSbTRBMFh8PT6tLolrdvdMi27SXOoW13FHbRSSXCJaSzXEcMUls1xvW
uq6XfQSXVlqVhd2sVzJZS3NreW9xBHeRTC3ltJJopHjS5juCIJIGYSpMREyBztoA/JDxz8Kvijqn
w5vPCknwi1JfEsf7NHwn8JeFb3S/AGkeLvEPiDVfD/w8l/tPT77x54q1q70L4VDwV4wublBoGj6L
o/ivWbiE6z4b1XUNavrN9K9I+LPwZ8b6l44/aGm8K/Dy6gj8c+Mf2fvH8ms2PhbwvqsPi/4f+Dm8
LL8RfCKx6ndWtlrWvHWrC68R3XgbWbmztPF8WnXEEk92+qpBefobqfiywsbXS7ywtb3xLban4k0/
wy0vho2GpR6bc3t+2mz3+pyPf20cGm6RdKy6w8L3F5abWVLKaVWjG7HqOny31xpkV9ZyalaQw3F1
p8d1A99bW9wWFvPcWiuZ4YZyjiGWSNUlKMEZtpwAfmrofwu8UWhTxbq/gzxd4t+FUPxx0Txd4j+H
N18NvD3hOXxDpenfCzxP4XHjnS/g5p7rOYrHxxq3hLVtQ0K+sk8Q6zP4Nj8WW3h+61GCwFz9T/sy
+Grnwz4U8dRSeB774d6brPxd8e+IvDfhbULa0sZrPw1rF1Zz6RNHp9jPcWmmQXUKtNDpMEippCt/
Zghg+yeSn0HY6jp+pxPPpt9Z6hBFPPayTWN1BdxR3Vs5iubZ5IHkRJ7eQGOeFiJInBSRVYEVcoA/
HSP4BfFW6+F9p4dvvh5r8k837O3wi8H32nPbqsjavpf7Ut54s13Rn2Tqy3Nl4Tm/tm6VXBjsHEiv
vwo9r+Mv7PniK48VeIdG+E3hu6+Hnh/XPHf7KOrWOveANE0WxtvDlz4Z174jWHi7xjpOki3/ALGj
1Twpor+Fbi5luNPePyrbR/tEF1BEkdfpBRQB+aetfCnWYvAHwj0XVfh54k0HXvhPefEfwrqmteHf
AGhfGPwh4k1rUzoCyeMNY+HPiT7Zr3i7SfjBZx3OvTeM7fUbTxN4O1+bW9B8RawiatqmqD7d+Ctv
4hs/hH8OLHxX4X07wT4gsPB2g6fqXhLSZ57jTfDslhYQ2kOlWb3Woavcxw2ltDBGttPq+rS2ZBs3
1TUWgN7P6fRQB8AfsPf8lF/4KN/9n/8AiT/1ln9lGj9sj/k4r/gk7/2f/wDEf/11l/wUso/Ye/5K
L/wUb/7P/wDEn/rLP7KNH7ZH/JxX/BJ3/s//AOI//rrL/gpZQB9/0UUUAFFFFABRRRQB8Af8E1f+
Kb/Zu1H4HS/urn9lj46ftB/s0Wdj0OneAfhh8XPFUPwKgK8eX9p/Z41T4SaoIlVIoV1BYrdTbJC7
ff8AXwB8Lv8Ai1X/AAUL/ab+Gzf6NoH7T3wl+Fv7WXhOH7qaj8R/hnBYfsy/tAzQxnjbpfgjQ/2Q
ZJ5ISRJdeIpnuIopWWe9+/6ACvgD9hH/AJGL9vf/ALP/APiz/wCqt+B9ff8AXwB+wj/yMX7e/wD2
f/8AFn/1VvwPoA+/6KKKACivDPjd+0z8Av2cLDRb743fFfwf8PZ/FF1Pp/g3w/q2o/afGvj3VbaI
Tz6L8O/AOkx6h43+IevRQHz30LwV4f17WBAGm+xGJGcfOf8Aw3teax/pnw+/Yf8A2/8A4h+Hn5t/
EX/Cg9D+Df2kHlD/AMIZ+098R/gT8ULLfGVk26p4DsHi3eTcLDcpJAgB9/18Afsr/wDJ3f8AwU7/
AOy//s//APrFH7O9H/Dxz4MeFOf2hPh1+0h+yVar81x4o/aJ+B3ivQ/hRpcPUT+I/wBoL4fj4j/s
7+EY2G5kXxb8WNDndI5XWErDKUx/2N/EOgeLf2n/APgpL4n8K65o/ibw1r/xv/Z11bQvEPh/U7LW
dD1rSr79iL9nW4stT0nVtNnubDUtPvIHSe1vbO4mtriF1khkdGDEA/RevgD/AIKP/wDJGPgr/wBn
/wD/AATS/wDW+v2da+/6+AP+Cj//ACRj4K/9n/8A/BNL/wBb6/Z1oA+/6KKKACiuf8V+LPCvgTw3
rXjHxx4m8P8Ag3wj4b0+41bxF4q8V6zp3h7w3oOlWib7rU9a1zV7mz0zS9Ptk+e4vb66gtoU+aSR
RzXxB/w3mfiDz+yr+y5+0r+1PpEvy2/xN8OeG/BvwU+Bs6NzBqujfE/9pfxr8Hv+Fm+FbtcfY/Fn
wD8N/GTRLtnQ29xLDHdz2gB9/wBfAH/BUD/kyv4i/wDY/wD7N3/rTnwcpP8AhpH9t+z/ANK1L/gm
94kvrCH57q08IftVfs+ar4mniHBj0bTvFep+A/Dl3eEkFYtX8YeH7QoHLX6MEST47/b2/bc+FfjP
9mHxT8J/iD4W+LH7M/xo8TfEX9na08NfCn9pDwR/wg2peMdQtP2kfhJf3mkfDX4j6FqnjD4D/GLX
LGws7/UNQ0L4OfFvx/rGnaXYXWsX9lbaQIb6YA/cSiiigAr4A+J//Fvf+Cjn7K3jdf3GkfH/AOAP
7RH7OOvMPlOo+O/AOpeAP2hPg5GzjAkXSfBHh39qGQQSCSTdq3nWr2yQ3yXn3/XwF/wUiR/Cn7Pm
j/tG2iMNR/Yz+MXwu/atuLpFLPZfDf4c64+jftHyR7fnSa9/ZW8X/HPSIJQSkM+pRTTx3FtHNbTA
H37RTUdJEWSNldHVXR0YMjowDKyspIZWBBVgSCCCDg06gDI8Qa9pPhbQdb8T6/exaboXhzSNS17W
tRn3eRYaTpFnNqGo3s20M3lWtnbzTybVZtkZwCeK+Lv+CaWg6tpX7Dn7PviPxJZS6b4v+M3hjWP2
m/HWn3O03unePv2rPGHiP9pPxzpuoSKWWa/0vxV8VNW028mWSVHntHMU0sXlu1H/AIKTXl3q/wCy
3rnwN0e5nt/EX7XXjf4dfsg6Y1nK8GowaB+0D4r0/wAFfF3XdNniKzwXvgf4DXHxV+Icc9syXUMf
hGWW1kjuEjkT7tsrO006ztNPsLaCysbC2gs7KztYkgtrS0tYkgtra3hjCxwwQQokUMUaqkcaKigK
AKAOX+IngLwr8Vfh/wCOvhf470qDXvBHxI8HeJvAXjLQ7oBrbWfCvjDRL7w94h0q4BBBg1HSNRvL
OUEEGOZgQelfMX7Anj3xV4x/Zm8IeF/iTq0+tfGH4C6v4q/Zn+M2q3pP9o698RvgHr158OL/AMd3
qEsYk+LWiaLoPxi0cbv3nh34g6NcbY/O8pPs6vgDSv8AiwP7fniDR3/0T4cft5eC4/GekO37uzsf
2rf2evCumeG/F+mBxhZtY+MH7NOm+DNa0ewSNWt7H9lzx7qlxcTvqMUNuAff9eDfHj9nTwD+0Hp3
hRfFF/428JeLvh3r1z4r+F/xQ+GHjHV/AfxI+G3im80bUPD13rHhrXtKlNre2uo6Lql9pWv+EfF2
l+J/APi7TJ20vxh4T8Qab/ode80UAfAH/CG/8FKfht/oXhH4z/swftOaBB+709/jx8PPGXwC+KTR
H5BL4p+I3wQuPHXwz8RXkfFwX8Nfs3/Dm0nIa0Flb7hexn2n/gqbr/8AxLv7G/YA+E/m/wDM4f8A
CS/tFftB/Yf+6cf8In+zJ/auev8AyVTR8dOetff9FAHwrof7Duj+L9Z0vxn+198TvE/7Yni3Rb+1
1fw94Z+IWi6D4W/Z08DaxZTLdWOp+Cf2bfDMX/CC3us6TfRpqHhzxt8Ybr4x/FHwrdhm8N/EHS4H
NvX3SAFAVQFVQAqgAAADAAA4AA4AHAFLRQAV5L4v+AvwT8f/ABF+G/xf8bfCf4e+Kfiv8H7rUrv4
W/ErXPCWi6h478Ayaxpep6Nq0PhbxXPZvrmkWOpafrGoRX2m2t6mnXU0sV7Nave2dncW/rVFABRR
RQB8T+NP2Gfh/c+LfEXxL+BHxD+LP7IvxR8W6ve+I/F/ij9nnXdA07wl498TajM11qfiT4kfAv4h
eGPiD+z9468U63cux1/x7q/wv/4WdqMMkqReO7KfyLq35j/hUX/BSzSv9C8P/tx/ssazpf3Rf/FT
/gn3458TeM9n3Qzav8Mv28fgp4QNwU+dpB8PlgNz+8W1W3/0Svv+igD4A/4Y6+M/xI/cftOftufG
r4ieGpPkv/hf8BtG8P8A7JHw41uE/fj1vXfhvPrf7SFxDIB5Nxpen/tG6X4c1KzkuLLWdC1S2nZF
+v8A4YfCj4ZfBTwbpfw7+EPgDwf8M/Aui+c2meE/A/h7S/DOhWs11IZr28GnaTbWtvLqGoXBa61P
UZ0lv9SvJJby/ubi6lkmf0CigAooooAyNF8P6D4ctrmz8PaJpGg2l7qep61eWui6bZaXbXes63ez
alrOrXMFjDBFPqer6jc3Goanfyq91f3s811dSyzyvI2vRRQAUUUUAfAE/wDxZP8A4KK2U/8Ax6+C
f24/gnLpkpPyWNv+0b+ys0+pacilsGXxJ8WP2fPHOtuyo0qDw9+yyjeXavE8l99/18a/t1/D3xd4
t+BZ+IHwu0ifXPjb+zT4z8NftNfBbR7LA1HxN4x+FIv7nxF8NNPdv3cMvxy+E+q/Ej4CXV0+z7Jp
nxRv7uGe0uYYby3+lfht8QvCPxc+HfgL4rfD/V4PEHgT4meDPDHxA8F69a5+z614U8Y6JY+IfD2q
wA8iLUNI1G0ukVvmVZQrAEEUAfO37dvxO8W/DH9mPx//AMKzvhp3xl+KE/hn4A/Au8CtK+nfGf4+
eJtK+E3w88SvaxvHNd6Z4D13xZB8Q/EsUUtu0XhTwnrt5Jd2VvazXkHvvwm+GPhL4KfCz4bfBzwD
YnTPA3wo8BeEPhv4O05mV3svC/gjQNP8NaDaySIkayyw6XplqksoRPNkVpCoLEV8g+Lf+L+ft7fD
7wRH/pXw8/Ye8Gt8cfGB+/Z6h+0j8dNA8W/DT4MaGXGYbi6+G/wUl+NPjLxJo10rtZ3nxZ+C3ie3
8i5trKavv+gAooooAKKKKACvz/8A2iP+T7f+CdP/AHd1/wCqd0Sv0Ar8/wD9oj/k+3/gnT/3d1/6
p3RKAPsD4s/8kr+Jf/ZP/GX/AKjmpV4B/wAE9v8AkwX9h7/s0D9mn/1THgqvf/iz/wAkr+Jf/ZP/
ABl/6jmpV4B/wT2/5MF/Ye/7NA/Zp/8AVMeCqAPr+iiigAooooA8S+Lvh7Wtd8Tfs/XWkadcX9t4
Z+Nq+IdfmgVTHpWip8JPi1ozajdszKEt/wC1dZ0qwDDczXN/bxqpMgr51+AvwMl+Hth+yRqNr8Or
bwt4i0X4eeKrD4pajaaZZ2WrJqWt+FNHna08V31vi61CWfX7RTDDezXS2l1bJHAtusKIv3vRQB+f
v7Q3wi8YeJPiz8QNZ8GeBZr7VPHv7Md74D8P+L9Pg0uwEHizTPEeuanrOgar4nkeO88MXPi7wfcW
vhbTNbn22szXMNlPeW9rZO8Hjn7QnhSK58D/ABc8WeD/AIS6t8OvhfP8O/g74L1rwXqHhfSvAc3j
nxpa/Hfwld2ENvoFvNCkn/CKeHpdS8N/8JHciDStQHiSG30TVNW0vTmurb9ZazdX0XR/EGnzaTr+
k6ZrmlXD20txpmr2FrqWnzyWV1DfWck1lexT20r2l7bW95bO8bNBdW8NxEUmijdQD88NX+Guta94
3s/FPw4+E2t/D/4f/wDC3P2WLifwtN4ZsvCct1q3w88XeMr7x749Hhi1mRdN03S/DmseE/Dk+r/Z
Yh4gTw751o97pOl6XfXdnwj8NL2HwofA3iD4CeJdf+LtppPx1tPHnxWs9QsPAJ8RHxrpPi1F1nRf
iMhnt/F+pfFC81HQLTTtL1EXCeCGceIfEdrol94M0XTr79GKKAPin9ljwr4j8JeJvGVkfCFxZ+Dn
8I+CrKy8ZeIPhhpnwh8a6hq+iXviS2Twjrvh/wAPXieG/FkfhjS7yKSHx1pPh3Q4byTUZLCG98RW
MFlc2H2tRRQAUUUUAFFFFAHwB+w9/wAlF/4KN/8AZ/8A4k/9ZZ/ZRo/bI/5OK/4JO/8AZ/8A8R//
AF1l/wAFLKP2Hv8Akov/AAUb/wCz/wDxJ/6yz+yjR+2R/wAnFf8ABJ3/ALP/APiP/wCusv8AgpZQ
B9/0UUUAFFFFABRRRQB8Aftxf8Wv1/8AZh/a+tf9Hi/Z6+NGm+C/ineJ8rSfs4ftNz6V8G/icl/K
MGHw34I8e33wW+PviaXcRFpfwOkmMcxjWM/f9cB8Vvhn4Q+NPwv+Ivwe+IGnnVvAvxU8DeK/h34x
0xXEUl94Y8Z6HfeHdctoZiknkTy6bqNysFwEZreYpMgLIK+fv2HPiZ4v8f8AwF07wz8VNQGo/HP4
B+JfEP7Ofx5u2QwT6v8AEz4STW+iv49eyZ5W0+w+NHgubwb8dfDVi808kHhD4n+HhLNJIXagD7Ar
4m8cfsg63YeOvGPxc/Zf+O/jb9mr4k/EHWk8T/EPRDpVl8Xf2fvif4oi0nTNETxF47+BvjG/sk0j
Xp9M0XSLTWfE/wADvG/wR8ZeKYtOs18WeJ9dFrbeT9s0UAfAH27/AIKm6L/oH/CMfsAfEryuf+Es
/wCE6/aK+CP27PG3/hXv/Cuv2gv7K27fM3f8LN1nf5vk7E+z+fcn/CA/8FHvid/ofjr48/s6/sye
Gp/3d/bfs3/DTxH8Zvi1s+6ZfDvxf+P1xo/wz0BnRn3xa1+yt41cSCB4LyARyrcff9FAHzn8Ef2V
fgx8A7/WvE/hDQNQ1/4oeLLWC08d/HD4k69qvxI+OHj6C3lNxBY+Kfij4tudT8UT+HbK7aW40LwN
pl7pXw/8IiaSz8G+FPD2miOyj+jKKKACvJfhX8Bfgn8DH8cv8GPhP8PfhSvxM8YT/EDx/B8PfCWi
+ELTxZ43u9M07SL3xVrNloVnY2d1rl/Y6VZLqGoGAT39yk2oXjz6heXl1cetUUAFcN8Sfhl8O/jH
4J174bfFfwR4W+I3gDxPBb2+v+D/ABnomn+IfD2qpZ3ttqVg93pepwXFq9zpuqWVlqul3gjW70vV
bGy1PT57a/s7a4i7migD4A/4Y5+Mvw3/AHH7Mn7bnxu+HHhqPiw+GHx10nw9+1t8ONGRf9XHo+uf
E2TS/wBo+3tUXEEOkXP7Rl74e06zitrTRNF0mKFhKf8ACo/+Cluqf6Hr37cX7Kmj6b937d8MP+Cf
Pj3w54v2H5C39q/En9vb4y+E/tAj+dJP+EC8gXeJXtZLXNkfv+igD4g8KfsIfDeXxJovj79oXx58
Uv2xviL4c1C31nw1rn7R+reGtY8E+C9ctX8201v4f/ATwB4V+H/7Pfg7xFpcpZdG8c2Hwul+Jtla
hLefx3fHzZpvt+iigArK1nQtE8RWa6d4g0bStd09L3TtSSx1nTrTVLNNR0e/t9V0m/W1vYZ4FvdL
1OztNR066CCeyv7W3vLaSK4gikXVooAKKKKACue8XeFPD3jvwp4n8D+LdLttc8KeMvD2teFPE+i3
gZrPWPD3iLTbnSNa0u7VGVmttQ028ubScKysYpnAYHBHQ0UAfEP/AAT38V+IdQ/Zu0j4V+O9UudY
+KH7LXivxb+yj8SdT1AqdW1/V/gZqQ8LeD/H+rKqoI7v4xfCQfDj41Qr5VvnTviNYyfZrbf9nj+3
q+AJP+LA/t/xzH/Rfhz+3x4JjtGP3LKy/a0/Zw8JXE8B3HDTa98af2XNOmjZd0kFpo37IMAjjtrj
UJ3v/ubxH4h0Pwj4e13xX4n1Wy0Lw14Y0bVPEPiHW9SnW207R9D0Wxn1LVtVv7lyEt7LT7C2uLu6
nchYoIZJGOFNAHwz4q/4vZ/wUN+G/hFf9J8F/sT/AAh1X44eIV/1ls/x/wD2kYfFPwf+D4ik/wBU
mpeBvgh4e/aPn1zT2WS6S0+MvgbU99jBJCuqff8AXwz+wH4e1zUfhH4j/aO8b6Ve6P8AEb9s3x/q
X7TPiHSNWga31jwr4K8U6H4f8L/AD4eapaSjzNM1f4ffs7eEfhV4b8WaWhS1X4h23jXV44IrnWbw
yfc1ABXyp+2R8IPFvxa+DbXvwsWxT48fBrxZ4c+PP7PlzqNyLCwl+Lnw0lub/SvCWraoQzaV4V+L
fhu78U/BPx/qUKPc2vw8+JXixrRftRhZfquigDyv4H/F/wAJfH74RfDv4z+Bmvl8MfEfwrpfifT7
LVrY2GvaJLewAan4Y8TaW5M2jeLPCurR33hvxXoV1tvdC8R6VqmkX0cV3ZTxr6pXwPqn7BkVt4p8
c678K/2tP2uPgB4c8feN/EnxH1P4X/CLxN8FI/hxpXjbxvfNrvj3XfDemfET4E/EPXtGl8deMLrW
fHXiayi8RyaZdeMvEniLWrSysn1aeKoP+GHviL/0kb/b/wD/AApP2Wf/AKFGgD7/AKK+AP8Ahh74
i/8ASRv9v/8A8KT9ln/6FGj/AIYe+Iv/AEkb/b//APCk/ZZ/+hRoA+/6K+AP+GHviL/0kb/b/wD/
AApP2Wf/AKFGj/hh74i/9JG/2/8A/wAKT9ln/wChRoA+/wCivgD/AIYe+Iv/AEkb/b//APCk/ZZ/
+hRo/wCGHviL/wBJG/2//wDwpP2Wf/oUaAPv+ivgD/hh74i/9JG/2/8A/wAKT9ln/wChRo/4Ye+I
v/SRv9v/AP8ACk/ZZ/8AoUaAPv8Aor4A/wCGHviL/wBJG/2//wDwpP2Wf/oUaP8Ahh74i/8ASRv9
v/8A8KT9ln/6FGgD7/or4A/4Ye+Iv/SRv9v/AP8ACk/ZZ/8AoUaP+GHviL/0kb/b/wD/AApP2Wf/
AKFGgD7/AKK+AP8Ahh74i/8ASRv9v/8A8KT9ln/6FGj/AIYe+Iv/AEkb/b//APCk/ZZ/+hRoA+/6
K+AP+GHviL/0kb/b/wD/AApP2Wf/AKFGj/hh74i/9JG/2/8A/wAKT9ln/wChRoA+/wCivgD/AIYe
+Iv/AEkb/b//APCk/ZZ/+hRo/wCGHviL/wBJG/2//wDwpP2Wf/oUaAPv+vy0+HXxa8H/ALBNz+1P
8Dvihc3WmfCf4PeF/GX7X/7PD2dq97qWsfs++NNfvtS+IPwh8IaZGRc+IfFXwV+O2r33gvwx4U0p
N9p8PvjB+zb4M0qK51O9Ebemf8MPfEX/AKSN/t//APhSfss//Qo1x17/AMExfA/jH4p/BX4qfG79
pn9rD9oi7+AfjOPx94A8IfFrxT8Go/BY8SWl1pWr6ZJ4htPhp8Dfhzr3iHSNK8WeGvBvju08Nah4
ifw5N438B+B/EepaVf3vhfSjAAe+/sZ/CXxh8NPhLe+J/izbWtv8f/j94y1n9oD9oJLO6TULXS/i
Z48sdHs7bwBp2pRhE1Xw/wDBP4eeH/AfwI8I6sI4ptX8I/DHQtVvUOo3t5LJ9Z0UUAFFFFABRRRQ
AV+f/wC0R/yfb/wTp/7u6/8AVO6JX6AV+f8A+0R/yfb/AME6f+7uv/VO6JQB9gfFn/klfxL/AOyf
+Mv/AFHNSrwD/gnt/wAmC/sPf9mgfs0/+qY8FV7/APFn/klfxL/7J/4y/wDUc1KvAP8Agnt/yYL+
w9/2aB+zT/6pjwVQB9f0UUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFAHwB+w9/yUX/AIKN
/wDZ/wD4k/8AWWf2UaP2yP8Ak4r/AIJO/wDZ/wD8R/8A11l/wUso/Ye/5KL/AMFG/wDs/wD8Sf8A
rLP7KNH7ZH/JxX/BJ3/s/wD+I/8A66y/4KWUAff9FFFABRRRQAUUUUAFfAHir/jG79tnw58QR/ov
wj/bitdD+E3j6T7lh4X/AGqfhp4d1O4+DPjC7IxFbr8bfhJpevfB7xBrd/KkbeKfhJ+zv4N0qKXU
vFpV/v8Aryb44/Bnwf8AtA/C7xP8J/HEms2eieIxo97aa54Z1BNI8WeEPFXhXX9L8X+BfHvgzWJL
a9j0fxr4A8baD4f8aeD9Xlsr2HTPEuhaXezWV5DA9tKAes0V8Af8MPfEX/pI3+3/AP8AhSfss/8A
0KNH/DD3xF/6SN/t/wD/AIUn7LP/ANCjQB9/0V8Af8MPfEX/AKSN/t//APhSfss//Qo0f8MPfEX/
AKSN/t//APhSfss//Qo0Aff9FfAH/DD3xF/6SN/t/wD/AIUn7LP/ANCjR/ww98Rf+kjf7f8A/wCF
J+yz/wDQo0Aff9FfAH/DD3xF/wCkjf7f/wD4Un7LP/0KNH/DD3xF/wCkjf7f/wD4Un7LP/0KNAH3
/RXwB/ww98Rf+kjf7f8A/wCFJ+yz/wDQo18tXfwE+OMH7a/h/wDZ5T/gol+3IfAuqfsteMPjPc3b
ax+zGfEY8W6D8WfA3geyt4r8fswCxXRG0fxHfy3Fm2lvdSXy20yX8cMb28oB+0lFfAH/AAw98Rf+
kjf7f/8A4Un7LP8A9CjR/wAMPfEX/pI3+3//AOFJ+yz/APQo0Aff9FfAH/DD3xF/6SN/t/8A/hSf
ss//AEKNH/DD3xF/6SN/t/8A/hSfss//AEKNAH3/AEV8Af8ADD3xF/6SN/t//wDhSfss/wD0KNH/
AAw98Rf+kjf7f/8A4Un7LP8A9CjQB9/0V8Af8MPfEX/pI3+3/wD+FJ+yz/8AQo0f8MPfEX/pI3+3
/wD+FJ+yz/8AQo0Aff8ARXwB/wAMPfEX/pI3+3//AOFJ+yz/APQo0f8ADD3xF/6SN/t//wDhSfss
/wD0KNAHsn7XfwW8QfG/4K6to/gC/wBP0P4zeA9c8N/GD4BeJdU8xdM0D43fC7VIfFXw/bXHg/0k
+D/Emo2Ungb4iWdsVm1j4b+K/F+hhgupua+OPib8atA/b3+HX7NX7PHgax1HTNG/a30bVPHn7UXh
jVDH/b/wu/Zw+D2uWGh/tEfBjxzHAWt7Lxn44+ML6Z+yB4r0CV7e6k0jWPjhrXh25kvfhteND7H/
AMMPfEX/AKSN/t//APhSfss//Qo11/7Jv7DPwt/ZE1340+NPC3i/4o/E74kfH/xTY+KfiV8SfjBr
nhnWPFGoNpkmtX9joGkWngrwd4C8IeG/DUfiXxV438b3WmaF4WsW1fx1498aeLdaudS1rX7u6oA+
zwAoCqAqqAFUAAAAYAAHAAHAA4ApaKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAK
KKKACiiigAooooAKKKKACiiigAooooAKKKKACvzr/bHg+JvhT9oH9jD46+CPgV8VPjx4Y+E+qfH7
TfHeg/B4/Du48YaMnxH+GlloXhrVBpfxF+IXw50+90uTU9Pntr6ay1ie4smeBpLVlnjJ/RSigD81
vHX7ZHxQ8R+CPGPh7T/+Ccv7fK3+veFfEOjWLXHh79luO3F5qmkXljbGeRf2q5GjhE06GV1jkZE3
MEYgKfLP2Uf2lvjP8F/2W/2bPg74w/4J0ft2y+LfhP8AAL4OfDTxTJo2ifsvXukSeI/Anw78OeFt
bfSryf8Aams57vTX1PSrprG5ms7WWe1MUsltA7mJP18ooA+AP+G4fiL/ANI5P2//APwm/wBln/6K
6j/huH4i/wDSOT9v/wD8Jv8AZZ/+iur7/ooA+AP+G4fiL/0jk/b/AP8Awm/2Wf8A6K6j/huH4i/9
I5P2/wD/AMJv9ln/AOiur7/ooA+AP+G4fiL/ANI5P2//APwm/wBln/6K6j/huH4i/wDSOT9v/wD8
Jv8AZZ/+iur7/ooA+AP+G4fiL/0jk/b/AP8Awm/2Wf8A6K6j/huH4i/9I5P2/wD/AMJv9ln/AOiu
r7/ooA+AP+G4fiL/ANI5P2//APwm/wBln/6K6j/huH4i/wDSOT9v/wD8Jv8AZZ/+iur7/ooA+AP+
G4fiL/0jk/b/AP8Awm/2Wf8A6K6j/huH4i/9I5P2/wD/AMJv9ln/AOiur7/ooA+AP+G4fiL/ANI5
P2//APwm/wBln/6K6j/huH4i/wDSOT9v/wD8Jv8AZZ/+iur7/ooA+AP+G4fiL/0jk/b/AP8Awm/2
Wf8A6K6j/huH4i/9I5P2/wD/AMJv9ln/AOiur7/ooA/Fn9mv4+/HP4TeLf2utb8U/wDBOn9ueSz+
N/7U+sfGXwYNK0f9mC7ni8I33wS+Bvw+gj1tJv2o7RbHWBr3w6193srd72BdPfT7gXjSXMtvb+h+
L/iB8Y/2m/2k/wBgCWw/Yy/aj+D/AIW+A/7UfxA+NPxJ8ffGi0+A+jeE9I8IXn7CP7aHwM02C1Hg
f48fEDxJqeuan8RPjb4D02006y8OSxrZ3Wo6ld3dra6dM5/WOigAooooAKKKKACiiigAooooAKKK
KACiiigAooooAKKKKACvgDUv+Upvg3/swD4lf+tFfCevv+vgDUv+Upvg3/swD4lf+tFfCegD7/oo
ooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiii
gAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKA
CiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACvgDUv8AlKb4
N/7MA+JX/rRXwnr7/r4A1L/lKb4N/wCzAPiV/wCtFfCegD7/AKKKKACiiigAooooAKKKKACiiigA
ooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACi
iigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKK
KACiiigAooooAKKKKACiiigAooooAKKKKACiiigAr4A1L/lKb4N/7MA+JX/rRXwnr7/r4A1L/lKb
4N/7MA+JX/rRXwnoA+/6KKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiii
gAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKA
CiiigAooooAKKK+PP2qv2hviz8G/Ef7O/wAOvgd8Ifh38X/ib+0T8SvFfgPQ9O+K3xr8S/AjwJ4e
svBfwh+IHxe1vXNV8ZeEPgV+0P4guLqTTfAUuj6Vo1n8PjFd32pxz3es6dBasJwD7Dor4A/4WN/w
VN/6M3/YA/8AFln7RX/0p2j/AIWN/wAFTf8Aozf9gD/xZZ+0V/8ASnaAPv8Aor4A/wCFjf8ABU3/
AKM3/YA/8WWftFf/AEp2j/hY3/BU3/ozf9gD/wAWWftFf/SnaAPv+ivgD/hY3/BU3/ozf9gD/wAW
WftFf/SnaP8AhY3/AAVN/wCjN/2AP/Fln7RX/wBKdoA+/wCivgD/AIWN/wAFTf8Aozf9gD/xZZ+0
V/8ASnaP+Fjf8FTf+jN/2AP/ABZZ+0V/9KdoA+/6K+AP+Fjf8FTf+jN/2AP/ABZZ+0V/9Kdo/wCF
jf8ABU3/AKM3/YA/8WWftFf/AEp2gD7/AKK+AP8AhY3/AAVN/wCjN/2AP/Fln7RX/wBKdo/4WN/w
VN/6M3/YA/8AFln7RX/0p2gD7/or4A/4WN/wVN/6M3/YA/8AFln7RX/0p2j/AIWN/wAFTf8Aozf9
gD/xZZ+0V/8ASnaAPv8Aor4A/wCFjf8ABU3/AKM3/YA/8WWftFf/AEp2j/hY3/BU3/ozf9gD/wAW
WftFf/SnaAPv+ivgD/hY3/BU3/ozf9gD/wAWWftFf/SnaP8AhY3/AAVN/wCjN/2AP/Fln7RX/wBK
doA+/wCivgD/AIWN/wAFTf8Aozf9gD/xZZ+0V/8ASnaP+Fjf8FTf+jN/2AP/ABZZ+0V/9KdoA+/6
K+AP+Fjf8FTf+jN/2AP/ABZZ+0V/9Kdo/wCFjf8ABU3/AKM3/YA/8WWftFf/AEp2gD7/AKK+AP8A
hY3/AAVN/wCjN/2AP/Fln7RX/wBKdo/4WN/wVN/6M3/YA/8AFln7RX/0p2gD7/or4A/4WN/wVN/6
M3/YA/8AFln7RX/0p2j/AIWN/wAFTf8Aozf9gD/xZZ+0V/8ASnaAPv8Ar4A1L/lKb4N/7MA+JX/r
RXwno/4WN/wVN/6M3/YA/wDFln7RX/0p2s/4M/DP9rzxP+14/wC0j+0j8N/2b/hLomg/s3678EPD
Xhr4IftHfE79oXVde1XxJ8TvCnjy71zXLvx5+yf+zHaeGdP0208Liwt7ewHiu51K5vzLKdNitf8A
SQD9D6KKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACi
iigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAK+A
P2qP+Tu/+CYn/Zf/ANoD/wBYo/aIr7/r4A/ao/5O7/4Jif8AZf8A9oD/ANYo/aIoA+/6KKKACiii
gAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKA
CiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAK
KKKACiiigAooooAKKKKACiiigAooooAKK/MD9u34V/Dr44/tJ/8ABO/4U/F7whovxD+GviH4m/tB
6nr3gbxRbHUfDOsah4c/Zv8AHF/oN5qWkyOLS9uNHvXe602W4jka0nd5ISjOxPoH/Dqv/gnH/wBG
YfAD/wAILS//AImgD7/or4A/4dV/8E4/+jMPgB/4QWl//E0f8Oq/+Ccf/RmHwA/8ILS//iaAPv8A
or4A/wCHVf8AwTj/AOjMPgB/4QWl/wDxNH/Dqv8A4Jx/9GYfAD/wgtL/APiaAPv+ivgD/h1X/wAE
4/8AozD4Af8AhBaX/wDE0f8ADqv/AIJx/wDRmHwA/wDCC0v/AOJoA+/6K+AP+HVf/BOP/ozD4Af+
EFpf/wATR/w6r/4Jx/8ARmHwA/8ACC0v/wCJoA+/6/iU/wCC6PwX/wCCtT/8FeP2DdA/Y/8A2o/j
R4Y+Ef7V/jBtN+E76VcWuoeHv2YPin4d8D6h4O/aB1uxibTbi4svDr/AfVNc+J/k397LcarDcfEv
S9CtY7fQraOL+mz/AIdV/wDBOP8A6Mw+AH/hBaX/APE0xv8AglP/AME33aN3/Ys/Z9doXMkTN8P9
KZonaN4i8ZKEo5ikkjLKQTG7oTtZgQD7m8MaI3hrw14e8OPrGteIW0DQ9J0Rtf8AEl6NS8Ra42lW
FvYtrGv6iIoBf61qZgN7qt6IYRdX0884ij8zYNyvgD/h1X/wTj/6Mw+AH/hBaX/8TR/w6r/4Jx/9
GYfAD/wgtL/+JoA+/wCivgD/AIdV/wDBOP8A6Mw+AH/hBaX/APE0f8Oq/wDgnH/0Zh8AP/CC0v8A
+JoA+/6K+AP+HVf/AATj/wCjMPgB/wCEFpf/AMTR/wAOq/8AgnH/ANGYfAD/AMILS/8A4mgD7/or
4A/4dV/8E4/+jMPgB/4QWl//ABNH/Dqv/gnH/wBGYfAD/wAILS//AImgD7/or4A/4dV/8E4/+jMP
gB/4QWl//E0f8Oq/+Ccf/RmHwA/8ILS//iaAPv8Aor8cfiH+yB+zD+zH+2B/wTT8T/s9/A/4ffB3
X/F/7TPxl8GeKtV8AaHD4eu/EXhNv2Cv2v8AxOfDusvZNGNR0f8A4SPw14e10WF0stuuq6Lpl+qC
5sreRP2OoAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKK
KKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooo
oAKKKKACiiigAooooA+AP2mP+T1P+Ca//Y//ALTv/rMfjavv+vgD9pj/AJPU/wCCa/8A2P8A+07/
AOsx+Nq+/wCgAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooA+AP2uP+To/
+CWH/Z3/AMY//Xdv7bVff9fAH7XH/J0f/BLD/s7/AOMf/ru39tqvv+gAooooAKKKKACiiigAoooo
AKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigA
ooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigD4A/aY/5PU/4J
r/8AY/8A7Tv/AKzH42r7/r4A/aY/5PU/4Jr/APY//tO/+sx+Nq+/6ACuOh8c6HN48vvhyPtsXiWx
8M2ni9o5rUpZXOhXmozaSl1Z3e8rcNDqEEltcxBVeB9hcbZYmfsa+bPivc2/gb4vfB74n3VwNP0W
7tfGfwz8X3rFfLNhq2jt4t8MiYF1O2DXvC88cTKJCH1Bl2gOWHxfHOf43hjK8uzrDyw0cDQ4m4aw
WfPEwuqeRZ1nGFyLG4yNV1aVPCxyupmeHzbF4qq5UqOX4DGOUHdNfR8MZVh87x2My2rGtLFVclzn
EZUqMrOeaZbl9fNMNh5U1Cc67x0MFWwFChTSnUxeKw6jJWd/SdD+LPg3xD8RPFHwv0y7upfFXhGx
h1DVo2tGSwaCQaeJhZX28x3U1jLqlnb6hCgWS0nlWOUDchfa0DxxoXibxF4z8M6S91NfeBL7S9M1
6doAtguoarpqarHZ2d0JGFxcWlpLCdQiKRtayTwowbzA1fGHhGzuPCVp8APjnqMP2W/+I3xA8Yye
OjGph8zSvj282peGZ7uQ2m+DTtCl0bwVD9nuGhSIhVkmLojLjHxb4k0T4a+A77RYPFtpqX7TPxl8
XeNNdm8Dixk8X23hO9XVNZstL8JSandLawX2p+FdG0CO21E3lvJZWkmoXNoi3kkRT8GwPjxnmEw2
HxXEWAoQnCriuKa2X4DL8QsdjOCOIMs4UjwJl1CnVxE44fOqnE/iHkPD2YYyrKVOtX4cz7EU8HRw
8+eh+pYnwuyzEVqtHKMVVlGVOhkdLF4rF0XhqHE2U43PHxRjKs4UoutlsMl4SzTN8Jh4JSp0s3yq
lPEVK0eWr+hWp6hb6TpuoareFxaaZY3eoXRjTfILeygkuZyiAgu4ijYqmRubAyM1meE/E+k+NfDG
geLtCkml0bxLpFhrelyXEL2072Oo28d1bGa3f54ZfKkXzI2J2tkZIGT8haRqfjq11jxjptp4a+Nt
r8M9X+FnjGTUT8X7u01WXQPFun2RfT7jRdZl1zxFrUtjrOnPe215pl3qAtre9gtrq1SMSSxtxtno
Pib4T/su+APizovxE8Y3PiXwv4X+HWtto0+uXU/gXUdD1SXw/p8nhCbwnuj0mGzt9J1E2q6tBbx6
2NRifUpLxpWWKL36/jjmVPF4rM48I5g+GuH+EuMOIOLY1lLBYzC0+FcdkNSrmWRVs0p5fPPMFiMk
zLF4vB0FgcHLFV8NXwlfE5fjsJLCV/KpeGeDnQoYJ5/hP7ZzbPuH8pyF02sTh6889w2aQhg80p4K
WLjlmJpZlg8PQxFV4rEKjSrUsRSo4vDV1XpfohRXLeONXg0Hwb4p1q58Q2nhKHTNA1W8fxPfWP8A
alroBgspnTVpdL8yI6p9hcLcJpqyB7+REtEDPMqN8KR+LNY0PUvgnqvhfVf2jbk618T/AAP4V8R+
K/iVNe2PgfxxpHi5Zk1OW18I+JNUeaye+WT7ToL6J4b0+DS4omK3KtFBLJ93x94p5fwDj8uwWKy6
eY/WqOHxeLjhcwwSzDD4LEZthcqjXw+URlXzDERpzr1sTVxWLo5Zk8aOErUY5tLHOOEPl+FeB8Xx
ThMXiaGLjhPYVKuHoOvhMS8LWxNHA18c6VbMGqeEpOcadOjToYepjcwdSvCpLARwqeIP0Uor5D8I
eEPEnxJ8TfHOfW/ij8RNM0/Q/iXrPhnwZpfhnxVqOiR+G1j0Dw3fS6hItk8TapH9pu0XT9J1N7rR
rRYr5kszLqE7R+e+CvFXjz4w3v7O1jrXjzxB4ft/EXw/+K9744HhPUZPDtz4sufAvjHw94fsZ45r
TMulXt9NAt9e3GlPbXcFjc6xYafdWkF2zL87V8a5UZYGnPgvNVXz7FYzC8LUf7Uym+a/2b4g8O+H
OPxGOn7bkyjD0814pybM6HM8ZWxGSVa9b2FLMsPLK5evDw3VRYmceI8A6WVYfDYjO6n1LH/7D9d4
Uzbi7CUcNH2fNj6s8BkmYYKrZYelRzKnSp+1ng6qxy+0PHfjbQ/hz4T1fxn4ka6TRdES0e+aytzd
XQW9v7XTYPKtw6GQm5vIQ3zjahZzwuDe0/xFbalr3iLw9FY6xBc+Gl0d7q9vdMuLXSL8a1az3cA0
XUpQLfVTaJA0WpC2LfYbho4JsO4FfAXxh1LW9F8FftSfCq88Q674o0Hwtpfwl8UeGb/xNqMmsa5p
Vv4w8S2o1DQLrWLlTfanZ2t5pH2rS5tRnuL6G3untpbidYo5K774h/FHxr4O1L9rq/0jWbh5vCWl
/BO08HW9+73um+G7/wAZ2L6Te6lYafMzWySC6v4tUmi8sw3d1aQ/aop4w0bfNYrx9hgc9x9TMsDi
cBkGS4CpLNsBQwuHx+Z0cz4dwf0jqvF9CGM+u4ehiMHz+DGGnkuIo0o1cR7SMMTRwyzCt/Z3tYfw
qlisrwsMFiqOKzXMcVCOAxVWtVwuCqYLN8R4PU+H6ssP9Wq1aWI5fEetHMqVSbhS5HKjUrPCU/rn
2/RXz9D8PNR+Hup+HfEtv8avFUdhZ2uq2Xi+y+JWu3PinRPFQm0u8u7e9tLbU9UsIvDWq6XfWq6k
o8PSWdvLpFte2Mtt5O+avkzxZ461XSfh+nxC8F+KP2jvFGt6Zqug64PiXqsN/wCGvhD4kttS8U6d
ps0X/CF+INXgsm8L31peSQaXZ6JoE0x82zuPtxjLzj6fi3xnq8D4GviuJeEK+CxOCwWcZxjMvocR
ZHmGMrZJkmBynMMbjcowWBq180x1SnTzSph6n13LcpyvDYzK8bDGZvh8LisjxmceJkHhzDifFUqG
TcQUsTRxOJy/L8Pi6uUZnhMPTzPM8VjsJhsNj8TiqdLA4aM54KFaH1bG47G1sPjcPLD5fVr0Myw+
X/oY/jLw9/bHiDw7b3xvvEHhjRbLX9Z0Wxtrm61C207Uhf8A9mssccRimudQOmXi2tlFK93IY0Yw
qk0DyaehaxB4g0XStctbbUbK31fT7TUYLTV7C50vVLaK8gSeODUNNu0jurG8jVwk9tOiyRSBkYZG
a+MLfw8+nftC/tI67aeI/F0V5o/wv8Na7axjxDe/Y5LrWNI8ehLa5tgQk2n6K+yfw9Z5VNHuIo5r
YhwS0Pw41jxh8VJ/gr4M1vx14p0vR4/2ePDHxQ8S3Xh/XbvR/FXjLxFq2qpokUep+IrSRNYj0q0j
tLm6vF0+5tpr281CP7VOQkG3yMs8aM2nmscrzPh6MszzDiPjvh3Icsy7EUFh8e+GvEKlwfgcZjs0
xde+XuGF+s4vM4xwuJVWGDxFfA0pV6mDyyv343w5wEcFLG4LNnHBYTKOGM3zXG4yjVdXCrOeEpcQ
4rD4bBUKTWL5q7o0ME5V6LhLEUaWKqKnDEY2n91UV8AeOvF3jzwH4K/aR8Gaf478QalL8NNR+Duo
eDPFeo3xu/F+m2Hj3WtJkvtG1XVgI5NVW0e1u0guL0PdXWmam1pePNAI1Hpsmj678MPjf8F9G0/4
ifELxLpPxEtPiPp/ivTfGviOTxFY3M3hzw1b69pupaZa3EEcGhXg1AP5q6Slram1kNnFbw24Mbex
Q8bKOIx9LCR4TzWFLC4/hfKOIsTPMMqvkubcU+KHEvhFhMLRoxrzlmtHC8W8LY+pisVQnRh/Ys6O
OowqYmX9nnn1fDapRws8RLPsDKdfC53mGUUY4TG2zHA5HwTkvH9etVqSpxWBqVshzzCQo0Ksasv7
RjUw1SUKK+tH1lRRRX7kfmR8Aftcf8nR/wDBLD/s7/4x/wDru39tqvv+vgD9rj/k6P8A4JYf9nf/
ABj/APXdv7bVff8AQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFA
BRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAF
FFFABRRRQAUUUUAFFFFABRRRQB8AftMf8nqf8E1/+x//AGnf/WY/G1ff9fAH7TH/ACep/wAE1/8A
sf8A9p3/ANZj8bV9/wBABXnXxU+GHhv4weDL/wAD+KpNTt9MvrnT7wXui3UNlq1jdaddxXUU1hdT
2t7DC8qpLZ3Be1lElldXUShHkWVPRa+PtP8AiV+0P4svfjLqfgWy+E+o6T8K/iV4j8Ead4L1fR/F
1l4l8XQeHNG0DW3ii8Y2vim70nStV1WLWvsNjLL4Nu7KG8iia5iFvI7xebnOT5XxDlOZZFneBw+Z
5PnGBxOW5nl+LpqphsbgcZRnQxOGrQdr06tKcoOzUlfmjKMkmuzLsxx2U4/B5pluKrYLMMvxNHGY
LF0JOFbDYnD1I1aNanLpKE4xkrpp2tJNNp+/+OPhj4Y8eeALn4baml5p/hya30a2tv7Hmht7/TE8
P3thf6S+nXF5bX0cMtnPptqI5JbecmNWUgli1VPEfwl8KeJfBnh3wTO2raXZeD20Cfwlq2h6gdN1
/wAN3/hm3S00fUtKv0heGO7trZGt3We0ns54ZZYprR0YKvB237T3wzn8O+GfEZXxVNba58OvDPxU
1ePRfCWv+J18DeC/FNld3en6v40u/DlhqVlpEavpurW01us9xfA6Rqt4tm2m6de3sHOf8NAXsnxQ
8R+DPt3hCx0HTvip8JfAvh3U5LDX9XuPFFl8Q/hdd+Pp4LS70e8msLfVJ54MaLq91FDoEWmwyrei
4ubi2mry8bwZwrmNbMMRjsgyzE1s0yPC8NY+pUwsHLEZDgcRisXgsrlZJQwuExWNxOJw0aShKhXq
KrSlGdOk4d2G4iz3B08LSw2a42jTwWZ185wsIV5WpZpiqNDD4nGq9+aviKGGoUaznzKrSh7OalGU
1L0HQvgjpVhf61rviTxd4y8eeKtb8L3ng1vEfie80lZ9I8PXzzvdWegaVomjaToOmyXLyxy3N42l
3N5PJbxh5/Iee3l5bQv2Y/DGiWXhrw3J42+I2ufD7wpJYXemfDvXda0u78NTajp0wura41SS30O0
1rUrKO+C6jHoNxqp0KG8AWHT47BIbCLspfj58Krfw74Y8VXPicW+h+LfB/ibx9pd5Lper/uPCfgz
TrPUfFeravFHYvLow0D+0tO07ULPUkt9QTWr+10WK1l1KQ2y4t7+0p8LdG0HxR4h8TXPinwhb+D7
HQNY1vTfFPgbxdo3iFdB8U66vhzQNf0/w9caOdX1fS9Q1hxZO+l2l5daZdZs9ZtNOvv9FPhT8KPD
2osG6vDWFrzwSxkVXr4nMK+KxtPMcVhMbmVHOcXWxk8Tn9DMsVl+ArZlh88q5hRx8sDgvrlOtHC4
dU/Tjx3xZD6wqec16UMR9XbpUqOEpUMNLB0K+GwdTLqFPDxo5VVwdDFYqng6uWU8JUwkcTifq86b
r1XP1bxl4R0Xx74V1/wb4jgluND8SaZc6VqUUEz20/2e5QqZLedPmhuIX2TQSYZVljQukibkbyeb
4A2WpyeFJPE3xH+JXic+Bda0LXPCMepah4agg0u98O3kV1p091b6Z4WsodcvXjiNlealriaheyWk
1wlpLZSTyys9/wBpD4cRXVvYz2vj62u1tdEvdftrr4aeO7efwTaeJtW1HRPDs/jiGXQVl8NDWtQ0
u9+xx3yCdNNSPXruK20C4t9Ul9G8deP/AA78PNMsNS8QvqUj6zrFr4d0HSdE0jUte13xBr97b3l5
baPo2kaVbXV5eXb2Wn6hfzMI0tbHTrC+1LULm00+zurmL2M84H4V4kxax2d5PRx2KeFw+Bq1JVsX
RjisHg8XUx+Bw2Oo4bEUaOYUsvx9Wrj8thjqeIWXY6rVxmB+r4ipOrLz8s4mz3J6H1bLcwqYWiq9
XEwiqdCpKhiMRQhhcVWwtStSqVMJPF4WnTwuMlhp0njMNCGHxPtaMYwXzJ4N+Cmv6143+P2s3vir
4nfDu28T/Ey8hjj8PXllpth4s8LHwzo8MN9arrGi6o1tNHfTajBb+INCksL0iN7Z7iZIIBBd8bfB
d5fip8B9I8Gp4r8GeE/A/gb4i2Fn4o8HuI5PDWoTDw3/AGXFeXuo2eqadeSawsWoi6ttdtb6LWWe
8kuElum89PVJf2hPh39m0RtPHi3XNY10+JPI8I6F4H8Van4z09PBmq22ieMJtd8MQaV/amhQ+HNV
u7Wxu31WC1F9c3VlBof9rS39gl1l6l+098JLKTSYbHUPE3iifWvAdp8TrKDwd4F8ZeJ5l8B3N5f2
MviK/j0nRLhtKh066027ttTsNU+x6xaXqR6a2nNqk0Nk/wAAvAjgpZHUyd08VKriOJcLxHis0des
sdN4fj+h4hVcuwc1WUcnwmMzfDUY4uWT/Ua1arRo5lVnPM6NLFR+rfihxJ/accwU6MadLJa2TUMC
qdN4aKq8K1OE4YzERdK+YYjD4CrUdBZh9ap04VKuDhGODqTouzJ+zz4RvfBnjnwlrOueL9bvfiTd
6Zf+NfGmpalp8vi7V7nRp7KbSlScaSui6fYaYlhDZ6dpdjokGn2Vk00UNuJJXmPUXnwf8G6lqfxP
1HVYb7VI/i3p3hzS/FWmXlxAdOS38MabdaZpsmki3tYL2xuvKujcSXL3tzLFe29tdWTWckXzeb2P
7UHgibxn8RdKv11Cw8DeBvhh8L/iba+P/wCwvE1xo+v6d8SZdcNjDpssOitHf3V5FBoNv4b0nSm1
DW/EWq3Ot6XYafLf6Jd2kXQ3X7SPwu0zRNe1rX7rxR4abwxrHg7RNc0LXvBHi2y8VWd18QdWTRPB
U0PhhdHm1nUrLxNqLSWuk3ek2l9Fc3dpqGmgjVdOvrC3+0o+HHAtBUFDhfKpfV6H1eHt6DxLqUnQ
4rw1X608ROq8bUxVLjnjD69Xxjr18fV4jzavjalevip1D5upxhxPU9rzZ3j4+1q+2l7KqqKhNVci
rQ9gqMYLDQoz4Y4e+rU8P7KnhYZPgKeHhSp0IQGWP7Pnh+S6sZPGni3xx8S9P0XTdT0rw5o3jXU9
OnsNEt9X0ltCv7pTouk6Leanq8mkTXlhFq+r3V9e20V9dS27xXZhuYcLUP2YdB1rwfZfD/X/AIi/
E7WPBuiw2Nv4b0WfVfDkKaLHpcsUuls91b+F47vXJdMWFbfTh4il1W2s7cR+TarcW1pcW9PxT+1N
4W0lPByaLoHi3UL/AF74zaB8IPEej6l4M8Z6Tr/g6+1fw+vi03V/oUnh97+5mufD11pN/o8UQS21
Kz1SW/tru4XRNXtIfQfiR8Wk+H/jn4J+DG8P6vq4+LvjTWvCr6jpulaxqMOgx6V4O1zxCl3cvpmn
3dtB519Y2KTtqNxZQWuhpr2tvI1rol68HmVvCHw4xGHxGFr8L4WvSxmHxeEzF1sXmdWtm2DxtLBU
K2CznEzxssTnOBhRy3LqWFwWaVcZhcBTy/AwwNLDxwmHVPup+IHGFGrSrUs7r0p4erQr4RU8PgoU
8BiMNPE1aeJy6jHDKjl2JlUxmMnXxOBp4evip4vEyxNSs69Vztav8HdA1bxxqvj1Na8U6TqPiDwt
/wAIj4k0vSdRsotB8Q6bFY65YWE+q2V3pd5cPfaXHr1zNYS215awJcW1lJPbXCxzpcYU37P/AIag
0jwJZ+GvEfi/whrnw68Nx+EfDvjDQr7Sxr8vh6O3SEaVrsd9o93ouuWJkijvRbXek+XDfobm1FuZ
Jll0PC/x9+G/jHXtH0HQ73XJF8TzazbeDvEF74U8SaZ4S8a3fh6G9udbtfCXifUNMttI1uWxtNO1
C/ha2ufJ1jTLG+1XQJdV0yyu7uHV8c/GHwd4A1SDQ9VXxLq2uSaLceJrjRvCHhHxJ4w1LTfC9nci
zuvEeq23h3TdQbT9LS53wWv2gpe6vPb3kGiWepTWF7Hb+liPDfgfFTxtStw7gnWzDF4vH4ivTlia
GIhjsdmOBzjF43B16FenWy7GVs3y3BZrLFZfPC145nR+vwqRxdSrWqcVHjHiahHDQp5viVTwlChh
aVOcaNSlLC4XB4nL6GGxFKpSnTxmHp5fjMTgVQxca9J4Kp9VlB0IU6cecm/Z88GXfgnxb4M1DU/F
Goy+PNU0rWfGHi691O0ufF2uX+i6np+qacZ7+fTZbC3s7VtNgsbXTrTS4LKy0954rOG3uJnuT6Br
vgPR/EPjDwJ42vbjUY9W+HsniWTRYbWa2SwuT4q0caJqK6nDLaTTzrFahZbP7LdWbR3ADTNPETCf
M9f/AGnvg/4enuYpdZ13WYLDwHoHxR1TUvCvgvxf4s0jSfhx4li1e40zxrqeqeHtE1GytNDktNE1
C8aV5jcvaQvcW9rPHBdG3w/jb+0z4X+GHh74gtoqX/iDxR4L8LwavPJa+GPEut+DdH1fW7VJ/CGk
+LPEeh2rafpM/iLz7Se2tpNRt5Y7C8sb69lsLPUtOubrqw3AnB+DpKjhuH8vo00uH04wpyTnLhXP
8ZxVkFWrNzc62Iy/iTMMfnkMTVlPEV8zxmJxeKqV6tacpYVuKOIMRN1K2bYupNvNmnKatFZ5lWHy
PNYU4qKjTpYvJ8JhcslRpqNKlgsPRw9CFKnTgl9O0UUV9aeCfAH7XH/J0f8AwSw/7O/+Mf8A67t/
bar7/r4A/a4/5Oj/AOCWH/Z3/wAY/wD13b+21X3/AEAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAF
FFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUU
UUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAfAH7TH/J6n/BNf/sf/wBp3/1m
PxtX3/XwB+0x/wAnqf8ABNf/ALH/APad/wDWY/G1ff8AQAV8i2fwl+Pfhq/+L2n+BfG3w08P6F8V
fiJ4j8bx+JdR0DxPrnjDwmniPQtF0SY6XpcGraLod5q2mro0d7pc97emxjvJFe8tL23ia1m+uqKA
PgbxT+xbZ22oSH4fDwnd6ZqPww8C/C/b8Qn8Ty3fhGP4f6dqeiaX4t0uHwre6Vp3jC71HSNSjXWf
DXiC30q1u9W06HUo9dhtr6/0qTrl/Zbv7Lxvaa/pOvaPaaDpvxW+CnjrTtK+x3ST2+g/Cb4RX3wz
k0ceXmBLu+muYL2zZGNvBaRNFKxl2ivsuigD4v1H9kKz1u1+Puiap4tkj8O/E/RNZ8P/AA5tbbT/
ADJvhfY+MPEmqfEfxuYYTcWtrqcPiD4narFq89gn2M/2D4e0HRo9QtzCZoeXl/ZF1vVdC8bRXKfD
fwlrfiDT/h/oelDwsPGWs2sNl4V+IugePPEGpajq/iq+uNVDeJH0Cxt7Dw7aW5stAa0jMur63Lc3
F4v3xRQB8i/G39n3xb8S/Gp8S+HtV8JeHr59F0bR9C+INqviPw18UPhrLZXuoXGp32i6z4SurBvH
2m6hFeI1n4Q8X6lYaFpd79uuAbu31O/s5/YPip4G1/xTL4C8S+DrzRbTxl8M/GE3i3QYPEkeoNoG
sx6j4T8TeCdb0LVJ9MZr3TY77RPFd7PZ6xbWepS6bqllYTNpt/aG6s5/Wq5rX/FuheGL3wnp+s3b
2t1428S/8Il4dRLa5uFvNdPh/X/Ey2kj28Ui2iNpHhnV5xc3RithJBHA0olnhVwDwM/C/wCM9j4o
0P4qW3jDwR4i+Iy+HPF/g7xBo2u6Rf6R4Lg8M+JfE+neJtAs/DeoaJBLr6TeA5NNj07z9Ytr2bxz
bXV3Pfz+GroWLWOf8LP2arr4Z67Dfx+J7XVbT/hSTfDe9lNhNaXV54q1T4g+MPiD4i8RRWn2i5hs
tHu9U8XXQ07Sftt1c2MCJbSXlyIxcSem658ePh5olxBp63Ova7rd14p8ReDrPw74Z8K+Ide1681v
wjaW+oeKFttNsdPklksNCsbq3ub7VMjTj59vbWtzcX11a2s1fVf2gvhtp1poN1az+KPETeIvCw8c
2mn+FfAvjHxBrNj4MEqQS+JNd0aw0STU/D9pFcM9qtjrFrZa3d3trqFhp+lXl9pmo21qAeDXn7J/
iO+8K6l4Ol8V+Hhpes/Av4AeALu5k03VZ7m38efs9a/d+IfDeqxwwXtgLrwfrt3fSRa3YfabHW1g
hjWwvraSVpY9DQP2YNYtodQvbmP4f+FtSu/iL8CvE0Gm+FB4q1m1i0D4O/EC28bXlveeJfFF02s6
hqPiJ5dSWzsk06w0jQH+ywodQluNQ1Sb1i5/aa+D1tqepaemvatf2uieB7L4k694j0jwj4r1jwho
XgjVPDOpeLtH17VvFWm6NdaHaQa3omlXc2h2zXrX+tXQj0/TLS6vpBbjv/BHxH0Lx4+r22m2HinR
9R0P+z31HSvFvhTXvCuox2mrpdSaRfwwa1Y2q3dnqMVlcvFJayTSWskEtpqMVlfxS2qAHiPjv4Ce
Ktd8Q6z4u8OeIfD9trX/AAvf4e/GXQbLW7LUZdLaLwb8MNL+HN5omry2Msd3HJfLFqWpW1zZJKsT
LYwyowknaL1P4keBNd8U+JPhB4o8PahpNne/DT4gXHiW8tdZgvJbXVNC1rwV4r8D65aWz2LpLb6t
Dp/imS+0mWXfZm8tEjvEMEjEes0UAfJvgL4F+PtAHwa8I+JvEXhHUvh58AdTudT8F3el2GrW/jHx
S1n4O8SeA/CEHieB5IdF0Y+H/D/iq/l1W40ubVf+En1iy0+8FvoVq95YTN+Nf7POp+PviBF8RvD8
PgzVtSuPAVr4CvNH8dXXi/T9O08aVreta3oXiXTLvwbf2t3eT2U3iXW4tT8P38cdvrMP9nJba1oU
lvPPc/WlFAHyla/s43ml+Gvit4Z0zXNHjtfHf7OXgP4H6O8WkyaZbabqPg7QPibok+tz6bbTXMNt
pl8/jmxuoNOs55pLNbS7tt8gEEsmL4//AGf/AIlarY/F7w54I8V+DbLw58btD0GHxPdeI9L1efWt
A1vQfBWi+BLl9Di0+b7FqGl+JNB8N6LbyLfyWd14cvP7Q1O3Ou/aINOtvseigAooooA+AP2uP+To
/wDglh/2d/8AGP8A9d2/ttV9/wBfAH7XH/J0f/BLD/s7/wCMf/ru39tqvv8AoAKKKKACiiigAooo
oAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiig
AooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooA+AP2mP
+T1P+Ca//Y//ALTv/rMfjavv+vgD9pj/AJPU/wCCa/8A2P8A+07/AOsx+Nq+/wCgAooooAKKKKAC
iiigArx/4weBPEvjK38Bat4N1DQrPxR8NviBZ+PtHtPE0GoPoGuSReGPFfhC90XUrvSn/tHSkuNL
8X391a6ra2mqNaahZ2nnaXe28k0dewUUAfE2p/s2+N9Y8MS2fief4XePtT1H4p+N/iPq+kazpWv+
HNLjk8WRWh0pvCXjDRnvvGngnWvB81qLa01XSWln17TZZ4dRltriZJ4MHU/2TPGbx+ENZuvE3hn4
m+MdN+GUHw61+/8AiVe+O7WDzNO8TeI/Evh7xBpup+HtYk13Vv8AhHx4s1XRLjTPEVxNeeJdNsdH
nufEWkakl9d3f3vRQB8reDf2db/wZa/FjTtP1zw01p47+Efw1+Gmhi48I219pGm3fgPwZ4l8Lz6l
rPg68uJNH1PQ9SudbhvJPC5vHtZ7GO60q5uvKlEx1/gH8Gtd+FF54tmup9D0Hw7rdn4dtNE+Gvg3
WvGOteCvDl7o0uvSav4k0keMrqWTQrrxUmq6bb3Phzw7p+laJplvoNn5kuuX0z6hH9JUUAFFFFAB
RRRQAUUUUAFFFFAHwB+1x/ydH/wSw/7O/wDjH/67t/bar7/r4A/a4/5Oj/4JYf8AZ3/xj/8AXdv7
bVff9ABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQA
UUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABR
RRQAUUUUAFFFFAHwB+0x/wAnqf8ABNf/ALH/APad/wDWY/G1ff8AXwB+0x/yep/wTX/7H/8Aad/9
Zj8bV9/0AFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFAHwB+1x/wAnR/8A
BLD/ALO/+Mf/AK7t/bar7/r4A/a4/wCTo/8Aglh/2d/8Y/8A13b+21X3/QAUUUUAFFFFABRRRQAU
UUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRR
RQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQB/KN/wdb/t
e/tEfsL/AAI/Yp/aN/ZY+IX/AAq34zeHP2k/GHhvRvGX/CJ+BvG/2PRfF/wR8daX4isv+Ee+Ivhn
xd4VuP7QsVEH2i60Oe7tMebYz202ZK/i+/4ijv8Aguv/ANHzf+azfsef/Q+0UUAH/EUd/wAF1/8A
o+b/AM1m/Y8/+h9o/wCIo7/guv8A9Hzf+azfsef/AEPtFFAB/wARR3/Bdf8A6Pm/81m/Y8/+h9o/
4ijv+C6//R83/ms37Hn/AND7RRQAf8RR3/Bdf/o+b/zWb9jz/wCh9o/4ijv+C6//AEfN/wCazfse
f/Q+0UUAH/EUd/wXX/6Pm/8ANZv2PP8A6H2j/iKO/wCC6/8A0fN/5rN+x5/9D7RRQAf8RR3/AAXX
/wCj5v8AzWb9jz/6H2j/AIijv+C6/wD0fN/5rN+x5/8AQ+0UUAH/ABFHf8F1/wDo+b/zWb9jz/6H
2j/iKO/4Lr/9Hzf+azfsef8A0PtFFAB/xFHf8F1/+j5v/NZv2PP/AKH2j/iKO/4Lr/8AR83/AJrN
+x5/9D7RRQAf8RR3/Bdf/o+b/wA1m/Y8/wDofaP+Io7/AILr/wDR83/ms37Hn/0PtFFAB/xFHf8A
Bdf/AKPm/wDNZv2PP/ofaP8AiKO/4Lr/APR83/ms37Hn/wBD7RRQAf8AEUd/wXX/AOj5v/NZv2PP
/ofaP+Io7/guv/0fN/5rN+x5/wDQ+0UUAfrH/wAEJ/8AgsT/AMFG/wDgox/wV3/Yx+En7ZX7RX/C
4/h94IvP2gvib4X8P/8ACo/gV8Pf7M8b2X7K/wAbvCVtrf8Aavwr+GPgfW73yvD3i7xDp/8AZuoa
ld6Q/wDaH2uSwe+tLG5tv9JeiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigA
ooooAKKKKACiiigAooooAKKKKACiiigD/9mgRh3wda4AALw6Ao1pc+wKIQHAzQNCOzT//9j/4AAQ
SkZJRgABAQEAYABgAAD/2wBDAAgGBgcGBQgHBwcJCQgKDBQNDAsLDBkSEw8UHRofHh0aHBwgJC4n
ICIsIxwcKDcpLDAxNDQ0Hyc5PTgyPC4zNDL/2wBDAQkJCQwLDBgNDRgyIRwhMjIyMjIyMjIyMjIy
MjIyMjIyMjIyMjIyMjIyMjIyMjIyMjIyMjIyMjIyMjIyMjIyMjL/wAARCAHJA0cDASIAAhEBAxEB
/8QAHwAAAQUBAQEBAQEAAAAAAAAAAAECAwQFBgcICQoL/8QAtRAAAgEDAwIEAwUFBAQAAAF9AQID
AAQRBRIhMUEGE1FhByJxFDKBkaEII0KxwRVS0fAkM2JyggkKFhcYGRolJicoKSo0NTY3ODk6Q0RF
RkdISUpTVFVWV1hZWmNkZWZnaGlqc3R1dnd4eXqDhIWGh4iJipKTlJWWl5iZmqKjpKWmp6ipqrKz
tLW2t7i5usLDxMXGx8jJytLT1NXW19jZ2uHi4+Tl5ufo6erx8vP09fb3+Pn6/8QAHwEAAwEBAQEB
AQEBAQAAAAAAAAECAwQFBgcICQoL/8QAtREAAgECBAQDBAcFBAQAAQJ3AAECAxEEBSExBhJBUQdh
cRMiMoEIFEKRobHBCSMzUvAVYnLRChYkNOEl8RcYGRomJygpKjU2Nzg5OkNERUZHSElKU1RVVldY
WVpjZGVmZ2hpanN0dXZ3eHl6goOEhYaHiImKkpOUlZaXmJmaoqOkpaanqKmqsrO0tba3uLm6wsPE
xcbHyMnK0tPU1dbX2Nna4uPk5ebn6Onq8vP09fb3+Pn6/9oADAMBAAIRAxEAPwD3+iiigDnL6812
58UT6Xpd3p1rDBZQ3DNdWTzs7O8q4G2VMACMevWn/Y/GH/Qd0P8A8E03/wAlUW3/ACUPU/8AsFWn
/o25roKAOVuJfE1pKIpvEOiByu4KNDnbj8LmltpPE127JD4i0JnUZKnRJ1OPXBua0LuWeHxErW9t
9oY2mCu8Lgb+vNL5d5NeG/ngW28iB1Rd4dmJ5yccYGK8/wCtVPaNJXSdtnt35tv6sdfsYcqb6ruv
y3K/2Pxh/wBB3Q//AATTf/JVH2Pxh/0HdD/8E03/AMlUsc16mm21ybtnnvDHGNwG2Pd3Ax1xVmV5
tMu4M3Ms8MwZWWUgkEKSCCAPSrjjU1zOLS07aX26kPDtO11fX8NyjcR+K7WBpptf0NY16n+xZjj8
rqpPsfjD/oO6H/4Jpv8A5KqO9jurjw815JduWlRXaPjZtJBwPpxzmtaCeV9Zu4GfMaRxlVx0Jzmi
ni3KoouNk7W+fM+/kOVC0Lp3avf5W/zM37H4w/6Duh/+Cab/AOSqbJB4shjaSTX9BRFGWY6PLgD/
AMCqlivbq48q2ExV5rqVDIAMqi54HvRq1rcw6TfBrt5IPL3LvxuB7gnHI/WlLG3pynCLdl5dr9xr
DWmoye/+diAR+KzOIBr+h+YU3gf2LN93OM5+1VJ9j8Yf9B3Q/wDwTTf/ACVVg3M1ndNH5rSxx2LT
YfHLBvYenFMla7tdLTUTeSPKFV3jIGwgkZAHbr1zT+uJJtp6Xb8kvnqL6ve1nvsRfY/GH/Qd0P8A
8E03/wAlUfY/GH/Qd0P/AME03/yVVrFzeanfQfbJYYodmwRgA5K+pHT296s6TcSXWlwzTHMhyCcY
zgkf0rWniFOfJZrf8HZ/iROi4x5r9vxV0YkbeJ5buS1TxDoRnjGXT+xZuB/4E+4pZz4ntp4YZfEO
hLJMcRr/AGLMcn/wK96k/wBRrlzeDolyscn+66Ac/Q4p96PP1GK6PRb2OBPouS36n9K5PrtTkeiu
pW+V9/wt6m/1aPMtdLfjbb+ugfY/GH/Qd0P/AME03/yVR9j8Yf8AQd0P/wAE03/yVViBbvUIJbsX
kkJ3sIo027QFJA3cc9KZBd3GqS2sYma3VrbzpDFjLHOMAnoOCa3+uJ29167ba/5fMy+rvXVab+RW
jj8Vyyyxpr+hF4iA4/sWbgkZ/wCfqpPsfjD/AKDuh/8Agmm/+Sqi8+405tQAdpJpLmONZNuTyo5w
Opx+tW7We4S/hRPt0kEgIk+0RY2HHBBwPpWdPHJtRktb29NWl/wSp4VpXT0/4F/+GIfsfjD/AKDu
h/8Agmm/+Sqq3t14n0h7Ka71LSLq3lvILeSOLTZYnxI4XIYzsARnP3TXVVz/AIu/48dN/wCwrZ/+
jlr0DlOgooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAoooo
AKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigA
ooooAKw7jxfottdzWzz3DywP5cnk2c0oVu43KhGefWtyuf8ACv8AzG/+wrP/AOy0AH/CaaJ/fvv/
AAW3P/xuj/hNNE/v33/gtuf/AI3XQUUAc/8A8Jpon9++/wDBbc//ABuj/hNNE/v33/gtuf8A43Wn
f3z2j28cVv50kzFVXeF6DNRrqU0c8cd5ZNbrK21HDh13ehx0rCWJpxk4t7eTt99rGqoza5l+a/Lc
of8ACaaJ/fvv/Bbc/wDxuj/hNNE/v33/AILbn/43W+SBjJAz0qvNdiG8trfZkz7vmz02jNaynGKu
/L8dDOMXLRGR/wAJpon9++/8Ftz/APG6P+E00T+/ff8Agtuf/jdbkDySQq0sXlOc5TcGxz6ipKad
1cGrOxz/APwmmif377/wW3P/AMbo/wCE00T+/ff+C25/+N1vghuhB+lGRnGRn0piMD/hNNE/v33/
AILbn/43R/wmmif377/wW3P/AMbroKKAOf8A+E00T+/ff+C25/8AjdH/AAmmif377/wW3P8A8brf
3LjO4Y9c0uRjOeKLgc//AMJpon9++/8ABbc//G6P+E00T+/ff+C25/8Ajdb4IIyCCPaq93eLa+T8
u/zJli4PTPeplOMFzSehUYuTsjI/4TTRP799/wCC25/+N0f8Jpon9++/8Ftz/wDG63yQCASAT0pa
ok5//hNNE/v33/gtuf8A43R/wmmif377/wAFtz/8broKKAMjT/E2lapeiztZpvtBjaQRzW0sRZQQ
CRvUZwWXp6iteufvv+R+0T/sH33/AKHbV0FABRRRQAUUUUAc/bf8lD1P/sFWn/o25roK5+2/5KHq
f/YKtP8A0bc10FAFf7Iv9o/bNx3eV5W3tjOc1NInmRPGTgMpGfrTqq314bRIhHEZZpn8uOPdjJwS
ST2AAJqVCKul1Kcm7eQw6bE2mR2Rd8RqoSQHDAjoR70kOnv9pWe6unuXQERgqFVc9TgdTRFezRmU
ahClusab/NSQtGR9SBgj0p39q2PkPMblFjRgrFsrtJ6ZB55zWf1endO21vw29bdLle2nZq+/6lV9
FL27WgvJRafwxbR8vOcZ6ke1WJ9Pd7s3NvdPBI6hJMKGDAdOvQ81Hca3Zw28c6v5iNOsBwCCpPqO
vTmrK6haPdG2WdTLkrj1I6gHoSO461KwlJbL8X02trpu9ivb1H1/IrLo8cdssUc0iukpljl4LKT/
ADoOkiWK4F1cPNLPH5ZkwF2r6AD35qWLWNPnOIrpG+UsMZ5A649cegpkerQPon9qEFYvL8wjuPaj
6pR25dPw7bege3qdx0emgTCSeYzHyDA25QNwJz2/KoRo7GNLeW9lks0IIhIHIHQFupFMh1oyW0Ur
RRFnaEbUkJ2+Y5XnKjpj8efrV5dQtHujbLOplyVx6kdQD0JHcdaHhaT3X4v8e/zEq9Rdf6/QWG0W
G8ubgMSZ9uR6bRiixtFsrNLdWLBM8n3JP9aS31C1upTHBOruATgdxnGR6jPcVFeaklo82ULLBAZp
SD0HO0fU4P5VpGlCLul3/F3f4kucmrN9vw0QPpkUi3ysxIu8Fv8AZIGOPyzQNMQWtpAJGxbyLJuP
ViM5z9STQNYshBDJJMsfmoJMHPyg9z6DPGTxT31SxjuTbvcoJQQrL/dJxjJ7ZyMVH1ale/L/AFe/
5j9tPa/9Wt+RA2lOGkWC8khglYs8SqDyeu0npT5dMUeS1pK1tJCnlqygMCvoQetP/tKBFlaaRFCT
GIBSWLHGcYxnPsM0Nq1gojJuo8SKGBHIwTjJPYZ45pfVaXb8X+Hb5WH7eff+vPv8yFdHi8q4WWaS
Rp3WQucBlYdx6VLBYyrcLNc3jzsmQg2hAM+oHU1doprDUotNLbzfe+vfXuDrTe7Cuf8AF3/Hjpv/
AGFbP/0ctdBXP+Lv+PHTf+wrZ/8Ao5a3MjoKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiii
gAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKA
CiiigAooooAKKKKACiiigAooooAKKKKACuf8K/8AMb/7Cs//ALLXQVz/AIV/5jf/AGFZ/wD2WgDo
KKKKAMzUf+Qnpf8A11f/ANANN18h7OK2Ujz5pkEY75BBzV26sba9VRcR7whyvJGPypltpllaSeZB
bor9Nx5P5muGpQqSc4q3LPrfVaJPS3l3OmFWEeWWt4/537/oZAinvL++Z7S2uSkhjHnSkFFxxgYO
M9c0618wTaKJZUlYGYB0bcCMcc9/Sta4020upfMlhBcjBYMVJHvg81ILS3VoSsSgwAiPHAXIwayj
gpqV2+t/X3k+3l3fyNHiYuNrdP0a7/5GFa/uNI0+/Gf3EjCT/cZyD+XBpLp5ZLOa8Q4F1crECW2j
ygcDnsCf51urZ262htREPIIIKex6/wA6d9lg+yi28pTAF27CMjFL6jPkUOb7P/k1rX9LB9ajzc1u
v4Xv+ZkQW01vqlqRBaWgIZWSKUkyDHpgZxwc1Dp2lQXWhGQJ/pMquBITyCGOPwyBWxb6daWsnmQw
4fGNxYsQPQZPFOEX2OzKWkAbZkrHuxnJz1NOGCS1qJNa6b78u2i7PZdQliXtB66fhfzffuZ1ncf2
reW0pHy28W9x/wBNW4x+GD+dS62iyJZI3KtdopGeoIOan020a1gkaRUWaaRpZAnQEnp+FWZYI5/L
8xd3luHX2YdDWsKE54dqfxS1f4foiJVYxq3jsv6/Mxo9OtDrs9v5CeQIEfysfJuyRnHTOKggRJBY
WcpJtjPOuwnhtpO0H/CugEEQuGuAn71lCFvUDtUT2FrJbmB4VMZYvjn7xOcg9jms3gbfCl1+aunb
00t/mUsV3v0/Jq/4mRef6Bc3yWP7sGzMjJH0Vt2MgdjjP5U67sbK3j02S3RVb7REA69XBOefX1rW
t7K2tUdYYgof7xOSW+pPJqKPSLCJ1dLcAqQy/MflIOeBnipeCm76LX/yXW+mn+Q1iYrq9Px066/5
mRHDNePfSSWltMfOdS8spVkA6AcHHHNbOmGQ6bbmWVZX28upyG9896J9LsrmUySwAu3DEMRu+uDz
+NWlVUUKoCqBgADAArbDYWdKblJ/8HW+ui/NmdatGcUkv6+//IWiiiu45jn77/kftE/7B99/6HbV
0Fc/ff8AI/aJ/wBg++/9Dtq6CgAooooAKKKKAOftv+Sh6n/2CrT/ANG3NdBXP23/ACUPU/8AsFWn
/o25roKACqWoW0032ea2Kefby+YqucBhgqQT24J5xU1zeW9mqtPIE3HCjBJJ9gOahGr6ezwqt1Gx
n/1QXnfzt4/HigCpPbanqEEvnCCAfIYoN28FlcNlmx3wBxTZdPvLy4a5lSOJi9viMPu+WOQsSTjr
ycfSr0eqWUrsiXCkhS3fBA6kHoce1QS65ZiwuLm3lSfyYjMFB27lHcEjp7jNAEV5ptzJJNLF5bMb
uK4RWYjIVVBBODjoar2uizw3EKPloop2m8w3LkHkkYToG557deua0m1a1aCWSCaNzGV3BmKgbjgH
OOnp61L/AGhafavs3nr52du33xnGemcdutAFGx0ua2tdLjcx7rVmMmD6qw4/EinW9hcr4bbT5BGJ
hbtCpViVPy4B6DFXLbULW7cpBOrsBuwO49R6j3HFF7dfY4FmKbl8xEbnG0MwGfwzmgDNbSbgyBsx
4AtO5/5ZuS3b0PFRWuizw3EKPloop2m8w3LkHkkYToG557deuavDWIxqN1bSRlI4EL+buyG2hSwx
7B1qIatczSQwwWsInaBJ2SafZ97Pyr8pyRg5PFADdN068tLxD8sNuqMrxLKXRicYKAjKDrxn/Glu
LUvf6jBuwb60Cxs3TKhlI/8AHlP5+lTNqNy81tDBZr5s0LTMs8pj2YKgjhTz81MXWT+7jktik/2o
W0ke/OwldwYHHIxj0oArpYahFHMFhgZrm3SFgZTiMqCM/d5GDn6/nVaOwun/ALT06JY2hcxRNO7E
MAIkBOMc8dOetb9zdwWiqZ5Nu44UYJJ+gHNSRSxzxLLE6vG4yrKcgigDHXTLqC9a8jEcjC5kkEe/
GUdVHXHUFf51Hc6bqEp82NIY7lkwJIJWQK2WOGXBDqMjtnOfXjQvNVj0+42XSFIWTdHKDnew6pj1
9PXmoZNYeC90+2uLXy2ulJY+ZnyjwADxzkkD6+tAF+KSRppo3iKrHtCyf38jJ4//AF1NWRc64IJ7
+NbfeLOHzC2/G44BK9Pcc1r0AFc/4u/48dN/7Ctn/wCjlroK5/xd/wAeOm/9hWz/APRy0AdBRRRQ
AUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFAB
RRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAVz/AIV/
5jf/AGFZ/wD2Wugrn/Cv/Mb/AOwrP/7LQB0FFFFAGdfalPZTxILIyJLII0cSgZYgnp26Gp0voQyR
XEkUFy4z5BlBbv8An0qPUraW4exMS5EV0sj84woDDP6iopbOY3mpTxxRs0tqkcRcAgsN+QfbkUAW
o9RsZVkaO8t3WMbnKyAhR6n0FKl/ZyRySJdwMkX+sYSAhPqc8Vz8mmahcR3G6GX57F4F85487iV4
ATgLwcVo32nvNNclLcPG1vEiqH2HKux4PYjII7ZoAkvNctLeGB4ZoJ2nk8uMecqgnGTk+39R61cS
9tZLlrdLmFp16xhwWH4Vk29lfNLA8qNsS7EoMpTzdvlFSWK8E5IA74pLWwu0WwtXg2C0mMjXAcES
DDdBnOTu5zjv1oA0v7W03YX/ALQtdo6nzl/xqWK9tZ5TFDcwySBQ5VHBOD347dPzrKstMngOi74l
H2WF1lwR8rED8+c1BBo92tnp0G0RNHbzxyMCPkZwMHjrQBuQ3tpcs6wXMMpT7wRwdv1xUVvqVtdX
Zgt5UmAj3l43DDrjHFYkWjXs1uYZfPjZLN7dWlkQrlgBhQozt474PTitO0juH1U3Utl9mQW4iwXU
kkNnsenp/SgBf7aifUprOLyn8korsZlB3MQMAd8Z/Pipo9VtTai4nljt0aR4x5rgZKsV/pmqM+nX
L3t3IqDbJdW0incOVTbu/kar/wBl30LwTL5+U89SkDoGG+QsD83GCMZ79KANuS/s4WjWW6gRpACg
aQAsD6etSyyxwRmSaRI416s7AAfia5x9KvILaKO3hl837OIyRKjITljtkVgAVG7gqM9fatjU47mS
1j+zoHdZVZsBSwA6lN3G760ASf2nYCATm9txETtDmUYJ9M560/7bam4FuLmHzjyI943HjPT6VjWm
m3Qu4pZ4mKretOTI6s23ydoJxxnPpSDSrsXjIwnaJrz7RvEiCMDdu9N+4dMdPcCgDoaKKKAOfvv+
R+0T/sH33/odtXQVz99/yP2if9g++/8AQ7augoAKKKKACiiigDn7b/koep/9gq0/9G3NdBXP23/J
Q9T/AOwVaf8Ao25rauLqC0RWmfaGO1Rgkk+gA5NAFDVZRaXtnd74FKrJHidyikNtP38EA/KOD15q
rolncb7e9cIoMEq4APVpdwIB7YrUk1Syihjla4TZICyEc5A6njsO57VAutWn2ua3kkRPLdVVt2Qw
ZVIPsPmx70AZn9m38aJNcYPk28qyEzltxKYyq4AUcdPf2psem3uo6PbBkii2WDRR4kJ3l1XGeOBx
+f0rebULRLr7M06iXIXHoT0BPQE+nWom1jT1laNrpA6sykc/eHVfrx060AVtT0ye8e4MRQCSKFF3
HHKyFj+hp0NpeQSvAsdu0D3DTea5JOGJONuOuTjOen5VaOqWQgjm88FJM7MAknHXgc8d/Skk1Wxj
jjka5TZIu9WHI2+vHQe5oAzrO0vtO3yiLEUUDf6OszSK7jGNmRlRweOeo44rVvLb7bp81s3ymWMr
67SR/SrAIIBByD0IqnJqMME06zMEjiCZcnqzZ+XHr0/OgDMl0S5n0y3jd4xcmV2uWBOCsmd4HHoR
j6CrOo2dxPO26ytL62IASOYhDEe+DtPB496mh1e1kimlZwscc3kqc5LnaDwMZzz068VK2p2SQRzG
4UpISE25JJHXgc8d/SgDPhsL+yeyeMR3LRW7xPvlK4LMpGDg5Axjmmy6XesRd7YWumu1uHjDkKFV
SoUNjk4747mtNb6NrqGJSrRzxGSKRTkNjqPyII/H0oudRtLN9k8wRsbiME4HqcdB7mgCneW95eRw
u9rGssbNjy7lldQR1VwB+IIqxYfa7eK2tbkCVxExeZegIIwvQZ4PXj7vSnS6rYwztBJcosikBgf4
c9M+nUc0y91a2s28veHm3ovlg9NxA5PY4Oce1AEd/psmpXBE0pjgiGYPLY7vM/vn6dh9agudNvb1
Y3naJZ1tnj3ITgS70ZWHHTKZrTuby3s1Q3Eqxh22rnqxxnA9TxUcGqWVzKsUNyju4yoHf1H19utA
GZLo1y9ncKDF509q6NyceazFj26ZOK1baS7dm+020UQA4KTF8/8Ajopi6tYuzhblPlVnJ5wVHUg9
CB7URarYzJI6XKFY03sTwNv97nqPegC5XP8Ai7/jx03/ALCtn/6OWtm2vILsMYJA204YYII+oPNY
3i7/AI8dN/7Ctn/6OWgDoKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACi
iigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKK
KACiiigAooooAKKKKACuf8K/8xv/ALCs/wD7LXQVz/hX/mN/9hWf/wBloA6CiiigBu9Q4QsNxGQu
eaihu4J4nlSQFEdkZjwAQcH9axbm0lXWzNFbs5eeNiJIgykAKCwcYK4GeDnp05qGGx+zXCmXTWa2
juLgsixggl2yjhR1AXI9s0AdMXUYywGemT1oDqWKhgWHUZ5FYFjpRN7ZyXNoPKijnaNXAPlbpFKL
9Qv5YqnZ6ZeqYowJY7pEl3zeUqjcVIyX6tkkH9eMUAdN9pj+1Jbg5dkZ+Og2lQc+/wAwp4lBmeMq
w2hTuPQ5zwPy/UVi6XbCPULV0097by7RopWKBQX3Jxx16Mc96TUrCW5vbjMBeGRrTPowWRi35A80
AbqsrDKkEHuDVMaraGWJFcnzJJIw2OAUzuz+VN0+1+y3N+EiEULzKyBRgH5FBIH1FZFvpf8AptvG
9gBDHeXEj5jGwht2w+/agDpGdFXczKF9SeKdXMzafOi237lhbxSXICLCJNu6QlDtPbbxntn3q/FZ
3Q8MPaoXW4aF1QOQCuc4HHTGQPagDQW7ie6+zqdz7N+RyMZx+dE95Db2/nM25N6p8nPLMFH6mufn
sZLgXX9n2D2ga0EeCgTcQ2SuPpxnv60JYTtHcPHFKFZ7cbTCsQJWQEnaPQd+/wCFAHSRSiVc7WU5
I2t14JGf0pS6AqCygt93J6/SueayvobOKW1iIuWknhbpwkkjEP8Agdp+hNQ3+lTLcTxJHI8LQJFb
bIlcqAMbdx+5zzn39qAOnLoG2lhn0z/n1p2ecd6wW0cTvqryIouHKeTcsoyCsa4YHt8wq3om+e1f
UJk2y3jeZt/uoBhR+Qz+JoA06KKKAOfvv+R+0T/sH33/AKHbV0Fc/ff8j9on/YPvv/Q7augoAKKK
KACiiigDn7b/AJKHqf8A2CrT/wBG3NaGq2kl0kJjjDtG5bIlMbrwRlWHQ89DwRWfbf8AJQ9T/wCw
Vaf+jbmugoAxIbHUbV4rn91cz+Q0Lq77QPmJU5C88HB4GcZp39lXBtb5GMPmXDRkFQQvyogPHYZU
4FX59Ss7abypp1V+M5zhc9MnoM+9I2qWKzTQtcxiSEZkBP3BgHn06igDKbRZ/tcwwZIZbkT7jcuq
qMgkFBwSCOPw9KtJpky+Rny/kv5Lluf4W34/H5hV+2u4LsMYJA204YYII+oPNM/tGzNw0AnXzFyC
OeoGSAehIHbrQBmtpt8hXZhozLO7Kkxjb533L8wGcY6ge3WoP7Hvo7G3jVI/tCQtH5sU7IQdxIzw
dy+xFaNtrlnPYQ3bP5ay52oQS3HXgfr6VOdTshPFD9pjMkqh4wDncp6Ee3FADrZ59xhnTJjRMyjg
SMRzgY4/+vVKWwuWQTqEa4S8NxsZsBgAUAz2OzH41ch1KzuC/lXCNsXeTnA2/wB4E9R7jio7bVYL
y9MEBDqIvM38jvjoR+OaAKKadepOLwxQGVbp5vJV+CrRheuPvcfzpYdOvbW6F6qRSSu0peHzCAoc
qRtOO2wZ47mr8mpW8Dyi4ljjVJBGDuySSobBGOD7c/0qe3uYbuESwSB0yRkdiOoPoaAM/wAqV9Q0
6JliD26NLN5S4VcgqAPqS3/fJqHVdPvrya5WMgxSw7I/3xjCnBzuwMt14HStGLUrOefyYp1aQ5wO
cNjrg9Dj2qLUL26syjRW0MsbukYLTlTuZgo42njkd6AKr6VcPDqq5jDXcaKnJ4IQLzx602bTrzdc
wxJE8M90lx5jSEFQChIxjn7vHNWnvb1bmG1W0tzO8byNm4YKApA4OzJ+8Owp099NZwRzXdvGsZfb
K0cpYRg9G5UZGevp70ASXVs895Yyrt2wSs7Z9CjLx+JFVINNniFlkx5huZpW57P5mP8A0IVMl/cX
Fs1xa20bxbj5bSylN6gfeGFPfp6jmqVxr1za6PFqUtjGY5fLKJHOS2GGecqOQPrQBTuNMv0s2lnw
fJtZkkPnltxKEZVcAKOOnv7Vaisbu9tImmgtlVLIwojOSshYKecAED5R78+1X7jVEhv7G2RPMF1k
7w3CDGQffPP5VYsbr7Zbeds2fvHTGc/dYrn9M0AVtLtrq3aczs3lNt8tHl81lxnPzEZI6YBz0qh4
u/48dN/7Ctn/AOjlroK5/wAXf8eOm/8AYVs//Ry0AdBRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABR
RRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFF
FABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAVz/hX/mN/wDYVn/9lroK5/wr/wAxv/sKz/8A
stAHQUUUUAFQTXcUMsUbHLyvsAHY4J5/I1PXNwWUqT2iNZt9rjupJJbnYMFSHwd3fOV47Y+lAHRh
1ZioYEr1APSkEiEsA6nacHB6Gubt7GcxWcVvava3cMLrPOygBmKEfe/iy+G/CkksjLphhttKeKaO
BBIxAXcyup2gdG6E5/xNAHTFgOpApBLG23a6ncMrg9R7Vzt3bzajeNIbKUQNNbcSrjcqsxYkenPQ
0LpbxyNJHaBXGpq6sqgERcZx6DlvzNAHRb1LlAw3AZK55pDLGAx3r8o3HnoPWuas9Ou0v4RKsnnJ
cvK8iwqAVJJzv6kEEDHX8qmsdI8m10xfsio/2d0uPlHJZRw3rzQBsm+g/sw6gCWgEPnZA5K4z09a
nSRJF3KwI789Kx4baQeDTaJbtHMLJovK24O/aQfzP86pSWkjRyNa6Y0SC2WKSJ0x5jb1PQEbtoDd
+c4oA6VZEZC6upUdSDxQZEEfmF12Yzuzxj61y62Erpf7rafypGgdCsSJkqTltnQ44yp5P5UGyvGt
7Zmh2wRXEjEJbjLAqMOYiTg53cD1zigDqgcjI6U0SId2HU7fvc9PrWZYWlxFoUsCM8cziQxbgFKb
idvA6dc47dKzHsZJLQra2D27R2E0MwKAeY5UBVB/i5BOf8aAOjljguonhlVJYzw6Ngj8RUgAVQAA
AOAB2rMs7BbTUlaG3WKI2oVigwCwbv6mtSgAooooA5++/wCR+0T/ALB99/6HbV0Fc/ff8j9on/YP
vv8A0O2roKACiiigAooooA5+2/5KHqf/AGCrT/0bc10Fc/bf8lD1P/sFWn/o25roKAMDVtMv717t
I9pSUDyz55RVwBkMoHzHOeuR09KsXGlTT2mpRBlVri4WaM7iOFCcEjkcqenrV6/vFsLGW6ZSwjHQ
HHU469hz1qK1vLhmIuoYkj2eYs0Mu+PHcEkDB70ARaXZS289xPMhVpAqANcNK2Fz1J47nGKhTTry
PVBLFthi85pJNspKSKc/wEcNyMkEd/XFXBq9gYZJvtKCOMAsWyMAnAPPY+vSnx6lZywyzJOpjiXc
5ORtHPJz9DQBl2OnX+ni2cRQyvDE0BXzSMgsGDA449xT7PRJYY5YpJVxJZiAuvVWLOTj2G8Y+laT
ahaLdC2adRLkLj0J6AnoCfTrS29/a3ckkdvMsjREq4X+E5xj9KAMSPQriS3aGUbCLV4FkNy8nLAD
Kg8BeOn09K0rWC8fUjd3MUMQ8gRbUcsSd2c9BxTptXto7mO3R1klaYREA42k9ecYJHpU0eoWktz9
nSdWlyRj1I6gHoSO4HSgCk+mzNqRuMps+2LPyedoh2fnmrllbPb/AGjeV/eTtIMehpg1awZZGF0m
2NdzHtjOMj1GeMipp722tg5mmVBGFZyx+6GJAJ+pBoAx7TTL9b6ymuNp8gv5jeeSGypAKpgBRz9a
1NQtnuoYkjK5SeKQ5PZXBP6CmJrGnyOqLcqWZ9gXBBDdgfTPbPWpRqFobr7MJ183dtx/tdcZ6Z9u
tAFLU9Pe51C3uPsVrdxpE6FJ2xgkqQR8p9DQ1jPPaR2f2aCztWY+dHC+cp/dGAPvHOfb61Zj1ewl
cqlyjEBjwDzjrj1Ix0psWqJNoh1ONCVELS7CcHgE4z+FABY2s9rbS2jsHhT5bdyfm2EcBvp0z3GK
gbTJm0nTLU7C9s0JkyeCExnFWbXVbO6gMizIu2MSOCcbVxycnqPfpSpqtk8ckguFCx437gVIzwOD
69vWgDPs9GuIGgMkiOYJwEOTxAquEHTr83NWNOiv7Rfs720Ji82RvNExzhnZh8u339atf2lZ/Z/P
89dm7Z0O7d/d29c+2M1NDPFcxLLC6ujdGFAElc/4u/48dN/7Ctn/AOjlroK5/wAXf8eOm/8AYVs/
/Ry0AdBRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQA
UUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABR
RRQAVz/hX/mN/wDYVn/9lroK5/wr/wAxv/sKz/8AstAHQUUUUAFNdiqMwUsQM7V6n2FOooAzrfVv
tF09utjdq8bBZCwTCZGRn5vT0otNVN4sUkVhdiKXBWRggGD3+9n9KWyhkj1bU5XQhJGjKMf4sIAf
1rM0aH7Nb2ccsGqLMiqrAu/lg9OmcY/CgDVbVrdI5SwkEkcohMOPnLHoAO+eoPp9DTJ9W8i7W2Nh
ds77tm0JhwOpHze4qjNbXcmof2ysHzwny0tyo3PFyC3s3JIHpx3NX7qGSTWtOmVCY40l3NjpkLj+
VAD7bU4Lm+nsgsiTwKrOrgfxDPGDzjIz9aji1q1nVWQSFWufswO3q2M569Md6zruzvk1G7vLSJvN
aby1OcZR4kXd9FZVP4GkksZbNEWK2laKHUEdVQZPliILn+lAHR1mxazDM8eILgQSPsjuCo2Mc4Hf
PJ7kVct5/tEZfypYsHGJV2n61hQRTxzRLbWl5aXPmgyorZtiN3zEZOMEZxjB5FAHRb137Nw3YzjP
OKQOrHAYE+gNc1Fp9yupLvSXzftjSmRYVA2bic+Z1xtwuPwp9rpstjoNpcW9kBf27eYyBQGkzkMp
P0Y/kKAOiZ0UZZlAzjJPelLKGClhk9BmuZuNLuIHtd4aaJbdlfbCJv3rNuc7T03Z6+3arelaWYb7
zrmDdJHaQxxySAMVI35APqMjkUAblFFFABRRRQBz99/yP2if9g++/wDQ7augrn77/kftE/7B99/6
HbV0FABRRRQAUUUUAc/bf8lD1P8A7BVp/wCjbmugrI1Hw1puqX/26c3sdz5QhMlpfz2xZASQD5Tr
nBZuvqarf8Ibpf8Az9a5/wCD29/+PUAbN4k8lq62zRrLxt8wZU88g+xHH41jDRprgXQFtBp6zWzw
lIJNwdmxhiAAOMH35o/4Q3S/+frXP/B7e/8Ax6j/AIQ3S/8An61z/wAHt7/8eoAjk0S7uI5d6Kjl
ERTJcvLnDqzdeg+X0z9K0NQ0yS7voZEZRCwCXKnq6q25cfjkH2Y1T/4Q3S/+frXP/B7e/wDx6j/h
DdL/AOfrXP8Awe3v/wAeoAG0Wf7XMMGSGW5E+43LqqjIJBQcEgjj8PStXTbZ7Sz8qTbu82R/l9Gd
mH6EVlf8Ibpf/P1rn/g9vf8A49R/whul/wDP1rn/AIPb3/49QBMun3itDBshMEV2bgSlzuKlmbGM
dfm9ajTSbpre1sZNiQW0jOJ0f5nGGA4xwfm55/nTf+EN0v8A5+tc/wDB7e//AB6j/hDdL/5+tc/8
Ht7/APHqAHtpt/caT/Z7pbRiO28lZNxYuw24I4+VeOev6cvmsb29a4kmihiMn2cKgkLcJIWbJx71
D/whul/8/Wuf+D29/wDj1H/CG6X/AM/Wuf8Ag9vf/j1AFqfTZpTfFSmZ7mGVcn+FPLzn/vk1Wj0a
4S7UMC8Qujcb2uXxgsWHydN2T9O/tSf8Ibpf/P1rn/g9vf8A49R/whul/wDP1rn/AIPb3/49QBas
9Nmt7bT42KZt7iSV8HswkAx/32KW3sLlfDbafIIxMLdoVKsSp+XAPQYqp/whul/8/Wuf+D29/wDj
1H/CG6X/AM/Wuf8Ag9vf/j1ADzp+pSwqMW8EsNo1vGVbcHY7ck8cD5ffrTBpV27XDvEjCSOMBJbp
3bKuWPzY+U88Y4BFH/CG6X/z9a5/4Pb3/wCPUf8ACG6X/wA/Wuf+D29/+PUAI2k30kULySOxhnLp
Ebgh9hTbgyAZJzn8OM1qaXZtZ2rK4AeSRpGAkZ8Z/wBpuScYz71mf8Ibpf8Az9a5/wCD29/+PUf8
Ibpf/P1rn/g9vf8A49QB0Fc/4u/48dN/7Ctn/wCjlo/4Q3S/+frXP/B7e/8Ax6nR+DtJS4hmZ9Um
aGRZUW41a6mQOpypKPIVODzyKAN6iiigAooooAKKKKACiuZ8TWyX+t+H7GeScW000xkSKd4t22Ji
MlCDwam/4QvRP7l9/wCDK5/+OUAdBRXDeEfC+maj4L0K+uzfy3Nzp1vNLIdRuAWdo1JPD9yTWz/w
heif3L7/AMGVz/8AHKAOgorn/wDhC9E/uX3/AIMrn/45R/wheif3L7/wZXP/AMcoA6Ciuf8A+EL0
T+5ff+DK5/8AjlH/AAheif3L7/wZXP8A8coA6Ciuf/4QvRP7l9/4Mrn/AOOUf8IXon9y+/8ABlc/
/HKAOgorn/8AhC9E/uX3/gyuf/jlH/CF6J/cvv8AwZXP/wAcoA6Ciuf/AOEL0T+5ff8Agyuf/jlH
/CF6J/cvv/Blc/8AxygDoKK5/wD4QvRP7l9/4Mrn/wCOUf8ACF6J/cvv/Blc/wDxygDoKK5//hC9
E/uX3/gyuf8A45R/wheif3L7/wAGVz/8coA6Ciuf/wCEL0T+5ff+DK5/+OVjaL4X0y51bxHDMb94
7XUUhhU6jcfIhtbdyPv/AN52P40AdzRXG6jodlouraBPYNeRvJqIifdezSBkMMpIKs5B5A7dq7Kg
AooooAKKwPGrOvhS72SSRlnhQtG5RsGVAcEYI4JHFJ/wheif3L7/AMGVz/8AHKAOgorhtC8L6Zd3
euJOb91t9RMMQOo3Hyp5UbY+/wCrE/jWz/wheif3L7/wZXP/AMcoA6Ciuf8A+EL0T+5ff+DK5/8A
jlH/AAheif3L7/wZXP8A8coA6Ciuf/4QvRP7l9/4Mrn/AOOUf8IXon9y+/8ABlc//HKAOgorn/8A
hC9E/uX3/gyuf/jlH/CF6J/cvv8AwZXP/wAcoA6Ciuf/AOEL0T+5ff8Agyuf/jlH/CF6J/cvv/Bl
c/8AxygDoKK5/wD4QvRP7l9/4Mrn/wCOUf8ACF6J/cvv/Blc/wDxygDoKK5//hC9E/uX3/gyuf8A
45R/wheif3L7/wAGVz/8coA6Ciuf/wCEL0T+5ff+DK5/+OUf8IXon9y+/wDBlc//ABygDoKK5/8A
4QvRP7l9/wCDK5/+OVjN4X0weNIrEG/+zHTnmMf9o3GN4kUA/f8AQmgDuaK4bxd4X0zTvBeu31o1
/Fc22n3E0Mg1G4JR1jYqeX7ECu5oAKKKKACiiigArkrGTWtGutUiXw9c3cU99JcRzRXMKgq2McM4
IPHpXW0UAc//AG5rf/QpX3/gXbf/AByj+3Nb/wChSvv/AALtv/jldBRQBz/9ua3/ANClff8AgXbf
/HKP7c1v/oUr7/wLtv8A45XQUUAc/wD25rf/AEKV9/4F23/xyj+3Nb/6FK+/8C7b/wCOV0FFAHP/
ANua3/0KV9/4F23/AMco/tzW/wDoUr7/AMC7b/45XQUUAc//AG5rf/QpX3/gXbf/AByj+3Nb/wCh
Svv/AALtv/jldBRQBz/9ua3/ANClff8AgXbf/HKP7c1v/oUr7/wLtv8A45XQUUAc/wD25rf/AEKV
9/4F23/xyj+3Nb/6FK+/8C7b/wCOV0FFAHP/ANua3/0KV9/4F23/AMco/tzW/wDoUr7/AMC7b/45
XQUUAc//AG5rf/QpX3/gXbf/AByj+3Nb/wChSvv/AALtv/jldBRQBz/9ua3/ANClff8AgXbf/HKP
7c1v/oUr7/wLtv8A45XQUUAcxbDVdS8W2F/c6NNYW1rZ3MTNNPE+5pGhIACMe0bda6eiigAooooA
KZLLHBE8srqkaKWZmOAoHJJp9c/4k/4mFxYeH15W+cyXY/6do8FwfZmKIfZ29KAKun6fqWu2o1Wf
W9UsFu2MsFrb+UqxQn7mQyE7iuGOTwWI7Va/4Rm6/wCho1z/AL7g/wDjVdBRQBz/APwjN1/0NGuf
99wf/GqP+EZuv+ho1z/vuD/41XQUUAc//wAIzdf9DRrn/fcH/wAao/4Rm6/6GjXP++4P/jVdBRQB
z/8AwjN1/wBDRrn/AH3B/wDGqP8AhGbr/oaNc/77g/8AjVdBRQBz/wDwjN1/0NGuf99wf/GqP+EZ
uv8AoaNc/wC+4P8A41XQUUAc/wD8Izdf9DRrn/fcH/xqj/hGbr/oaNc/77g/+NV0FFAHP/8ACM3X
/Q0a5/33B/8AGqP+EZuv+ho1z/vuD/41XQUUAc//AMIzdf8AQ0a5/wB9wf8Axqj/AIRm6/6GjXP+
+4P/AI1XQUUAc/8A8Izdf9DRrn/fcH/xqj/hGbr/AKGjXP8AvuD/AONV0FFAHP8A/CM3X/Q0a5/3
3B/8ao/4Rm6/6GjXP++4P/jVdBRQBz//AAjN1/0NGuf99wf/ABqsLUk1rTNZUaVrOpagNPh+2X9v
ceU4kjJwIl2op3sBIw54KLn71dvd3UNjZT3dzII4II2lkc9FVRkn8hWX4YtZotLN7eRlL/UHN3cq
3VCwG1P+AIFT/gPvQBrW9xDd20VzbyLJDMgkjdTkMpGQR+FSVz+gf8S3UdR0E8RwMLmzH/TCQk7R
/uuHGOy7K6CgAooooAKKKKAOf1n/AJGrw1/11uP/AES1dBXP6z/yNXhr/rrcf+iWroKAOf8AAn/J
PPDX/YKtf/RS10Fc/wCBP+SeeGv+wVa/+ilroKACiiigAooooAKKKKACiiigAooooAKKKKACiiig
Arn/AA9/yHPFn/YVj/8ASK1roK5/w9/yHPFn/YVj/wDSK1oAPE3/AB/eHP8AsKr/AOiZq6Cuf8Tf
8f3hz/sKr/6JmroKACiiigDn/Gv/ACKtz/11g/8ARyV0Fc/41/5FW5/66wf+jkroKAOf8M/8f3iP
/sKt/wCiYa6Cuf8ADP8Ax/eI/wDsKt/6JhroKACiiigAooooAiuIEubd4XJCuMZU4I9xWLHPdXcn
9jyOVli/186ty0fGMe5zz6VsXj3CWzm1iEkx4UEgAH1Oazn0h4LWKW1bdfxMZDIx/wBaT94H2P6V
5+LjOU7wT0Wvmuy8/wDhup10JRUfefp5Pv6f10G6osaXcIu45m09YsAR52q+f4sc4xTYRbizvpLC
7323kN+63EmNsHkZ5H0q1K+oQ3AuI4DNFJGN0G8Bo2Hoehqv9kubqe6umtRbl7Zolj3As7Hucce1
YTg/aNxjq79Hfb+ba3k/zNYy9xJvT1Vt+3fzNHTiTploSckwpkn/AHRVmsu1mvoLWCA6a5MaKhPn
J2GPWtSvQw81KCWuiW6a/M5KsbSb/VBRRRW5kFFFFABXPv8A8lDh/wCwVJ/6NSugrn3/AOShw/8A
YKk/9GpQAeO/+SeeJf8AsFXX/opq6Cuf8d/8k88S/wDYKuv/AEU1dBQAUUUUAFFFFAFTVNRh0nS7
i/nDMkKFtqjLOeygdyTgAepFYtr4e1We1jmv/EmqRXci75orZoRFGx5KpmMnaOgyc8VLqH/E18VW
Wm9bawQX9yOxckrAp/EO/sUX1roKAOf/AOEZuv8AoaNc/wC+4P8A41R/wjN1/wBDRrn/AH3B/wDG
q6CigDn/APhGbr/oaNc/77g/+NUf8Izdf9DRrn/fcH/xqugooA5//hGbr/oaNc/77g/+NUf8Izdf
9DRrn/fcH/xqugooA5//AIRm6/6GjXP++4P/AI1R/wAIzdf9DRrn/fcH/wAaroKKAOf/AOEZuv8A
oaNc/wC+4P8A41R/wjN1/wBDRrn/AH3B/wDGq6CigDn/APhGbr/oaNc/77g/+NUf8Izdf9DRrn/f
cH/xqugooA5//hGbr/oaNc/77g/+NUf8Izdf9DRrn/fcH/xqugooA5//AIRm6/6GjXP++4P/AI1R
/wAIzdf9DRrn/fcH/wAaroKKAOf/AOEZuv8AoaNc/wC+4P8A41R/wjN1/wBDRrn/AH3B/wDGq6Ci
gDn/APhGbr/oaNc/77g/+NUf8Izdf9DRrn/fcH/xqugrP1zUv7I0W5vVj8yVFCwxf89JWIVE/Fio
/GgDkRdanpGu3F6msXt7oenultfC78s/M/LOpVFwI8xknnguOq131Zml6NFY6BHpc+24DRsLlmH+
vd8mRiP9pmYn61W8LTSrYTaXcuz3OlzG1ZmOS6ABonPqTGyZPru9KANyiiigArn9B/4mGratrTco
032K2PpFCSGI+spk57gL6CrviLUZNJ8PX17Aoa4jiIgQ9Glb5Y1/Fio/GptI06PSNHs9OiYsltCs
e89WIHLH3J5P1oAu0UVj63rF1p1xYWtlYJeXN7I6Ksk/lKoVCxJO1vTpigDYorn/AO0fFP8A0Ltj
/wCDQ/8Axqj+0fFP/Qu2P/g0P/xqgDoKK5/+0fFP/Qu2P/g0P/xqj+0fFP8A0Ltj/wCDQ/8AxqgD
oKK5/wDtHxT/ANC7Y/8Ag0P/AMapn9vaxa6hp8GpaJbwQ3lx9nWWG+80q2xmHy+WvHyHvQB0dFFF
ABRXK2Gp+J9XhmurOPSI7cXM8MazGUviOV48nHHOzP41a/4rD/qB/wDkagDoKK5//isP+oH/AORq
P+Kw/wCoH/5GoA6Ciuf/AOKw/wCoH/5Go/4rD/qB/wDkagDoKKyPDup3ep2Nw19HClxb3Uts/kEl
DsbGRnmtegAooooA5/xJ/p1zpmhjlb2fzbkf9O8WGb8CxjQ+zmugrn9K/wBP8U6xqJ5S12afB6fK
BJIR9WcKf+uQroKAOf8AEf8AoF7peuLwLacW9wfWCYhTn2D+U2ewU10FVdSsIdU0u60+4BMNzC0L
464YYOPfmqfhm/m1Lw7Zz3RBu1Uw3OP+e0bFJP8Ax5WoA1qKKKACiiigDn9Z/wCRq8Nf9dbj/wBE
tXQVz+s/8jV4a/663H/olq6CgDn/AAJ/yTzw1/2CrX/0UtdBXP8AgT/knnhr/sFWv/opa6CgAooo
oAKKKKAGPLHGyq8iqznCgnBY+1K8sce3zHVdzBV3HGT6D3qvqFtFdWUiStsC/OJP7hHIb8Ky9Hlb
VLk3N2wM0ChY48Yxkf6zHvXLUxEoVVStrLb9b/p3N4UlKDnfbf8AQ1p7+0tXCT3MUbHs7gGpDPEI
hKZUEZxh9wwfxrJMdzYXd1IbAXcU0m/zEI3gY+6QeuMVXnNqdDk+yB1T7UpaNxgxtvGVx2/+vWEs
ZOPNzLZN21T0/B/LY0WHi7We9tfX8vmdFRRRXonIFFFFABRRRQAVz/h7/kOeLP8AsKx/+kVrXQVz
/h7/AJDniz/sKx/+kVrQAeJv+P7w5/2FV/8ARM1dBXP+Jv8Aj+8Of9hVf/RM1dBQAUUUUAc/41/5
FW5/66wf+jkroK5/xr/yKtz/ANdYP/RyV0FAHP8Ahn/j+8R/9hVv/RMNa/8AaNiD/wAflv8A9/V/
xrI8M/8AH94j/wCwq3/omGrOqQQrc6diKMZuQDhRz8prDEVJ0480Lf8ADuxrRjGcrSNOKeKdS0Mq
SKDglGBGfwqSs2/mmtZLW3skhRrh2Ull4Hy5zxTLi4urdljnvrWABMmVlGXbPZc8DpUPEqN1Jbb9
u/VlKi5Wae/3mrRWFHq9zLYRPH5Lytd/Zt5BCt1+bHUdqspdXlveTW0rJcsLczRlU2kkHG3GTSjj
acrNJ2f6/wBdBvDTV7mpUK3Vu1wbdZozMoyUDDIH0rL0/UZ7qWLbeW0hb/WwFCjxnGeMnJxUFrNc
WUN7KDHLI920SqI8ZckDJOentWbxyajKK01v8lfo/wCuxSwzTab1/ryOhorM869s7q3S5ljninbZ
uSPaUbBI78jiqiahqJ0mXUneAIqNtjCHkg4yTn68VpLGQjo07q9/JK3n5olYeT1TVv8AP/hjeorH
kuNSiurWLzYGN0G48sgRYAOevzd6kju7xBfQuYpZrfaVc/IpDDPPPamsXG9mmv8Ahr/l/VxPDytd
Nf07fmalMaWNFLPIiqDgksAM+lY8epSDULe3W+t7oTblOxPuEAkHIPI4qtbyzW2k3MjeVKPthXa0
fGTJgnr/APqrJ4+OvKtr320sk+j8y1hX1fb8f+GOkorMWe9vZrn7NLHBHA5jG+PcXYdc88CoRqd3
cCxSFYo5Z2kSTeCQpTrj8jWrxcF0fl56pafNrexCw8n1X+WlzZrn3/5KHD/2CpP/AEalaFjcXBvb
mzuHSRogrK6rtyGz1Gfas9/+Shw/9gqT/wBGpW1OoqkeZef4aGU4ODsw8d/8k88S/wDYKuv/AEU1
dBXP+O/+SeeJf+wVdf8Aopq6CtCQooooAKRmVFLMwVQMkk4AFLWD4vdn0QabExWXVJksQQcEK5/e
Ee4jEh/CgBPCStcaZLrEqkTatMbvkciIgCJfbEapkepPrW/TURY41jRQqKAFUDAAHanUAFFYeqa1
f22sw6ZpumRXkz27XDGW68lVUMF4+VsnJ9qj/tHxT/0Ltj/4ND/8aoA6Ciuf/tHxT/0Ltj/4ND/8
ao/tHxT/ANC7Y/8Ag0P/AMaoA6Ciuf8A7R8U/wDQu2P/AIND/wDGqP7R8U/9C7Y/+DQ//GqAOgor
Astc1M67b6Xqekw2huLeWeKSG884Hy2jBBGxcf6wflW/QAUVHcS+RbSy4zsQtj1wM1zOmX3i3U9J
s9QRNERLqBJlRjKSoZQ2D+dAHVUVz/8AxWH/AFA//I1H/FYf9QP/AMjUAdBRXP8A/FYf9QP/AMjU
f8Vh/wBQP/yNQB0FFc//AMVh/wBQP/yNV3w9qcmseH7LUJo0jlnjDOiElQehxntxQBp0UUUAFc/q
H/Ey8W6dp/WCwjOoTj/bOUhB9s+a31jFdBXP+Fv9MXUtZbk392/ln0hjPlR49jtL/wDAzQB0Fc/f
f8Szxfp96OIdSjNjP6eYoaSE/l5q+5ZRXQVkeKLKa+8O3aWwzdwgXFt/12jIdP8Ax5QD7E0Aa9FV
tPvYdS021v7c5huYUmjPqrAEfoaKAMjxB/pesaDpfVZLo3ko9UgG4f8AkVoTXQVz8H+l+PryQ8rY
afHCh/2pXZnH5RRfnXQUAFc/rP8AyNXhr/rrcf8Aolq6Cuf1n/kavDX/AF1uP/RLUAdBRRRQAUUU
UAFc/wCJv+P7w5/2FV/9EzV0Fc/4m/4/vDn/AGFV/wDRM1AHQUUUUAc/4M/5F5/+whff+lctdBXP
+DP+Ref/ALCF9/6Vy10FABRRRQAUVVuNT0+1k8u4vraF/wC7JKqn9TVhHSRA8bq6noynINAGD4T/
ANRq3/YVuv8A0Ougrn/Cf+o1b/sK3X/oddBQAVFc3EdpazXMzbYoUaRz6ADJqWsDxoS3hW6tFJDX
7xWIx1HnSLET+Acn8KAJPCNvJB4WsXnXbc3Km7nHpJKxkcfgXI/CtukACqFUAADAA7UtABXP6J/o
fiPXtN6IZI7+IeiyqVYf9/IpD/wKugrn73/RPHOlTjhby0ntX93UrIn5AS/nQB0FFFFABRRRQBz+
s/8AI1eGv+utx/6Jaugrn9Z/5Grw1/11uP8A0S1dBQBz/gT/AJJ54a/7BVr/AOilroK5zwVJ5Pw3
8OSbHfbpNqdqDJP7pegq/wD23H53lfYr7zNu7b5POOmetZVK9Om7TdjSFKc1eKNSimRP5kSvtZNw
ztYYI+tPrRO6ujNqwUUUUwKd9Zve+VEzhbbdulXu4HQfT1pLixLXcF3bMscsfyuMcOn90/0q4zBE
LMcKoyTVezvBexeasM0aEAqZFA3A9xzXPOnSc7S3ev3fkbRnNRutl+pV+x39pLJ9hmgMMjl/LmU/
IT1wR2pkmkSvYTRmdWuZpVleQrhcgjjHpxWtRUvB0mmne2ul3pft/XoNYia1W/8AkVIRqPmr572p
j/i2IwP4ZNW6KK3hDlVr39TKUuZhRTZJFiieRzhEUsx9AKjW5VzBsSRlmXcrheAMZ59KbnFOzYlF
vUmoooqhBXP+Hv8AkOeLP+wrH/6RWtdBXP8Ah7/kOeLP+wrH/wCkVrQAeJv+P7w5/wBhVf8A0TNX
QVz/AIm/4/vDn/YVX/0TNXQUAFFFFAHP+Nf+RVuf+usH/o5K6Cuf8a/8irc/9dYP/RyV0FAHP+Gf
+P7xH/2FW/8ARMNa15aNcy2rhgvkS+YQe4wR/Wsnwz/x/eI/+wq3/omGugqZwU1yyKjJxd0Vbq0a
4u7SYMAIHLEHvlSKgksrlNRlu7doG81VU+cpJTHpjt7Vo0VlLDwk79b3+drfkVGrJaeVv1MiPSJk
jRXnV2F59pLbcZHcYq3JZPJqLXIk2g25hGOoOc5q2TtUk9AM1Fa3KXlrHcR52SDI3Dmojh6MfcXr
v2/4ct1akve/rUof2ddzz25upLcrA4dZEQ+Y+PUnp7086UXtrmJpdrSXBnjdR9w5BH8qtW95FcTT
QqGWWFsOjjB9j9DUEmr20dnLdlZGhjfZuUA7jnHHPIzWXs8NGLlJ6O/Xto/u/rUvnrN2S7f8D7xq
Wd3Pcwy30sJWBiyJEpGWxjJJ/lTBpbjQW07zF3lWG/HHLE1oRzxyW6zhsRsu/J9MZqnBrNtcW8c6
LKEkmEAyuDuP49KqVPDx+J6yT67p2v8AoJTrPZbNffr/AMElls2kvLKcOALfdkeuVxVa60p7k32J
Qv2jyyvGcbex9Qa0ydqknoBmsxNcikiEy2d6YiM7xDkY9etOvDDr3anW7/Dl/IVKVV6w6f53/MPs
N3Lc2k00kCC3ckRxKcYIIPJph0mc21xbedH5bziZDtOR824g1f8At1t9j+2ecv2fGd/aqp1mJEEk
1rdwwn/lpJFhR9ecis508LH4pb+fRq33aehcZ138K28vn94GzvbeedrKaERztvZZVJ2N3Ix17cGi
HSvIksSkm4W/mFyw5csOT+dTXOpW9rc20Em4tcHCFRkduv51Je3sVhatcTbtgIGFGSSfSr9nh1zS
b+HfXbVS/wAmTz1nZW38t+g2K0aPUri6LArKiKF9MZ/xrJf/AJKHD/2CpP8A0albsUqzQpKudrqG
GfQ1hP8A8lDh/wCwVJ/6NSuqnGMV7uz1+/Uwm23r/Vg8d/8AJPPEv/YKuv8A0U1dBXP+O/8Aknni
X/sFXX/opq6CrJCiiigArn7r/TfHVjb9Y9OtHu2HpJIfLjP/AHys4/Gugrn9B/0nXvEV+eQbpLSM
/wCxFGpP/j8ktAHQUUUUAc+//JQ4f+wVJ/6NSugrn3/5KHD/ANgqT/0aldBQAUUUUAFFFFAHP33/
ACP2if8AYPvv/Q7augrn77/kftE/7B99/wCh21dBQBXv/wDkHXP/AFyf+RrP8J/8ibof/YPt/wD0
WtaF/wD8g65/65P/ACNZ/hP/AJE3Q/8AsH2//otaANiiiigAooqm+radHN5MmoWqS5xsaZQ35ZoA
uVz/AIH/AORL0v8A65f+zGt8EMoZSCCMgjvWB4H/AORL0v8A65f+zGgDoKKKKAMrxLfy6Z4a1G7t
/wDj4SBhAPWVvlQfixFWtLsItK0mz06H/VWsCQp7hVAH8qyvE/8ApE+h6d1F1qUbOP8AZhVp/wAt
0Sj8a6CgAooooA5/wl/o9je6Uf8AmG3stuo9IziSMfhHIg/Cii0/0Tx3qUHRL2yhuVHq6M0bn/vn
yaKADw3++1HxFef89dSMa+yxxRx4/wC+lc/jXQVz/gz5tAkn/wCfi/vJs+oa5kK/+O4roKACsPXr
O+e90vUrG3W6ewkkZ7cyBGkVkKnaTxuGehIB9RW5WJrup6haXmmWWmR2rT3sjruuS21QqFv4ec8U
ARf8Jno0Py6jLNpcg6rqELQgfRyNjfVWIo/4Tnwu3Fvrlldt/cspPtDf98x7jR/xWH/UD/8AI1H/
ABWH/UD/API1AB/aWs6v8ul2J0+3PW81GMhiP9iHIb8XK49Go/4RGyuPm1O81LUpT1NxduqH/tnG
VjH/AHzmj/isP+oH/wCRqP8AisP+oH/5GoAP+EJ8PrzBZPat2e1uZYGHvlGBzUEnhrUf7R0xxrct
zYWd19oMN5GHlBCOoCyLjI+f+IMfftU//FYf9QP/AMjVDJqfiLTtR0yPUY9Le3vLr7MTbmQOpKOw
PzcfwfrQB01FFFAHMWkereGUlt007+09Pa4mnSS1dVnTzJGkKtG5AbBc8hskD7vrP/wmGnrxLY65
G46r/Yt2+PxSMqfwJqjpQ8Q63azXq68tqhu7mJIVskYKsczxjknJ4QVe/sjxF/0NH/khH/jQAf8A
CQ3t78uk6Dfyk9Jr5fskQ+oceZ+SH8KP+Ecm1H59f1Ga7z/y62zNb2y+xVTuf/gbEegFH9keIv8A
oaP/ACQj/wAaP7I8Rf8AQ0f+SEf+NAFqDwv4ftU2W+h6bEvologz+lV38G6EHMtlZLplx/z304/Z
nz77MBvowI9qb/ZHiL/oaP8AyQj/AMaP7I8Rf9DR/wCSEf8AjQBc0HR20WymgkvJLySW4kneaRFV
mLnPIUAfkB9BWpWJ4Yvb28sLpb+dZ57a8mt/NWMJvCNgEgcA4rboAK5/xF++1Xw5Z9pNRMr/AO7H
DI4/8fCV0Fc/f/vfHeiRdorK8nPsd0CD/wBDb9aAOgooooAK5/xR+5k0K9/59tViGf8ArqrQf+1R
XQVz/jX5fC1xN/z7zW9zn08uZHz/AOO0AdBRRRQAUUUUAc/rP/I1eGv+utx/6Jaugrn9Z/5Grw1/
11uP/RLV0FAHP+BP+SeeGv8AsFWv/opavf8AMzH/AK8//Z6o+BP+SeeGv+wVa/8Aopa2vssf237X
lvM8vy+vGM5rGtBz5bdGmaU5KN79UZ00T3euS273E6QrAjhY3K/Nk81VuXEsd7JG17O6FyksbbEj
x2HzYOMehzW0trGt690C3mMgjPPGAc/1qr/Y8G2SMSziCRizQh/lyevbOPbNcVXC1GnZbt/8D+un
Q6YV4Jq/S3/BKcfm319aRy3EyxtYrK6o5Xc2fb60ifa2tLy2gldzDdBF3SYdk4JUMe9akFhFBNHK
rOWjhEAyR90HP50x9Lt3SZSXzLKJSwbBVhjBB7dKPqlS1+rvfXpb/MPbwv5adPMzomjk+1wE3luz
Qlvs8zHt/ErZPHYjNEEbGPS7MTTJFNCZZMSHLYVflB6gc9BWjFpkUbvI8s00joY98jZIU9hxilk0
2GS3gi3SIYABHIjYZcDHWksLUtdpX/S6dvnrtoDrwvZP+rWv/Wpm3by2Jv7eKaQx/ZDOhZyWjbJH
BPOKJoJIUsNt3c7rqZfNYyH+6ScelaC6VbiG4jZpZGuF2ySu2WI9M9qmksopBbBi3+jsGTB7gY5p
/VKju38lfbX/AC/yD28Ft8/PT/My4bTfql1Zm5ufs0aI4Tzmzk5/iznt0pq3BbTbJJri5d2kddkQ
JklCkjGc8DpmtdLWOO7luQW8yVVVsnjAzj+dQHSoPLhVJJY2hZmSRW+YbjkjpjHPpTeFnFPlXf7u
ZNfcr2W3TYXt4t+95fk7/iZLFz/adsRcxQ/ZfNWOWXLA89wTwcdM1YgZrdtHRJJNjwuzKXJ3fICO
tXo9KgSSWQtK7TR+XIXbO4f54pYNMigNsRJM5t9wjLtngjGP0qIYSrFp/wBW5k/yKlXptW/r4bfm
Z0cUk2iHUTdzi6MZmDCQ7Vxk7dvTHbpToA+pajKJppki+zxSeXHIVGWB9KtnRbc7k8ycQM24wB8I
e/Trj2zVqO0iiupbhch5FVSOwA6Y/OqhhKl4qS0Vr676PX8vXrsKVeFny79PLbQq6NJI9k6ySNIY
5njDMckgNxmqHh7/AJDniz/sKx/+kVrWzbWsdojpGWw7tIcnuTk1jeHv+Q54s/7Csf8A6RWtd1CE
oUoxlukc1WSlNtbB4m/4/vDn/YVX/wBEzV0Fc/4m/wCP7w5/2FV/9EzV0FamYUUUUAc/41/5FW5/
66wf+jkroK5/xr/yKtz/ANdYP/RyV0FAHP8Ahn/j+8R/9hVv/RMNaGqyKqQxtLMu9/8AVwA75AB0
BHQe9Z/hn/j+8R/9hVv/AETDWvdWUd2YmLyRyRHKPGcEZ61jXjKVNqO5pSajNORjiaaGe+iQXMMZ
smlVJZNxVhkZBySPzp5je3h0y7W5uGlmljWTdISrBhyMdKvrpEAklkaSZ5JYjE7M2SQfwqZ7GJ4L
aIlttuysnPdema4I4SrZ3+Wu2tzqdeF1b5/cUIYG1A30slzMjpM8UeyQqsYHfHQ++c1Y0MY0S0H/
AEzp8ulwyTPIJJoxJ/rEjfCv9fw9KsWtulpbRwR52IMDPWt6FCcKvNJdGr33u0/6+4yqVYyhyp9v
loYmuB5rsJZK5uUiJnMbY/dH+E+57VLqD28nh6FrUAQF4tgA6DeOK07SzisxJsLM8jF3dzlmPvUB
0m2Mc0YMixyyCUoDwrA549MkVlLC1Xzy0vNNW7dv+D5mka8Fyr+Vr59/+AUQxSzl0oEiTz/JXByf
Lb5s/wDfOfyquqhYwqgADV8ADtzW4bGA6gL0g+cE2Dnj6/WoZNJgkiaPfKu6f7RuVsEP7cVM8HVe
3TRenQccRD79X69S7J/qn/3TVHQv+QHZ/wDXMU+HTvJk3m8u5BgjbJLkHPtioE0OGOIQi7vPKAx5
fnYGPTiumXtnUVRR6Nb97f5GK9nyOHN1T29TLTb5MR/5df7VJH93bzj8M10V15f2SbzceXsbdn0x
SGytjZ/ZPJX7Pt27O2Kqf2NCwVJbi6mhXpFJJlfx7ms6VCrRi4xSd0vk/wDIudWFRpt2s/6+ZjLb
y3NvpcMmfNNpIV9QRtK/0q5d3A1O0DDlIrR5nHYOVKgfh81bDWkb3UNxyHiVlUDpg4/wqKPTLeKK
6jQMBcli/PTI6D06msVgakbxT0e/nZK34p3NHiYuze6/Vu/4Emn/APINtf8Arin8hWO//JQ4f+wV
J/6NSt2KJYYUiXO1FCjPoKwn/wCShw/9gqT/ANGpXp04uMEmcU3eTYeO/wDknniX/sFXX/opq6Cu
f8d/8k88S/8AYKuv/RTV0FWSFFFFABXP+C/3nhxbvveXNzd59RJM7r/46VH4VtXlwLSynuW6RRtI
c+wzWX4Qtza+CtCt2+9Hp8CsT3IjXP60AbVFFFAHP6pBfWfiGDWrWya+hS1e2mhicLKMurBlDYDd
DkZB9M9KP+E28Px8XuoDTnHVNRja1I/7+AA/UZFLqmp6uPEEGlaVHY5a1a5eS6L9nVcAL9aT/isP
+oH/AORqAD/hN/DcnFpqsV+3ZNPDXTH8Ig1Hn6/rPFvF/Ytmf+W06rJcsP8AZTlE9i24+qij/isP
+oH/AORqP+Kw/wCoH/5GoAP+EN0qX5r577UJD1e7vJHB+iBgi/8AAVAo/wCEL0SPm1guLJx0azu5
YMfgrAEexBHtR/xWH/UD/wDI1H/FYf8AUD/8jUANtNA1GDxHaX9zq5vbW1tpoYxNCqzZkaM/My4V
gPL/ALoPPJNdFXO2mp63D4jtdM1WPTzHdW00yPal8qY2jGDu9fM/SuioAZNEJoJIiSA6lSR7jFc1
p8+r+G9NtdOu9Jkv7W1hSGO709gWZVAALxMQwPH8Jf8Aw6O5kaG1mlUAsiMwz0yBXL6PbeJNU0Ow
1B/EixtdW0c5RbCMhSyhsDn3oAu/8Jjpo4a01wN3H9h3hx+IixR/berah8mlaHPED/y86kRBGPcI
MyMfYhfqOx/ZHiL/AKGj/wAkI/8AGj+yPEX/AENH/khH/jQAf8IrDffPr13Nqsh6xSEx2w9hCDtI
/wB/eferieGdBjh8mPRNNWLGNi2kYX8sVT/sjxF/0NH/AJIR/wCNH9keIv8AoaP/ACQj/wAaAFPg
/SoGMmkpJo8/UPpzeUufVo/9W3/AlNX9D0saLolppomM32eMIZGXaWPc47Vn/wBkeIv+ho/8kI/8
as+F7+41Twzp97dsrXEsQMjIu0E5xnHbpQBr0UUUAc/ef6R480qLqttY3M7ezM0SL+nmV0Fc/a/v
fiBqbdoNMtUH1aScn9FX866CgAooooA5/U/9H8aaBc9BNFdWZ9yypKP/AESf1oqt43uf7Pt9I1Pp
9jv/ADMn/agmj/8AZ6KALPgjnwZpjf3oy/1yxP8AWugrn/A/HgnSF/u24X8iR/SugoAK5/Wf+Rq8
Nf8AXW4/9EtXQVz+s/8AI1eGv+utx/6JagDoKKKKACiimSyxwRmSWRI0HVnYAD8aAH1z/ib/AI/v
Dn/YVX/0TNWvbajY3jFbW9t52HURSqx/Q1keJv8Aj+8Of9hVf/RM1AHQUUUUAc/4M/5F5/8AsIX3
/pXLXQVz/gz/AJF5/wDsIX3/AKVy10FABRRTZJEhjaSV1RFGWZjgAe5oAdRWC/jbwujlD4g05iDg
7LhWwfTINX9O1zSdYDf2bqdnebfvCCdXK/UA8fjQBneE/wDUat/2Fbr/ANDroK5/wn/qNW/7Ct1/
6HXQUAFc+/zfEOD/AGNKk/DMqf8AxNdBXPtx8Q0/2tKb9JV/xoA6CiiigArn/HXHgLX2/uWEz/TC
E/0roK5/x1z8P/ES/wB7TbhfzjYf1oA6Ciuf/wCEL0T+5ff+DK5/+OVHF4UntDImn+J9cs7dmLLb
hoJlTPUBponfHfBY9aAOkqG6u7ayiEt3cRQRlggeVwo3E4Aye5PArF/4R7VP+hz1z/vzZf8AyPXL
fELwJr/iDwhcabZeIdR1CeWWLEF4LWOLAcEsxSFW4HPB7dD0oA6nWf8AkavDX/XW4/8ARLV0FeWe
E/Bmp+DNR8N2mpeILjU2aSfbC3+qgxC3CZ+bH4gewr1OgDn/AAJ/yTzw1/2CrX/0UtbswlMTCBkW
T+EupI/EAisLwJ/yTzw1/wBgq1/9FLXQUAY9lqF40d1c3clsLe1eRJPLibcQncfMf5VZGsWxRGVL
li4LKogfcVGPmxjpyPrUY0xxpuo2vmLuummZWxwu/OM/nTb7TJ7maIrLG0SxeWY5C20HP3sA/N9D
QBJJrljHzvkYCJZyUiZgsZzhjgcDg1K2p2y3JgzIzBlVmWMlVLY2gkeuR+dU4dGkisriAyoTLYx2
oODwVVhn6fMKS50iaW8WaJ4o2BTE65WRQMZXjhgcHr0z3oALTXFmkuDIrhRMYYYlgbexHU+/T0GO
/WrTaxZjyMGV2nLBFSJi2VIDZGMjGe9Vl0m4gmFzDJGZluJZArg7SsnUE9jwOaks9Ke3uobh5VZx
5zSYGAWkZTx7DbigBV16ycqE89t5ZY9sLfvCDyF45x/noasNeedpcl3ZYkby2aMMCMsM8EdeoxVS
10iS3/s/Mqn7K8rNgfe37sY/OremWjWNgluzBirMcj3Yn+tAFT+2C9/ZpEqG2mRGdz1UuGKf+g4/
EVBJrM3kW8ge2gjnklCzzA7FVWwueRyw56jpTo9Ckh0y6tknUSvKHgkx/qwmPLH4bR+Zqy1jdW1v
bR2M0e2GLyjFMDskGBg8dDx79aAInv777NabRbCae4MQkBLxsu1juGD329M1Hdatd2EV3HcJA1xF
EJo2QEI67sHIJyCPr3FKmj3EMMZhe3Ey3ZuSoUrGMoV2gDnvn65oudHub2C7e4ni+0zRCFNikJGo
OfqcnqfYUAalzdRWkPmTEgFgoCqSWJOAAB1NFtcx3UXmRhwASpDqVII6gg1Tntb68tJIbgWZyVIX
aWVgDyDnp7EdKl0uzksrZo5JN25yyoGLCMYHygnkjj9aALtc/wCHv+Q54s/7Csf/AKRWtdBXP+Hv
+Q54s/7Csf8A6RWtAB4m/wCP7w5/2FV/9EzV0Fcx4yt5bp/D8MN5PZyNqq4ngCF1/cy9A6sv5g1P
/wAI9qn/AEOeuf8Afmy/+R6AOgpskiQxPLI6pGilmZjgADqTWD/wj2qf9Dnrn/fmy/8Akequp+Gd
Xn0q8ij8W63M7wOqxtFZAOSpABP2cYz9RQBN4unhuvB0s9vLHNDJJbskkbBlYecnII610leDeHvh
hr/g3wvPd6pr8qI8kJbS7Zt0OTKnLk8Z/wB0Dp94iveaAOf8M/8AH94j/wCwq3/omGugrn/DP/H9
4j/7Crf+iYa6CgAqOSeKEEyyogHUswFSVkGK3l8TSiZUZxbIUVue7ZOKxrVHDlUd27amlOCle/RX
NTzYwgfeu1uhzwaabmAQiYzxiI8B94wfxrnWSOWJYQA1r/aYRAPulccge2c1oC3t/wC3hBJHGI1t
wYIyo25LHcQPXpXLDGTnsl0W/V/p276G8sPGO78/68zVV0ZA6sChGQwPGKbFPDOCYpUkx12MDiuc
nEafbIosCw+1xCTb90A43j6ZxmruqJbW0cj2qiO8Ns+wRDGVHUnHp2oWNlZysrR3131a0+7TuH1Z
XSvv/wAB6/eayXEMkjRpNGzr1UMCR+FDXECSCN5o1kPRSwBP4Vz3kTLb2Uitp8Sb0MUkYbc3t05z
3p88JQ386R2t5b+YzTLJlJFIHIDfyqPr1Tlvy/8ADWvtv/Vyvq0b7/1+RvS3EMGPNljjz03sBmmv
KwnhRQhRwcsWwRgcYHesdozc3ZntPs8zNAm+3ulOVUjIwffvSWskUtzozQxGKMCZQhbdjAx17iqe
Mk5Wt1Vv/Aku1uuvVbeZP1dJX8n+Tf6ehtfaYN6p58e5vujeMn6Usk8UOPNlRN3A3MBmuaW0t/8A
hEJZ/JTzsM3mEfMCGOMHt0rQgWCbV7z7YsbuscfliXB+QjnGffOaIYypLlTSTkk1r3Tev3fiOWHi
rtN6X/C3+ZsKytnaQcHBwe9LWXoPlfYZfIbdF58mw5zxnitSuyhU9rTU+5zVIck3HsFc+/8AyUOH
/sFSf+jUroK59/8AkocP/YKk/wDRqVqQHjv/AJJ54l/7BV1/6Kaugrn/AB3/AMk88S/9gq6/9FNR
/wAI9qn/AEOeuf8Afmy/+R6AOgorn/8AhHtU/wChz1z/AL82X/yPUcPgrTQhN5d6pfXDszvcTX8i
M5JJ+7GVQAZwAqgYAoAr3firRPEXgvXLjSNRhuhFZT+YiNh0IRuGU8j8RXRaYmzSbND/AAwIOP8A
dFeOWPwQsfDeiaxrF9qE93qS2dw8SQO0UUZKNgE53P8AiQD3Br2TTmDaZaMDkGFCP++RQBZooooA
59/+Shw/9gqT/wBGpXQVz7/8lDh/7BUn/o1K6CgAooooAKKinube1j8y4nihT+9I4UfmabbXtpeA
m1uoZwOpikDY/KgDGvv+R+0T/sH33/odtXQVz99/yP2if9g++/8AQ7augoAr3/8AyDrn/rk/8jWf
4T/5E3Q/+wfb/wDota0L/wD5B1z/ANcn/kaz/Cf/ACJuh/8AYPt//Ra0AbFFFFABRUVzdW9nA091
PFBCv3pJXCqPqTWKfHPhXPHiDTmHqs6sPzHFAG/XP+B/+RL0v/rl/wCzGtWw1TT9VhM2nX9reRD+
O3mWRfzUmsrwP/yJel/9cv8A2Y0AdBRRRQBz+lc+MvELeiWq/wDjrn+tdBXP6Tx4w8RA9SLVvw2M
P6GugoAKKKKAOG+Lz+X8Or6U9EkiPHX74H9aKb8YVL/DTUY1+87wgf8AfxT/AEooA2/BXy+F4Yu8
FxcwH6pPIh/9BroK5/wr+6GtWfe31W4yP+uhE/8AKUV0FABWNrenXtzc6ff6e0BubCR3WGclUlDI
VK7hkqec5wfpWzVLUtY0zRoFn1TUbSxidtiyXU6xKzdcAsRzxQBmf8JQ1t8up6Hq9q46mG0a7Q/Q
w7zj6gH2FH/CYWEnFrZazcv2WPSrhQf+Buir+Zo/4Tvwf/0Neh/+DGH/AOKo/wCE78H/APQ16H/4
MYf/AIqgAz4h1jjYNDtD1JKTXTD2xmOP65f6DrT4vB2gLIJbjTo764H/AC3vybmT8GkyR9BgUz/h
O/B//Q16H/4MYf8A4qj/AITvwf8A9DXof/gxh/8AiqALNx4W8P3ahbjQ9Okx0LWqZX6HGQfpVL/h
EI4tQ0+a21K9jtbS4+0fY5ZTMhbYyjaz5ZPvngHHtUn/AAnfg/8A6GvQ/wDwYw//ABVWLLxb4b1K
7S0sPEGlXVzJnZDBexu7YGThQcngGgDYooooA5uGw1rw/wCammJbajYPNLP9nmfyZozI7OwV8FXG
5jgELj+8ak/4SS9XiTwrrauOoX7Ow/AiXBpX8Z6GsssYnuZDFI0TGKxnddysVYBlQg4II4Pak/4T
TRP799/4Lbn/AON0AH9p+Ib/AOWy0NbBT/y31OdSVHqI4i276Fk+op0fhWznkW41l21e5ByGuwDE
h/2IvuL9cFvUmm/8Jpon9++/8Ftz/wDG6P8AhNNE/v33/gtuf/jdAG8iJGgRFVVAwFUYAqhqOg6V
qxVr6xhlkXlJtu2RD6q4wyn3BBqh/wAJpon9++/8Ftz/APG6P+E00T+/ff8Agtuf/jdAF/RtHg0O
ze2gmuJleZ5me4k3uWY5OT3/AB5+taNU9M1Sz1iz+1WMpki3shLIyEMpwQVYAgg+oq5QAVz91+7+
IOlsek2mXafisluQPyJ/Kugrn9b/AHPibw1c9muJrUn03wu4/WID8aAOgooooAK5/wAb/N4N1KLv
OiwD6uwQf+hV0Fc/4u/e2OnWg63OqWi/gkyyt/47GaAOgooooAKKKKAOf1n/AJGrw1/11uP/AES1
dBXP6z/yNXhr/rrcf+iWroKAOf8AAn/JPPDX/YKtf/RS1vswVSzHAAySe1YHgT/knnhr/sFWv/op
a3ZkaSCREkMbspCuBkqcdaAKa6xaMkjnzUVIjOC8TLuQYywyOeo9+aF1mzKSOWkQIgk+eJl3KTgE
AjnJ4rOTQbgpNvkhDyWklsWBZixbHzFjz26dquXmlPdMSsoQiFUUkZwyuGBPtkCgCWy1H7Ze3MKo
yLCkZw6FWBbdkEH6D86JdSSC5nWT/Vx7EUKpZmkbJ2gDrxtP4mlsra5jvLi5uXiLTKihY84Xbu7n
r1qKTTZmjEiyJ9pW6NwC2Sp6qAe/3CB9RQAkGtRSCYur5FwYYo1jbe2FBPy9eMn2qc6ra+XE6mRz
KWCokbFvlOGyMZGD1zVNNLvI5/tglha5EzybSCEKsqqVz1GNo5/Tmli0q5tXS5gkha5JlMocEI3m
MGOO4wVH1oA0TeW4svtnmfuNm/dg9Pp1/DrVZtZtI45Hl82LyygZXiYN8xwuBjnJp9xa3U2lNbC7
IuSgBnC7cnvwOmenHSqEWiSrJJIWhj3yQPsTcceW5Y5Y8knPWgC9/a1r5LSEygrIIjGY2D7yMgbc
ZPBzS6dffb/tLBcLFMY1ypU8KpOQe+Sagn0yV55LiKVBL9oWeMMDjiPYQfqM/pVjT7Wa2Fy07o0k
0xl+QEAfKox+lAFRdTujdf2eYV+2h8k7Ts8rP+s/pjPWks9ZaXUNSguVSOO1JKOM/Mo+8T9OPzpf
7HkDrerKv9peZvaUj5Sp4Mf+7j9Rmo5dCeSV388LvumkcAfeiYKGT8dooALHWLm5+wCaGNHuJZUk
UZ+XYDj8eOa26x30u6SWCaCSEvFcTS4kBwQ+eOPTNakHneUPtHl+Z38vOP1oAkrn/D3/ACHPFn/Y
Vj/9IrWugrn/AA9/yHPFn/YVj/8ASK1oAPE3/H94c/7Cq/8Aomaugrn/ABN/x/eHP+wqv/omaugo
AKKKKAOf8a/8irc/9dYP/RyV0Fc/41/5FW5/66wf+jkroKAOf8M/8f3iP/sKt/6JhroK5/wz/wAf
3iP/ALCrf+iYanhhn1L7VOb2eBkmkihWJsKgU7ckfxZIyc+tAGzWdLpcdxqclxcJHJE0SoFYcggk
5/Wo31SWGeaNoUkhtrdZ5pw+Mghvurg5+6e9Q2/iFZvMHlwM4hMyiO4DAYxkMSAFPI9R19KzqUoV
ElNXsXCcoXcTWFtAI44xCgSMhkULwpHcUlxaW92oW4hSQDkbh0+lYd1rty9jeG2Fv5sBixJHNvQh
3xwdvXgjpU0/iOOC6kjdYNsLiOQed85JxkquOQM+ozg03Tg1ytaC5pJ3ua6W8CQeQsKCLGNgUYx9
Kbb2dtaFjBAkZbqVHWoNWeSCwe6imEbwfvMN91wOqn6/zxWab+4k0aXUhI++SeNVhT/lmokVSnP8
R5zn1x2o9nC6dttg55aq+5rxadZwzedFbRJJ/eC9Pp6US6dZzzedLbRPJ/eK9fr61QN5Pdatb2xh
urWN4Ji28qMnKYIwTyMn86SwhkE9+7Xly/2eYoivJkY8tTz68saXsaduXlVvQftJ3vdmjcWNrdMr
T28cjLwCRyB6fSpBbwqYyIkBiBCYXG3PXHpXM2up3h8NeU87NfnaBL/EVZPM3fgu4fVa1tNuJZry
VJJCyi1gcA+rb8n8cCn7OF72Vxc8rWuX/s0Atzb+SnknIKY4/KqN7Zzy3G8W9pcxYGxJhgxnvg4O
RV64g+0RhPNli5zuibaawbSa5i8OR34uppLmYLGDK25VLOF3Y9s1FShCceXYqFSUXc2NOszZWnlM
wLszO5UYGSc8e1W6yJkk0ua0kS6uJkmnWGRJn3Z3Zww9CD6cYzxUNnHc6hp41E380Mzkugz+7jUE
4Ur0Ix1J59xVwhGEVCOyJlJyk5Pqbtc+/wDyUOH/ALBUn/o1K6Cuff8A5KHD/wBgqT/0alWSHjv/
AJJ54l/7BV1/6Kaugrn/AB3/AMk88S/9gq6/9FNXQUAFFFFAFLWLc3eiX9sOs1vJGPxUiofDlwLv
wvpFyOk1lDIPxQGtOuf8EfJ4N02372kZtCPQwsYiP/HKAOgooooAwtUsNRi1uDWdNSC4eO3a3ktZ
XMZdSwbKvggMMdCMHPUUz/hLIYPl1DSdas5B1X+z5LhR/wADhDrj3zV/U9f0bRWjXVdWsLAygmMX
VykW/HXG4jPUVQ/4Tvwf/wBDXof/AIMYf/iqAD/hLrWb5bHTNavH7Kumywg/R5gifjmj7Lrusf8A
H7ONItD/AMu9o++4cf7UuMJ9EBPo9H/Cd+D/APoa9D/8GMP/AMVR/wAJ34P/AOhr0P8A8GMP/wAV
QBLB4Q8PW8nm/wBkWs0/ee5Tz5T9ZHyx/E0658JeHrshpdFsPMH3ZUgVHX6MoDD8DUH/AAnfg/8A
6GvQ/wDwYw//ABVH/Cd+D/8Aoa9D/wDBjD/8VQAtl4YFjrtvqC6pezQ29vLDFbXL+bs8xkJIkb5z
/qxwxb6it+svTfEmhazcNBpetadfTKu9o7W6SVgvTJCknHI/OtSgBksazRPE2drqVOPQ1zlpBr/h
2ygsYLaDV7C3jWKIrIILlUUYAIb5HOB97cn0rpXZURnYgKoySewrno/HGgyxrJFNePG4DK66dcEM
D0IPl8igB3/CS3Y4bwrrgbuNtucfiJcUfa/Euo/Jb6bDpER6zXsqzSr9I4yVz7l+PQ0f8Jpon9++
/wDBbc//ABuj/hNNE/v33/gtuf8A43QBLbeFtNjnW6vUbU75eRdX2JWU/wCwMbY/ogUVtgADAGBX
P/8ACaaJ/fvv/Bbc/wDxuj/hNNE/v33/AILbn/43QBbv/Dek6jMLiazRLsfdu4CYp1+ki4b8M4Pe
rGk6ZDo2k22nW7yPFboEVpSCx9yQBz+FZn/CaaJ/fvv/AAW3P/xutixvrbUrGG9s5RLbzKHjcAjI
PseR+NAFiiiigDn7D93481uP/npY2cw/76nU/wDoA/Ougrn5P3HxCtyel3pcgH1ilT/49/OugoAK
KKKAOP8AiTbm/wDDcOnD713dLGP+Aqz/APslFaGuAT+JvDVtjOy4numB7qsDx/zmFFABpv8Ao3jT
XbY8C4itr1fckNE35eUv5iugrn9T/wBE8Y6HedEuY57B/diBKmfp5Tgf71dBQAVz+s/8jV4a/wCu
tx/6Jaugrn9Z/wCRq8Nf9dbj/wBEtQB0FFFFABRRRQAVz/ib/j+8Of8AYVX/ANEzV0Fc/wCJv+P7
w5/2FV/9EzUAdBRRRQBz/gz/AJF5/wDsIX3/AKVy10Fc/wCDP+Ref/sIX3/pXLXQUAFFFFABRRRQ
Bz/hP/Uat/2Fbr/0Ougrn/Cf+o1b/sK3X/oddBQAVz/jD91pNrff8+V/bTsfRPNVXP8A3wzV0FUd
b08atoWoacTgXVtJDn03KRn9aAL1FZ3h/UDq3h3Tr9hh7i3SR17q5UbgfcHI/CtGgArn9Y/0nxZ4
dtBz5TXF8w9kj8r+c4roK5+x/wBM8carc9UsrWCzX2kbdLIP++WhoA6CiiigAooooA5/Wf8AkavD
X/XW4/8ARLV0Fc/rP/I1eGv+utx/6JaugoA5/wACf8k88Nf9gq1/9FLWzdXcVmitLuJdtiKqlizd
cAD6GsbwJ/yTzw1/2CrX/wBFLWpqVmb22EYWFwGDFJlyrDnjI5U98j0oARtUtljiYCVmlLBY1iYv
8pw3GMjFVTr1ul1Mrbmt1gSdXjjZsKd2S2BwBgfrSQaZeWogmjnjknjEibZSxUIxBCg8n5do6/pU
h0udo70S3CySXNqsJfbj5gHycDt836UATy6rawzNG7P8mA7hCUTPTLdB1H51HJrdlHM8bGU7JPKZ
lhYgP2XIHJNUrjw+ZbiYr5DJOVLtJu3LgAEAA4OQO/TPerB0iQ7/AN6vzX63fTsMcfXigCwNWtWh
DqJWYuY/KEZ37gMkY7cfhQdXtfLjdfNcyBiESJiwCnDZGOMHiqUuj3JeRkmRke5eZoizKrBlAGSO
eMdOhzTTocosbeAi1lMTStyrJjc24FSvK49O/wCFAGld3iw6f9qSRFU7CGdSRhiB0HPeo11izacw
hpMiXyS/lNtD5xt3Yxmm3OnSz6Kli1xvlAjDSuPvFSCSfrimJpbrBJH5i5a9+05x23hsfXigAt9b
hmgMjxSq/nyQpGI2LPtJ5Ax6Dn0q7FdR3FqZ4SSo3dQQQRkEEHkHIrNXSrqGcTxSws8c8skasCAy
yHJBPYg45HpV2ysmtrSWN3DSzO8jsowNzEngeg6fhQBQi1LUI7G0v7kWzW0wjLiNWVow+ADyTnBI
z0qeS9vHjvmgMCfZZSv7xC25Qit2I5yTUUOl3rWdrY3M1v8AZYBGGEaktJsxgEnoMgZq2liyx6gu
8f6U5ZePu5RV5/KgCCG/uo9FbULowtuhWSNIkK8kcKck5ySBVnTbt7u1JmCrcRu0Uyp0DA9vYjB/
Gq76U01jp9nLJ+5twvmhSVLlVwMEdOcH8Kls9NFhfTSQMfImVSyO7MQ44zkk9RgfgKAL9c/4e/5D
niz/ALCsf/pFa10Fc/4e/wCQ54s/7Csf/pFa0AHib/j+8Of9hVf/AETNXQVz/ib/AI/vDn/YVX/0
TNXQUAFFFFAHP+Nf+RVuf+usH/o5K6Cuf8a/8irc/wDXWD/0cldBQBz/AIZ/4/vEf/YVb/0TDV+b
R4pZJilxcwpOcyxxOArnoT0yCfYiqHhn/j+8R/8AYVb/ANEw10FAFRdOtlMwCfJLCsLR/wAOxcgD
/wAeNQHRopIHhmubqZGQRrvcfIAQRjAGTkDk5PFaVUdWeSCwe6imEbwfvMN91wOqn6/zxQBG2jQy
pcia4uJWuFRXdmGflJKkYAA5Ppin/wBlR+aXW5uFVmV5EVgBIwx8xwMgnAzggGs439xJo0upCR98
k8arCn/LNRIqlOf4jznPrjtVg3k91q1vbGG6tY3gmLbyoycpgjBPIyfzoA0bi0jumhMpYrE+8Jn5
WYdM+uOv1qB9Kt3ec5kVZ3SR0U8b1IIb6nAz64qpYQyCe/dry5f7PMURXkyMeWp59eWNZ1rqd4fD
XlPOzX52gS/xFWTzN34LuH1WgDpHtke7iuTnfErIvPGGxn/0EUkVpHEbgqW/fvvfJ77QvH4AVS02
4lmvJUkkLKLWBwD6tvyfxwKk1uaS30mWWFyjhowGHu6g/oaAETRbSNkYb8pbC1Bz/AOAfr1596U6
Som8yG7uYG8tIj5ZXkLnGcqfU1AusTtKx+yKLdbr7KX835s7tu7bjpnHemf2nc3M9jJFEEtJbpow
4kyzAK45XHAJHqegoA2VGFAJJIHU9TVWLTbaPTRp5UyW4XbhzyR9az7TxFHeTwxxpCRPuEYE2XBA
JG9cfKCB2zirem6mdSaXbbtGsJ2SFm5Eo+8gHfHHPvQAsWlolxHNLcXFw0X+rEzghDjGRgDJx3Oa
jfRLd96edcLbOxZ7ZXxGSTk9sgE9gcVp0UAQxxOlzLIZSUcKFj7LjOSPrn9KxX/5KHD/ANgqT/0a
ldBXPv8A8lDh/wCwVJ/6NSgA8d/8k88S/wDYKuv/AEU1dBXP+O/+SeeJf+wVdf8Aopq6CgAooooA
K5/wx+4m12wPBttTlcD2lCz5/OVvxBroK5+L/Q/H1wh4TUdPSRR6vC5Vz9ds0f8A3zQB0FFFFAHP
v/yUOH/sFSf+jUroK59/+Shw/wDYKk/9GpXQUAFFFFABRRRQBz99/wAj9on/AGD77/0O2roK5++/
5H7RP+wfff8AodtXQUAV7/8A5B1z/wBcn/kaz/Cf/Im6H/2D7f8A9FrWhf8A/IOuf+uT/wAjWf4T
/wCRN0P/ALB9v/6LWgDYooooAKKKKACuf8D/APIl6X/1y/8AZjXQVz/gf/kS9L/65f8AsxoA6Cii
igDn9e/0fXvDl70UXclq59FkibH/AI+kY/GugrB8ZRufC13cxqWlsjHfIB1JhdZcD67CPxrcjkSW
NZI2DI4DKw6EHvQA6iiigDn/APj5+IORyLDSyD7GeUf0t/8AOaKPDn+lajr2pdVnvzBEf9iFVjI/
7+CX86KAH+MInPhye7hUtPYOl9Go6sYmDlR/vKGX/gVbUUqTwpLEweN1DKw6EHkGnkAggjIPUGsD
wkTbadcaM5+fSZ2tVz/zywGh/wDIbIPqpoA365vxDPFa+I/DdxcSpDCLiZDJIwVQzRMFGTxknget
dJTJoYrmF4Z4klicbXR1DKw9CD1oAfRXP/8ACIWMH/IMutQ0sdo7O6YRL9Im3Rr+Cij/AIRYyfLd
eINcuI+6fahFn/gUSo360AXtS12w0uRIZpWku5BmK1gQyTSe4Qc49zwO5FUftfii9+a20yx06I9D
fTmWX8Y4/lH4SGtLTdG07R43TT7OKDzDmRlHzSH1Zjyx9yTV6gDn8eMIvm8zQ7r/AKZ7JoM/8Dy+
P++azdR1G+vdW8P2t3o15aTx6iJCyjzoSohlBIkXgckcOFJ7CuyooAKKKKAOX8JX1rbQTaPcTLDq
SXt3J9ml+R2R7iR1ZQfvKVYHIyOa6iqmoaZYarb/AGfULK3u4c5CTxhwD6jPQ+9ZX/CF6MOIjqcC
/wBy31a6iT/vlZAP0oA177UbLTLY3F/dw20I6vM4UZ9Oe9ZH9r6vqn/IF01Yrc9LzUt0YPukQG9v
+BbPbNWbHwvomnXIurfTovtS9LiXMso+juSw/OtegDn/AOyfEcnzS+J1R+u2209FTP0cucfjn3o8
vxVY/MtxpuqxjrHJE1rL+DgupPttX610FFAGB4SiuksL6S8sprOSfULiYQzbdwVnyM7SR+RNb9FF
ABRRRQBz/hr/AEO61nSDwLW9aaIesU/70H6b2lX/AIBXQVz+pf8AEu8WaXqI4ivVbT5z/tcyQk/Q
iRfrKK6CgBGZUUsxAUDJJPAFYPg5TLoI1FwRJqc0l8cjB2yNmMH6R+WPwpfFztLo66XExWbVZlsl
IOCEbJlYe4iWQj3ArcRFjjWNFCooAVQMAAdqAHUUUUAFFFFAHP6z/wAjV4a/663H/olq6Cuf1n/k
avDX/XW4/wDRLV0FAHP+BP8Aknnhr/sFWv8A6KWugrn/AAJ/yTzw1/2CrX/0UtdBQAUUUUAZWpaj
Ja38FutxaW6yRPIXuehIKjA+Yf3v0otNXVraWS4aNwk3kpJbgssxwCNo5Pcjv0PNWJ9PS41GK4lW
N40hePY655JU5/8AHT+dUZNEka1+zCVGhhnE1sj5+VcEFCRzjk4Pbj0oAkudZy1rFaBvNnnMTeZA
7eXhSSCBg56fgc9KtRataTSqis+G3bHMZCvjrtOMHofy4qraaQ8ElvITEjJcNMyxg4wYygGTyeo5
NQWWgNaywg+R5cIYK4DF2yCBkE4GAeo6+1AF2LW7Oa3jmiE7CX/VKIW3SDGcgY6e/SlOtWeYwhlk
aRC6rHEzHAODkY4weOaqzaK72mnIDFJJZw+UVcsFcbQDyORyoqWw0lrO6imLx4WB42VFIG5n3ZHt
2oAnk1e0jVGDO6vEJsxxs22M9GOBwKV9VtUmMZZyFYK0gQlFJxgFuncfnVSHTLyzjiFrNCHNrHby
M6k7SgOGX16ng+1Qy+Hi91M2YnjnlEjvIDvHTIAHBzjr2z3oA04tSt5rjyU8wksyB/LIVmXOQDjH
GDVusiHSZYtV+1Boo18xndotymUHOFZfu8ZHPU47Vr0AFFFFABXP+Hv+Q54s/wCwrH/6RWtdBXP+
Hv8AkOeLP+wrH/6RWtAB4m/4/vDn/YVX/wBEzV0Fc/4m/wCP7w5/2FV/9EzV0FABRRRQBz/jX/kV
bn/rrB/6OSugrn/Gv/Iq3P8A11g/9HJXQUAc/wCGf+P7xH/2FW/9Ew10Fc/4Z/4/vEf/AGFW/wDR
MNRXl8ItR1D7RLqSxxOoU24+RAUU8noOSetAHS1BcWkd00JlLFYn3hM/KzDpn1x1+tZLazNYRWlr
d/Z/tpgEkplm8tfTggHJPPtSyeIR/o7RwxhJolkUzS+XuJJBVTjBYY7kdR60AXn0q3d5zmRVndJH
RTxvUghvqcDPrirD2yPdxXJzviVkXnjDYz/6CKoSavIhlmFsps4p/IeQyYbO4KSFxyAT61HaaoYm
Zbo/u2mucSk9Njn5cY/u5P8AwGgDSitI4jcFS379975PfaF4/ACqqaLaRsjDflLYWoOf4BwD9evP
vVGbxMIchoYkeOJZJY5J9r/MM7VG3k4x6c8VpX1+bWyS4hh88yPGiIW253sAOce9ADDpKibzIbu5
gby0iPlleQucZyp9TVi6s47y0NtMzlTtJYEAnBB/mKy7rxELOaWKWOAPAFMq+fhiSMkINvzcEdcZ
6UkeqywreMzxMBePGjTzCNUUICBnkn6AUAaK6ZAsbIC+GuPtJ5/i3BvyyKjXSIUuI5FlmCRSmaOH
cNisQc44z/EeM4HaqK6zcTXGnSKkcdvKs5mG/P8Aqzjj5eehPbNNi8UwsnmSJFtMLSqsUu9htGcM
MDBx7mgDRi0pIMLHc3KxoGEUYcbY89xxzjtnIFEOk29sGFs0kO6IRNsbrjo3T73Xmo7a5vH1cxXM
SxD7OHCJJvGd3rgc1VkvpU1iaJnkKfa4Y0VWwFzGSc8cj2oA3aKxE1i4ns45XtVhW5t3kiZZdzKQ
ueRgf1qPT9defRDdxwNOsEaKzbvmd8DccAEgDOc/XAoA3659/wDkocP/AGCpP/RqVqabem/t2lxD
w20NDL5ingHrgEdehFZb/wDJQ4f+wVJ/6NSgA8d/8k88S/8AYKuv/RTV0Fc/47/5J54l/wCwVdf+
imroKACiiigArn/E/wDokmk6uOBZXqLKf+mUv7ps+wLox/3K6CqupWEOqaXdafcA+TcxNE+OuGGO
PfmgC1RWT4av5tR0C2luiPtkYaC6A7TRko/4blJHsRWtQBzdzPFb/EOz8+VIvP02SKLewXzH8xDt
XPU45wOcV0lQXljaajava3ttDc27/eimQOp/A1jf8InBDxp+q6vYJ/zzhvC6AegWUOFHsMUAdBWT
f+IrKzujZQrLfagAD9jtFDyDPQtyFQe7lRVX/hFI5uL7WdZvE/55veGJT7HygmR7HNa9hp1lpdqL
awtIbaAEnZCgUZPUnHUn1oAyPO8WXfzR2uk6enYTyvcP+IUIAfozfWjd4vt/mKaJfDuitLbH8CfM
z+Q+tdBRQByMN9cah460vztKvbKS3sLsSiaMFPme327ZFJRs7TxnPHIFddRRQBDeI0llOiDLNGwA
9TisPwdqVnN4d03T1uEF9aWcUVxav8ssTKgBDIcMOR6c10VUNS0TS9YVRqOn29yU+40kYLJ7q3VT
9KAL9UtS1jT9IiV7+7ig3nCKxy8h9FUcsfYAmsz/AIQzSOgfVVT/AJ5rrF2qf98iXH6Vd03w9pGk
StLY6fBDOww0wXMjD3c5Y/iaAKX27xDqnzadY2+nWx+7PqSs8je4gUjA/wB51Pqoo/sjxCfmbxQw
f0SwjCfkcn6c/nXQUUAc/v8AFOnfNIlhrEI6iFTazgewZmRz+KCpfB9tcWnhLTYLqF4J1h+eJ/vK
SScH3rbooAKKKKAGuiyIyOoZGBDA9CKw/B7snh6OwlYmbTZHsHz1IibahP8AvJsb/gVb1c/F/wAS
3xtPF0g1a3Ey+nnxYVvxaMx/9+zQB0FUtX1FNI0a91GQbltoHl2jq2ATge56fjV2uf8AEP8Ap+o6
Roo5Wef7VcD/AKYwkN+shiHuCaALvh3Tn0rw7YWUx3Txwr57f3pTy7fixY/jRWnRQAVz9/8A8Svx
ZY6gOLfUU+wXHoJBl4WP5yJ7l19K6CqWr6amr6VcWLu0ZkXKSr96Jwco491YBh7igC7RWPouuR32
mRveSQ297GTDdQlwNkqnawGe2RkHuCD3rQ+32f8Az9wf9/BQBYoqv9vs/wDn7g/7+Cj7fZ/8/cH/
AH8FAFiiq/2+z/5+4P8Av4KPt9n/AM/cH/fwUAWKKr/b7P8A5+4P+/go+32f/P3B/wB/BQBYoqv9
vs/+fuD/AL+Cj7fZ/wDP3B/38FAFiiq/2+z/AOfuD/v4KPt9n/z9wf8AfwUAWKKr/b7P/n7g/wC/
go+32f8Az9wf9/BQBYoqv9vs/wDn7g/7+Cj7fZ/8/cH/AH8FAFiiq/2+z/5+4P8Av4KPt9n/AM/c
H/fwUAWKKr/b7P8A5+4P+/go+32f/P3B/wB/BQBW13TTq+i3NkknlzOoaGX/AJ5yqQ0b/wDAWCn8
KdompDV9Gtb7y/LeRMSxHrHIDtdD7qwYfhU/2+z/AOfuD/v4K5K91qHwxqt6lu0dwmqDzbGFHBze
EhTHx0D5RvwkJoA1bb/ia+MLq6PNvpUf2SL0MzhXkP4L5ag+7j1roKoaLpg0jSYbQyebKMvNMRgy
ysSzufqxJ/Gr9ABRRRQAUUUUAc/rP/I1eGv+utx/6Jaugrn9Z/5Grw1/11uP/RLV0FAHP+BP+See
Gv8AsFWv/opa6Cuf8Cf8k88Nf9gq1/8ARS10FABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQA
Vz/h7/kOeLP+wrH/AOkVrXQVz/h7/kOeLP8AsKx/+kVrQAeJv+P7w5/2FV/9EzV0Fc/4m/4/vDn/
AGFV/wDRM1dBQAUUUUAc/wCNf+RVuf8ArrB/6OSugrn/ABr/AMirc/8AXWD/ANHJXQUAc/4Z/wCP
7xH/ANhVv/RMNbKWcKvcsRu+0kGRW5B+ULj6YFY3hn/j+8R/9hVv/RMNdBQBmjRokjhEVzcxPFGY
hKrAsUz905BHHbuPWnT6RFPH5X2i4SIxCF0Dgh1HY5BPc8jBrQooAzzo9uZWIklELSCVoARsZxg5
PGeoBxnB9KWbR7Se1NtIHaMzNP8Ae53MSSPockfQ1fqtqMvkaZdzfN+7hdvlbB4Ung84NAEVxpcc
88kqzzwmUBZREwAkA6Z4yPTIwasXFtHcxokhbCSJIMHupBH6is7+2Jw0zCzUwQzxws5m+YltvIXb
23juKl1a6urZrEWwT97crG+5sZBBOOh9KAJJtMjmnklWeeIS481InAEmPXjI444I4pjaPD5xmjmm
im81pQ6EZBYAEYIIxgCo49XkYwytbKtpNN5KSeZ8+ckAlcdCR61DHrU0tnBNNaCGO6iZoik25gQp
bB+UYyAcHmgC0mjW8a24Ekx8hnZSzAlg5ywbI5B/Oli0eBIzE8s8sHlmJYZH+VUPbgAn6kk1XtdU
uLiJFtbXz/LiiaXzJsPllBwOME45ycU+DV2m1V7Mwxptdkw0uJMAE7tpAypx2J6/kAWLXTltrk3B
uJ5pTGI8ysDhQcgcAfn1pH0q3kuzckybzMk3BGNyrtHbpg1eooAorpVuttbwAybII2jTkZwRg549
Kauj26JtjeaP90kRKNgnZja3+8MVoUUAVbSxS0aZxJJLLMwaSSTGWIGB0AHQelZL/wDJQ4f+wVJ/
6NSugrn3/wCShw/9gqT/ANGpQAeO/wDknniX/sFXX/opq6Cuf8d/8k88S/8AYKuv/RTV0FABRRRQ
AUUUUAc/b/8AEq8Y3Ft0ttWj+0x+gnjAWQf8CTyyB/sua6CsrxDp819pm+z2jULRxc2hJwPMXPyk
9gwLIfZjUmn63p+o6fb3kVzGiTIHCSOFZc9VYdiOhHYigDRoqv8Ab7P/AJ+4P+/go+32f/P3B/38
FAFiiq/2+z/5+4P+/go+32f/AD9wf9/BQBYoqv8Ab7P/AJ+4P+/go+32f/P3B/38FAFiiq/2+z/5
+4P+/go+32f/AD9wf9/BQBYoqv8Ab7P/AJ+4P+/go+32f/P3B/38FAFiiq/2+z/5+4P+/go+32f/
AD9wf9/BQBYoqv8Ab7P/AJ+4P+/go+32f/P3B/38FAFiiq/2+z/5+4P+/go+32f/AD9wf9/BQBYo
qv8Ab7P/AJ+4P+/go+32f/P3B/38FAFisTxTbTPpIvrSMveabILyBF6uVB3oPdkLp/wKtP7fZ/8A
P3B/38FH2+z/AOfuD/v4KAH21zDeWsN1byCSCZFkjdejKRkEfgaxNA/4mWqanrjcpLJ9jtD/ANMY
iQT/AMCkMhz3UJWG2oPpr3PhLTrgC4vJc6ZJGwPkwSZMh9vKw5HbBiHeu2s7SCwsoLO2jEdvBGsc
aDoqgYA/KgCaiiigAooooAzbrw9ol9ctcXmj6fcTvjdLNbI7HAwMkjPSof8AhE/Df/Qv6V/4BR/4
VsUUAY//AAifhv8A6F/Sv/AKP/Cj/hE/Df8A0L+lf+AUf+FbFFAGP/wifhv/AKF/Sv8AwCj/AMKP
+ET8N/8AQv6V/wCAUf8AhWxRQBj/APCJ+G/+hf0r/wAAo/8ACj/hE/Df/Qv6V/4BR/4VsUUAY/8A
wifhv/oX9K/8Ao/8KP8AhE/Df/Qv6V/4BR/4VsUUAY//AAifhv8A6F/Sv/AKP/Cj/hE/Df8A0L+l
f+AUf+FbFFAGP/wifhv/AKF/Sv8AwCj/AMKP+ET8N/8AQv6V/wCAUf8AhWxRQBj/APCJ+G/+hf0r
/wAAo/8ACj/hE/Df/Qv6V/4BR/4VsUUAY/8Awifhv/oX9K/8Ao/8KP8AhE/Df/Qv6V/4BR/4VsUU
AY//AAifhv8A6F/Sv/AKP/Cj/hE/Df8A0L+lf+AUf+FbFFAGP/wifhv/AKF/Sv8AwCj/AMKltvDu
h2Vwlxa6Np8E6crJFaorL24IGRWnRQAUUUUAFFFFABRRRQBz+s/8jV4a/wCutx/6JaugrF1zSr+9
u9OvNOubaG5spHYC5iaRGDIVI+VlIPNQ+T4w/wCf7Q//AADm/wDjtAB4E/5J54a/7BVr/wCilroK
5LR9H8V6NolhpcOo6K8VlbR26O9nLuZUUKCcS9eKu+T4w/5/tD/8A5v/AI7QB0FFc/5PjD/n+0P/
AMA5v/jtHk+MP+f7Q/8AwDm/+O0AdBRXP+T4w/5/tD/8A5v/AI7R5PjD/n+0P/wDm/8AjtAHQUVz
/k+MP+f7Q/8AwDm/+O0eT4w/5/tD/wDAOb/47QB0FFc/5PjD/n+0P/wDm/8AjtHk+MP+f7Q//AOb
/wCO0AdBRXP+T4w/5/tD/wDAOb/47R5PjD/n+0P/AMA5v/jtAHQUVz/k+MP+f7Q//AOb/wCO0eT4
w/5/tD/8A5v/AI7QB0FFc/5PjD/n+0P/AMA5v/jtHk+MP+f7Q/8AwDm/+O0AdBXP+Hv+Q54s/wCw
rH/6RWtHk+MP+f7Q/wDwDm/+O1SsdH8V2N3qVxHqOis1/ci4kDWcuFYRRxYH73piIH6k0AXfE3/H
94c/7Cq/+iZq6CuafSPEF9qOmy6lfaYbeyuftO22tZFdyEdQMtIQB8/p2rpaACiiigDn/Gv/ACKt
z/11g/8ARyV0FZniDTJNY0S4sYZkhlcoySOhZQVcMMgEZHy+tUvJ8Yf8/wBof/gHN/8AHaADwz/x
/eI/+wq3/omGugrkrDR/FenzX0keo6KxvLk3DhrOX5WKKuB+96YQVd8nxh/z/aH/AOAc3/x2gDoK
K5/yfGH/AD/aH/4Bzf8Ax2jyfGH/AD/aH/4Bzf8Ax2gDoKiuYEurWa3kzslRkbHXBGDWJ5PjD/n+
0P8A8A5v/jtHk+MP+f7Q/wDwDm/+O0Aan9mQeVNHl9ssqzNz/Eu3H4fIKfeWaXqRq7uhjkEiMhAI
YfXPqayPJ8Yf8/2h/wDgHN/8do8nxh/z/aH/AOAc3/x2gDQTSII5kYSTGJJDKkBYbFc55HGepJxn
FV9P0MQWNvFdTSyPHCYwu4FULDDFeM+vXOKr+T4w/wCf7Q//AADm/wDjtHk+MP8An+0P/wAA5v8A
47QBe/sS3ChElnSMxrFIisAJVUYAbjPTjjFSHS4muUmead1SUzJEzAqrnPI4z3PGcVm+T4w/5/tD
/wDAOb/47R5PjD/n+0P/AMA5v/jtAHQUVz/k+MP+f7Q//AOb/wCO0eT4w/5/tD/8A5v/AI7QB0FF
c/5PjD/n+0P/AMA5v/jtHk+MP+f7Q/8AwDm/+O0AdBXPv/yUOH/sFSf+jUo8nxh/z/aH/wCAc3/x
2qR0fxWdbTVP7R0XzVtmtwn2OXbtLBs/63rxQBd8d/8AJPPEv/YKuv8A0U1dBXJ6vo/irWdFv9Ln
1LRo4b23kt5Hjspdyq6lSRmXGcGusoAKKKKACiiigArKl8MaBPM802h6ZJLIxZ3e0jLMT1JJHJrV
ooAx/wDhE/Df/Qv6V/4BR/4Uf8In4b/6F/Sv/AKP/CtiigDH/wCET8N/9C/pX/gFH/hR/wAIn4b/
AOhf0r/wCj/wrYooAx/+ET8N/wDQv6V/4BR/4Uf8In4b/wChf0r/AMAo/wDCtiigDH/4RPw3/wBC
/pX/AIBR/wCFH/CJ+G/+hf0r/wAAo/8ACtiigDi/E/hnQIYdLMWh6bGX1O2RttpGMqX5B46H0rc/
4RPw3/0L+lf+AUf+FV/Fn+o0n/sK2v8A6HXQUAY//CJ+G/8AoX9K/wDAKP8Awo/4RPw3/wBC/pX/
AIBR/wCFbFFAGP8A8In4b/6F/Sv/AACj/wAKP+ET8N/9C/pX/gFH/hWxRQBj/wDCJ+G/+hf0r/wC
j/wo/wCET8N/9C/pX/gFH/hWxRQBj/8ACJ+G/wDoX9K/8Ao/8KP+ET8N/wDQv6V/4BR/4VsUUAY/
/CJ+G/8AoX9K/wDAKP8Awo/4RPw3/wBC/pX/AIBR/wCFbFFAFCy0PSNNmM1hpdlayldpeC3RGI9M
gdOBV+iigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAoo
ooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiii
gAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKA
CiiigAooooAKKKKACiiigAooooA5/wAWf6jSf+wra/8AoddBXP8Aiz/UaT/2FbX/ANDroKACiiig
AooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKAC
iiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKK
KKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooo
oAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigDn/Fn+o0n/sK2v8A6HXQVz/iz/UaT/2F
bX/0OugoAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKK
KACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAoooo
AKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigA
ooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKAOf8Wf6jSf+wra/+h10
Fc/4s/1Gk/8AYVtf/Q66CgAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooA
KKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAo
oooAKKKKACiiigArn/Est6bzQ7Gz1GewF7ePHLNbpGz7VglfA8xGUcovaugrn9f/AORh8K/9hCX/
ANJJ6AD/AIR7VP8Aoc9c/wC/Nl/8j0f8I9qn/Q565/35sv8A5HroKKAOf/4R7VP+hz1z/vzZf/I9
H/CPap/0Oeuf9+bL/wCR66CigDn/APhHtU/6HPXP+/Nl/wDI9H/CPap/0Oeuf9+bL/5HroKKAOf/
AOEe1T/oc9c/782X/wAj0f8ACPap/wBDnrn/AH5sv/keugooA5//AIR7VP8Aoc9c/wC/Nl/8j0f8
I9qn/Q565/35sv8A5HroKKAOf/4R7VP+hz1z/vzZf/I9H/CPap/0Oeuf9+bL/wCR66CigDn/APhH
tU/6HPXP+/Nl/wDI9H/CPap/0Oeuf9+bL/5HroKKAOf/AOEe1T/oc9c/782X/wAj0f8ACPap/wBD
nrn/AH5sv/keugooA5//AIR7VP8Aoc9c/wC/Nl/8j0f8I9qn/Q565/35sv8A5HroKKAOf/4R7VP+
hz1z/vzZf/I9H/CPap/0Oeuf9+bL/wCR66CigDn/APhHtU/6HPXP+/Nl/wDI9H/CPap/0Oeuf9+b
L/5HroKKAOf/AOEe1T/oc9c/782X/wAj0f8ACPap/wBDnrn/AH5sv/keugooA5//AIR7VP8Aoc9c
/wC/Nl/8j0f8I9qn/Q565/35sv8A5HroKKAOf/4R7VP+hz1z/vzZf/I9H/CPap/0Oeuf9+bL/wCR
66CigDn/APhHtU/6HPXP+/Nl/wDI9H/CPap/0Oeuf9+bL/5HroKKAOf/AOEe1T/oc9c/782X/wAj
0f8ACPap/wBDnrn/AH5sv/keugooA5//AIR7VP8Aoc9c/wC/Nl/8j0f8I9qn/Q565/35sv8A5Hro
KKAOf/4R7VP+hz1z/vzZf/I9H/CPap/0Oeuf9+bL/wCR66CigDn/APhHtU/6HPXP+/Nl/wDI9H/C
Pap/0Oeuf9+bL/5HroKKAOf/AOEe1T/oc9c/782X/wAj0f8ACPap/wBDnrn/AH5sv/keugooA5//
AIR7VP8Aoc9c/wC/Nl/8j0f8I9qn/Q565/35sv8A5HroKKAOf/4R7VP+hz1z/vzZf/I9H/CPap/0
Oeuf9+bL/wCR66CigDn/APhHtU/6HPXP+/Nl/wDI9H/CPap/0Oeuf9+bL/5HroKKAOf/AOEe1T/o
c9c/782X/wAj0f8ACPap/wBDnrn/AH5sv/keugooA53/AIRa4muLWS+8S6vex286TrBMlqqM6nIy
UhVuvoRXRUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUU
AFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRWfqmtWGjJC19M6ecxSNY
4nkZiBk4VAT0HpWf/wAJpon9++/8Ftz/APG6AOgorn/+E00T+/ff+C25/wDjdH/CaaJ/fvv/AAW3
P/xugDoKK5//AITTRP799/4Lbn/43R/wmmif377/AMFtz/8AG6AOgorn/wDhNNE/v33/AILbn/43
R/wmmif377/wW3P/AMboA6Ciuf8A+E00T+/ff+C25/8AjdH/AAmmif377/wW3P8A8boA6CuV8R6n
p8PiTw1HLfWyPFfyGRWlUFAbWbGRnjqPzFWv+E00T+/ff+C25/8AjdeS/Ejw1ovi/wAcaLq1sb1b
eRhFqpGn3APlryGHyZJIBT/vntmgD3hHSWNZI3V0YBlZTkEHoQadXOxeMNBgiSKL7YkaKFVV0y4A
UDgAfu6d/wAJpon9++/8Ftz/APG6AOgorn/+E00T+/ff+C25/wDjdH/CaaJ/fvv/AAW3P/xugDoK
K5//AITTRP799/4Lbn/43R/wmmif377/AMFtz/8AG6AOgorn/wDhNNE/v33/AILbn/43R/wmmif3
77/wW3P/AMboA6Ciuf8A+E00T+/ff+C25/8AjdH/AAmmif377/wW3P8A8boA6CisW08WaPe30FnF
POs85KxLNaTRByFLEAuoGdqscZ6A1tUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAU
UUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRR
RQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFF
ABRRRQAUUUUAFFFFABRRRQBz+s/8jV4a/wCutx/6Jaugrn9Z/wCRq8Nf9dbj/wBEtXQUAFFFVftT
DVTaMqhTD5it3POCP5VMpqNr9dCoxcr2LVFZ1vqbT6rNamMLEu4I/wDeZcbh+tS21750t3uCpDA+
wOT1IHzZrKOIpy2fVr7i5UZx3XmXKKg+1wvBLLBLHLsUk7GB7e1RWWow3dvAxliWaRAxiDjIyM9O
tV7aHMo33J9nKzdti5RRUKXls8vlJcQtJ/cDgn8q0ckt2Sk3sTUVC93bRHElxChzjDOBz6U6SeGE
AySogIyCzAcUueOuuw+WXYkoqle6gkGmy3du0cwTGMNkHkDqPrU6SsbmWMmLYqgjDfNznOR2qfbQ
cuVPXT8b/wCTH7OVuZ/1t/mTUVFFdW87FYp4pGHUI4JFJ9stvO8n7RD5ucbN43Z9MU/aQte4uSW1
iaiqQ1KJ76e0VkDxIGBZxgnnj8Mc1MtyiWkc1xLCm4DLB/lz7E1Ma0JXs9r/AIbjdOS3RPRUazwt
F5qyxmP++GGPzpI7m3mcpFPFIy9VVwSKvnjor7k8r7EtFFFUI5/xD/yHPCf/AGFZP/SK6roK5/xD
/wAhzwn/ANhWT/0iuq6CgAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAK
KKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAoo
ooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiii
gAooooAKKKKAOf1n/kavDX/XW4/9EtXQVz+s/wDI1eGv+utx/wCiWroKACsvWJBZva6gRxCzK3+6
wx/MCtSmyRxzRlJUV0PVWGQayr03UpuMXZ9PVar8TSlNQkm9jDaM2OmafeP9+GQPKfaT736kflUU
6Sx6NYsxQedcCWYyD5fmyRu9skCuhkjSVCkiK6HqrDINDRo0ZjZFKEY2kcY+lcksDuk9LW+en6JL
7zdYrZta3v8An/mzCeOQX5Z5rQSfZ3DJAjAsuOM9RwahYWn/AAi1v9m2edhPLK/e8zIzjvnrW/DZ
21ujJDbxRq33gqgZpEsbSOYSpbQrIBgMqAECoeBk09tU110vbVfd5FLEx030t+AXkiRWU8kilkWN
iyg4JGK5+5Dra6cStnFH50RiSLLOBkfxfzrpyAQQRkHqDVZNPs4wwS0gUN1xGOe9bYrDTrPR9DOh
WjTWqM6yFj9q1Xz/ACt/nHfvx9zA/TrVS1Ee3RBd4xiXZ5nTtt6+2MfhWpBpUQnuZbmKGUyTGRNy
5KjAHf6VJd2Aury1kYRtFEHDowznIAHH4VzfVajgnZXT273mnd/JG3toc1rvb/21rT7zG1PZnVvI
2+T5cW/b08zd/PGKfqW/7RrGzOfIizj0yc/pmt1bW3SDyFgiEJ6oEG0/hUgjjDs4Rd7DDNjkj3q3
gJSvd2v/APb/APyX4ErFJW02/wDtf8jPkbTYpLR1VS4B8nyeuNpz07YrGumZvD/mpFaQW74aNMl5
Cd2evr+ddLDZ21u7PDbxRs3UogBNNFhZhmYWkGW4P7sc062DqVE1orprTzSW+72206dhU8RGDT1d
rfr/AF/w5mMsS6xqWQgY26leBknDZxUFgIzPpX2nb5f2L91v6b+M498VvNbwPIJGhjLqNoYqMgem
fxpHtbeWEQvBG0Q6IVGB+FN4OXNdNbt/e76/12YliFa3kvysc7fiPZrAg2+R+5zt+7v3c/jjGa0b
iCKDWtM8qJI8+aDtXHG3pWiLW3WDyBBGIv7m0bfyp7Rozq7IpZM7WI5XPXFOOCabbavo/S0nJ/nY
HiU9F5/jFL9B1FFFegchz/iH/kOeE/8AsKyf+kV1XQVz/iH/AJDnhP8A7Csn/pFdV0FABRRRQAUU
UUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRR
QAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFA
BRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAc/rP/ACNXhr/rrcf+
iWroK5/Wf+Rq8Nf9dbj/ANEtXQUAFYNvbSXr6lIb25ikjuXSNlmO1AFBHy9COfSt6s19EtpHmJlu
Qk7l5IllKqxIwc47UAUR4ifybb91H5jWqTybyy5LA/KuAfQ8n2pkepPLqJbM3lS3NuEQuV2Bot3I
/mK1rjS4J23K0sB8sRN5LbdyDoD9MnpzzSf2Ta+cJQrBhIkg+bjKrtH6UAVTroW3EjQfMkMks6hu
Yyh2lffLZA+hqu3iORIJWNvHJIiK6iN228sF2klRg/MPrWqumWivdt5WftYAmBPDDGMe3U/nUJ0a
3eN0lluJdwVcySZICkEAfiPqaAK9xrFzZ3McNxBBGSFJdpWCOSSCFYrjIGDzjr+NX767e1WFY4xJ
LNKIkDNgZwTkn6A0y60uC7kdpHlCyKFljV8LIB0BH49sVNdWkd5EEkLKVYOjocMrDuDQBT+3XxuE
tBaxLc7Wdi0h2bQQARgZ5z36YNV49buLt1W0tYyfs/nN5kpGCGKlRgc8r1q2NHt12skk6TAsTMr/
ADtuxnJ79B9McYqSDTLW3kDxIVxCIAM8bck/nknmgDLbW5opprp0X7ILKGdI93zbnJAzx68fgKeN
fk2uq28csoeJU2OwRt77cZK8Ef1q6dGtGCqwcoIFtyu84ZB0z7jJ5py6XDg+ZJNKxdH3yPk/IcqP
TGfzzQBQvNSvgixokUc8d7FC+1yVZWAbrjI64NXNTnuobnTlt9myW52SbjjI2McdD6foKln0y3uB
Lu3hpJVlLK2CGUAAj8hUt1aR3Yi3l1MUgkRkbBBwR/ImgCjbarPMbOWS3RLa8OIiHyw+UsNwxjkA
9OlGo6v9jvEtUEfmGPzC0hYADOAOAeTz9MVPb6Tb20sbo0pSIkxRM+UjzwcD6EjnpnipLmwjuZVm
8yWKVVKeZE20lT2P+eO1AGb/AG7cSxSzQWa+XDarcuJZCp53ZUDB5+U80apqV01pqH2SJQlvGA0h
k2uCVDZUY7AjvWh/ZlsI5kCsFmgWBhuP3ACB+PzHmo7nRra6Mm5pkWVQsiI+A+OAT7j/APXQBoUU
UUAc/wCIf+Q54T/7Csn/AKRXVdBXP+If+Q54T/7Csn/pFdV0FABRRRQAUUUUAFFFFABRRRQAUUUU
AFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQA
UUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABR
RRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAc/rP/I1eGv+utx/6Jatm9uDaWFxchdxhiaT
bnGcAnFY2s/8jV4a/wCutx/6Jat2aJJ4ZIZV3RyKVZfUEYIoAoXmqSW+8R2xlYQCUAE92A6AE8df
wqsdf22SSD7O7vN5SskhKj5dxJGMjoeMZq0mi267y0txI7IE3vKdwAOVwe2D/wDXzSjR7faxMkxm
aQSeeX+fcBgH06cYxjmgComuTz/Z47e2jaaWV4iXkKp8q7sg7ckEe1TW2rvNqjWkkccRDOoR3Ikw
M4YAjDA4zwTjNWItMgieCTdI8kLs4d3ySzDBJ/ChdMhW6WbfKwR2kSNnyqs2ckD8T7DPFAFS4uL5
fEDRWqpIotA+ySQqud56YB5PTNA10NAZBDy9vHNbru5kLnbt6cEMQPxFWrrS4bq6+0mSaOUx+UTG
+3K5zj9ail0wSahYsIo0trJT5eGJJOAAuMcAYB69QKALGoXhsrdHHlAs4TMr7QOD+J6dBWfFrdxc
LbRw28RmmlkiyzsFG0Z3dM8+lad3ZpdiIs8kbxPvR4zgqcEfyJrOk0FRPaGCaWNIpZJnbzCX3MuM
g9+euaACPV7q5uY7a3tYfOxL5peU7UMbBeOMnOfaqw1qRrl7xUcwrZLI8O7hSJCHPuQAfrirjaKv
2y3eKaWKOKKRSySHezOykk+ucHOe5qc6dFbIXtIFaQQCBY3chSoOeTg+p+tAEL6l5t7EiIfKF2IA
6yYDny2Y8dwOB9R7VBDrs/2WG7ubVEgmgeZRHJuYbV3c8DqKuWWkxWtjZW7Es1s3mBgerkEE/wDj
xpzaXAtnFBGoIgiaOMScjBXHzeooAbbXt216ltdW8UZeEyho5C2MEDacgevWq+qay+nyyBUhYRR+
YVMh3uOc4ABx06nj+dGmaZcW999pnwu2HyVXz2l4yD1IGBxx39asXWj213JOzvMouFCzIj4D4GAT
+H/16AIZNVuEnuCLWM28FwkDMZDubds5Ax23+tW9Rvf7PtftTJuiRh5uDyqnjI9cccUp0+BkmUhs
TSrM/P8AEu3H/oIqS4tYrryxKCyxuHC54JHTPrjrQBlXGt3FvFbyPbRxrLGZN0khCdeE3AEA45ye
PrVnT53m1TUlZyUVoti7shQUB4pTotv5QjjknjQKY8I/8BOdv0547j1qxa2MFm8jQKV8wKCM8AKu
0Y/AUAZVpql6zyQskbzSXksUWXO1VXJOeO2Pxz2rUsLw3ccu9AksMrRSKDkZHoeOMEGoTo9tvd1a
VHaUzKyvyjkEEr9cnI6VatbWO0h8uLdyxZmY5LMepJ9aAMXxD/yHPCf/AGFZP/SK6roK5/xD/wAh
zwn/ANhWT/0iuq6CgAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKA
CiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAK
KKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAoo
ooAKKKKAOf1n/kavDX/XW4/9EtXQVz+s/wDI1eGv+utx/wCiWroKAM3V7m5t2sRb7f3t0qPuOMjB
OOh9Krx6zcPYC7eG2ijklMcZeY9iwJPHX5eAM9a0ryzivY0SQupRxIjI2CrDv+pqH+ybcW0MMbSx
+Q5kjdW+ZSc5/wDQjQBSi1u4uBbRxW0ZmmmkiJZ2CjaM7umefTFJPrk0METtbRx7jIru7t5YZHK7
dwXjOCcnFXYNItbeSN08wtHI8oLOT8zDDE5ok0mBh8kk0Ry+Sj4yHbcwP4n60AZ0l/cLqlxcFA8M
UEPkxpcEBmkYqMgDaee/OABirFxq11a+ZC9rE9yrQ7AspCsJH2g5xxgg1aOk2Ziki8siN4o4toY8
KmduO4Iz1+lC6VAATI8ssjPG5kkfLHYcqPTAP8zQBTl1e+ha4zZwMLeSOJ8TH5mcL935exYdavWN
1LcPcxTxoksEgRtjEqcqGBGQOzU6TTreTz9wb99Kkr8/xLtx/wCgipYreOGaeVAd0zBnye4UL/IC
gDnY7/U5dQhUFCTeTxhTIQpVVOAcDt29farkuuvGkCmKJJpDKG3OxVfLfacEDJyenFXY9Jtorz7U
pk3iRpQpb5QzDDED3zSvpcDBSjyxSI0jLJG2GG9tzD6E/wAhQA+zu2vdOW5jj2OwOEc8bgSOuOmR
1x0rOTXpZrVriCzBCyx2+15MHzGYBhwDwMjnvWolrHFZ/ZY2dUClQwY7ue+fX3quNHs0I8uMxqPL
O1DgEocqfrxj6UAVV1a7WRhLbQhIrlLaRlkPJbbgqMdBuHX3qexnnawu5AfMkSecJvJxw7AD6cVY
bTrdvMyG/eTrcHn+NduP/QRUkNrFBE8aA7Xd3bJ7sST+poA5Vby5i0tN0swuJLWCcyfaGYfNIAcA
9OPT6Vq/2/m+MSxKYxceQRlt+d20tjGMA+/Tn2q02i2bRrGQ+1YUgHzfwocj9RT/AOy4Bc+aHmVT
J5piD4Qv64+vOOmaAK9pq8lxqLWskUcRyw8tnIkGDwcEAEEc8E4qO91O4stWn3KHtorMShA2CWLE
Dt6jFXYtLgiuUmDyt5bM0aM+VQtnJH5nr60tzpltdzmWZWJaIwuu7AdT2I/GgBtveTG+NndRRpL5
XmqY2LAjOCOQORx9c1eqrbWEdtK0vmSyysoTfK24hR0A/wA896tUAc/4h/5DnhP/ALCsn/pFdV0F
c/4h/wCQ54T/AOwrJ/6RXVdBQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUU
UUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRR
QAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFA
BRRRQAUUUUAFFFFAHP6z/wAjV4a/663H/olq6Cuf1n/kavDX/XW4/wDRLV0FABRRRQAUUUUAFFFF
ABRRRQBh2eoXkbN5kaSQPfSwK5kO4fO2OMdBjHWo9O1TUZba0jMUMs9x57b3kIChHA5wvvj8BWsN
PgVFQBsCczjn+Mkk/qTTLbS7e1lR49/yGTYC2Qu8gkD2yP50AZr6zcz6c0jQrALiylnhZJCWUqB1
4H94EY9K2LNmext2YksY1JJ7nFQf2Ra/Z4oMPsiga3X5v4GAB/HgVcjjWKJI1+6ihRn0FADqKKKA
CiiigAooooAKKKKAOf8AEP8AyHPCf/YVk/8ASK6roK5/xD/yHPCf/YVk/wDSK6roKACiiigAoooo
AKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigA
ooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACi
iigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooA5/Wf+Rq8Nf9dbj/ANEt
XQV5R8dP+QNov/X63/otq8XoA+v6K+QKKAPr+ivkCigD6/or5AooA+v6K+QKKAPr+ivkCigD6/or
5AooA+v6K+QKKAPr+ivkCigD6/or5AooA+v6K+QKKAPp/wAQ/wDIc8J/9hWT/wBIrqugr5p+Gv8A
yU3QP+us/wD6Ty19LUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRR
QAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFA
BRRRQB//2aBGHfBbhAEAIDcoDQvAOrZ8j2cw4QgWD///2P/gABBKRklGAAEBAQBgAGAAAP/bAEMA
CAYGBwYFCAcHBwkJCAoMFA0MCwsMGRITDxQdGh8eHRocHCAkLicgIiwjHBwoNyksMDE0NDQfJzk9
ODI8LjM0Mv/bAEMBCQkJDAsMGA0NGDIhHCEyMjIyMjIyMjIyMjIyMjIyMjIyMjIyMjIyMjIyMjIy
MjIyMjIyMjIyMjIyMjIyMjIyMv/AABEIAaYCyQMBIgACEQEDEQH/xAAfAAABBQEBAQEBAQAAAAAA
AAAAAQIDBAUGBwgJCgv/xAC1EAACAQMDAgQDBQUEBAAAAX0BAgMABBEFEiExQQYTUWEHInEUMoGR
oQgjQrHBFVLR8CQzYnKCCQoWFxgZGiUmJygpKjQ1Njc4OTpDREVGR0hJSlNUVVZXWFlaY2RlZmdo
aWpzdHV2d3h5eoOEhYaHiImKkpOUlZaXmJmaoqOkpaanqKmqsrO0tba3uLm6wsPExcbHyMnK0tPU
1dbX2Nna4eLj5OXm5+jp6vHy8/T19vf4+fr/xAAfAQADAQEBAQEBAQEBAAAAAAAAAQIDBAUGBwgJ
Cgv/xAC1EQACAQIEBAMEBwUEBAABAncAAQIDEQQFITEGEkFRB2FxEyIygQgUQpGhscEJIzNS8BVi
ctEKFiQ04SXxFxgZGiYnKCkqNTY3ODk6Q0RFRkdISUpTVFVWV1hZWmNkZWZnaGlqc3R1dnd4eXqC
g4SFhoeIiYqSk5SVlpeYmZqio6Slpqeoqaqys7S1tre4ubrCw8TFxsfIycrS09TV1tfY2dri4+Tl
5ufo6ery8/T19vf4+fr/2gAMAwEAAhEDEQA/AOjzTgaZmlBr6Q8AdS03NKDQMcKM0lSW8L3FxHCn
3nYKKltJXElcQqyhSykBhkEjqKlitZ5oJZo4y0cQBc5HGa2dYSGexP2ZeLCQQkjuuBz/AN9ZqtbW
0EuhXc8ctyssYXzE3AI2Txx3rn9veN/M29laVjJqaa1mt4opJU2pMu5DkHIq/Fp9nb2Ed1qMswM3
MUUIG7Hqc1d1a1+1LpFtaEsHiIQtxxxyfwoeIXMktgVF2bZzlGa20sNIkuhZLdXJnJ2CXaPLLfTr
14rIuIXtriSCT78bFTj2rSFaM3ZEypuKuyOlBrRtrG3Wx+238kiQs22NIgN7nueeABTrjTbZraG8
s5ZGt3kEbrIBvQ/hxSdeClYapSauZwcikd+K3ZtK0m11IWM1xdGR2ABULhc9AT3/AA9aw9Qtmsry
a2dgxjbGR39DRTqxqOyCVOUVqJHbT3FvNcRx7ooceY2R8uaWG1nnglnijLRwgF2z0zWhpR/4pvWf
on86itLe3k8O3lxFNdLNFt81NwEb5bjjqfxqZVWm15pFRpppMorSk8Vpx2On2dlazanPOHuhuRYA
PlX1OatNots+vR6eryBGg3+YCPmOOv0pPERuNUnY54kd6bgGtyHTdMv1ngs7i4N1EhYNIoCPjrgd
R+NVrSwtlsBfahLIkLNsiSIAu57nngAf596WIjbUToyuZ6ICasCPir1zp9uLGO+sZZHgZ9jLKBuR
vfHFVh0qo1FNXQnDl0ZA0eDUbLirDGonOatMloqvmoWq0QDTfLBq0xWK1JWx4H8D+G9X8GWGoahp
3m3Mvmb5PPkXOJGA4DAdAKbqGjeAbfSb/ULHRJtRhs4Wkaa3mnaFiOiiQMQ3PBK7tuDuxivJhmlW
cedU1b/F/wDan0NbJ8HRrSoyrSvFtfAt07f8/DJpK6K58N/Duz8j7Tps0ZliExB+1fukPAaXn90O
vL7eh9DhX8N/DlNRewaxfz45VhkO+5KI7AFQz52rncMZIyTgc8Uf2pUX/Ltf+Bf/AGpH9l4P/n7P
/wAFr/5Yc5mm10P/AAjPgC2tUkuLFp3kmmjRbVbp3PluVb92rM2FwAW6ZweMgVMfDHw5E6xCzDbr
cXW9ZrgxrEQSHZw21VIU8kjpT/tSp/z7X/gX/wBqL+y8H/z9n/4LX/yw5ig1o6xpHgeDSHm07SJj
defDAI54bzcnmMAHaPIcrjdjGAxG0HNaOqeC/CmkjSjNpCuLiUxzMr3GTiJ2+RA5OSVHHJ5x1pf2
rU/59r/wL/7UtZThG0lVnr/07X/yw5ymmurTwr8PpDarHpzu10CY1WS4J4IVtwByuCQDnGO+Ko6h
oXgKDSr65tNJkllggaWNWa5CygcBlOfmTJGWXIAIOcGh5tUWvs1/4F/9qEcnwrdlVn/4LX/ywwTR
2roIfDfgmCCNL3QtSluNoLvb6fqGw5GeMbux6ZPP5U668E6Fp4vL+80GFdJtllmLi4mEnlLGjDgy
dS3mDGOw/HT+0a1rumv/AAL/AO1M3luBTt7af/gtf/LDnKTFb9r8OUDWt3daLpk0E0i+bYwSXCS2
6MevmtNtkK8ZGxc845wDQ1rTfBKXVlY6PpkjTz3zWslw9pfTQx7A5cAqyhmBTGA3HLHgGp/tSr/z
7X/gX/2ov7NwP/P6f/gtf/LDOpCK7bSfBfgPXLEXlhpkklufuyO9zGH4Byu4jcOeoyOvPBqnaaB8
Nb0z+VaMqQxNOZZXuYo3jX7zo7ELIo4yykjkeoo/tSr/AM+1/wCBf/ai/s3A/wDP6f8A4LX/AMsO
Uorpo9D+Hd1YajcWulzmSxt/tEkNx9qt32kEqQshUkHaQCOOKzD8PmTXLHTJI9CV7m0luWYWd2dh
Roxt/wCPvn/WdeOnTngWaVf+fa/8C/8AtR/2bgf+f0//AAWv/lhmUGurj8PfDh9VXS/sUhujI0If
/SlheRQSyLKTsLAA5UMSMEdjWfqGl+AP7E1S50rTWku7Wxlu4VuRdxpMqj7yFiokTJXlCR8w55FH
9qVf+fa/8C/+1D+zcD/z+n/4LX/ywxKTNdhL4Y+HduLsS2D5s9iz+W9y4V3xtQFSdzncvyDLfMvH
IzBN4Y8EXOizXelaVvnWdLVY7l7mJkmdlUB0dlYffVsEDI5HWh5pVX/Ltf8AgX/2of2bgf8An9P/
AMFr/wCWHLhzTt5xXXeHvA3hbVdMkubjRo1dLu5gxHcTAbY5nQHlzzhRn3qK10H4Z3hn8u22pDE0
5kmkuYkeJThpEdyFkQcZZSRyOeRQ8zqJ29mv/Av/ALUP7OwX/P6f/gtf/LDmEc5qYPW0uh/Dq7BS
1tWhmjktxIl1FeIyiWTYgKMVILHIB6DIYgjrPa+H/hteaklhBYyNO8kkKk/aljaSMsHQSE7Sw2sd
uc4GenNJ5nV/59r/AMC/+1H/AGdgf+f0/wDwWv8A5YYaMKnSo9V0Hw1aiE/Y9M0y1ubyeGPUL+ad
oY1i+Xa2JlBd2DkfMowvc9dW28IeFbHSjca7pMJJm8u3msJbiUXilQyvHEju/TOV+YjaTkjmp/tK
o/8Al2v/AAL/AO1H/Z+B/wCf0/8AwWv/AJYUxQanuPCnhTUnsLXw9pts016kkv2i5kuGWBI2Cvuj
3qxfcwXaSpB3Z+7gzx+DfC+l6c8niPREimW48iJrSW4k+15GVaOJXZwSM5TkjaxyQM0v7Qq/yL/w
L/7Uf1DA/wDP6f8A4Av/AJYUM0w9K0ZdF+GcUFtL9imkFykkkSQrdyyEIwVwUXLAqSAQQCOcjg4b
c6T8L7QI0lszI1vHdb4jdSKsL52yMy5Cp8pyxwB3xkUf2hV/59r/AMC/+1D6hgf+f0//AAWv/lhm
NUZ6V0Nx4Y+HVrqa6fLYOJ2dIywa5MSO33UaUHYrHIwrMCdy4HIzE/h/4creT2i6dO80XmL8gu2R
3RSzIjj5XcAH5FJbg8cGn/aVX/n2v/An/wDIi/s7A/8AP6f/AILX/wAsJdJh8qxU93O41erCsdI+
H1x4d0zVrnRLqE38PmrbRreTSDABYhVG4qMj59u3kHPIrRh8K/Du51CCxtrEzzzwrcR+TJcOnlMC
VcupKqDtOCSM9O4rGWMqt/Avv/8AtS1gsCl/Fn/4Av8A5YXKKqXfhL4e2E91DdWDRyW0AuJFMlxz
GTgFcH5+eMLk5IGORmnPo3wytrp7aezljkjkWKQsLvZG7KrKrt91SQy4BIyTgc8VP1ur/Ivv/wDt
R/U8D/z9n/4Av/lhr0Vhy+HPBtzNpQ0vSN6XV69pMty1zFJGVgkkwUdlZTlV6jofcGtHSfhzo0kL
Nq2gwROEjIEN1MfmKAuP9YeA2QPb1qvrNW3Nyr/wL/7UPqeB/wCfs/8AwBf/ACwt0VmaR4Y8DapD
GzaJLbvLPLBGkktwu4oT3JHOBnHbkdQakuPDHw8tpfKbTZHky4CRNcyMdhAbAUnOCR+voaj65U/l
X3//AGpq8twqfL7Sd/8Ar2v/AJYX6KpXHhb4eW/kl7AsksayiSOW4dFQ9HZlYhVPPLEDg+hpt34X
8BWV09vJoGqO6Yy0NpfSoeM8MgKn8DVRxVWW0F9//wBqRLA4OOrqz/8AAF/8sL9Fc/rXhPRdDsNQ
1WfwzHLp1qkkqKk9x5jqEQpkBiRly4J28AZOMZq1faL8NtNiikvNOuYvMgFywEd4xijP8UoGTEOv
L7eh9DTeJqr7K/8AAv8A7Un6ngf+fs//AABf/LDWorOm8OfDiDUhYSWEnnGRIi6m6aFXfG1GlB2K
xyuAWBO5fUZq6V4Z8G3kCRXOlIL+e6u4YIYpbhsrDKybmwx2jAXLHAywHGQKSxVV/YX3/wD2ofU8
D/z9n/4Av/lht1Be3Is7Ka4YZ8tS2PU9hWafAulWukyTX+gWsd2wgigVLmYqZXCqc/vOgdj36D8a
vQ+EfAbX/wDZ9xpT2l4WKxxXM8yedjJzGd+2TgZO0kgEbsHinOtX5XaK+/8A4Ang8Dt7Wf8A4Av/
AJYc9F4zOf3tkMeqP/8AWq3F4wsW/wBZFMn4A/1rqf8AhWfhD/oEf+TMv/xdH/Cs/CH/AECP/JmX
/wCLrijUxi+0v6+RCwOE/wCf8v8AwWv/AJYYUXiTSpP+Xnb/ALykVft7y3u1Y286Sheu1s4q9/wr
Pwh/0CP/ACZl/wDi6P8AhWfhD/oEf+TMv/xdbwxOIXxJP5v/ACLWCwfWtL/wWv8A5YS6R/yFIf8A
gX/oJrqK5L/hWfhD/oEf+TMv/wAXR/wrPwh/0CP/ACZl/wDi6mpVqzd+Vff/AMA3p0MDBW9rP/wB
f/LDraK5L/hWfhD/AKBH/kzL/wDF0f8ACs/CH/QI/wDJmX/4us71ey+//gF+zwP/AD8n/wCAL/5Y
dbRXJf8ACs/CH/QI/wDJmX/4uj/hWfhD/oEf+TMv/wAXRer2X3/8APZ4H/n5P/wBf/LDraK8x8c+
BvDmjeDb+/sNO8m6i8vY/nyNjMig8FiOhNenU4Tk5OMl/WvkuxOIw9KFKNWlJtNtapLZRfSUv5jy
DNLTaXNfUnyo4UoNMzTqQDwa29AVbf7Rqkq7ktk+UZxuY8Y/z61hA07NZ1Ic8eUqEuV3Om0y9sLu
aWxjsPs/2pCrOZi/OCRwarWcbQ6JrET8MjIpHuGrDorH6vbZ6aGntno2jori0k1rTbKWyKySQRiK
SPcAV9+fpVqeUaXc6K05GI4mVyDnHGP0rlKTNL6u3o3oP2y3tqdfKfERmZoLqN7Y/Ms37vbt9ema
5WeWS4neaVt0jHLH1NRUtXSo8nb7ialTnOm067u59EjttNnVLuBjuiIXLqTnIz9aq6hNrCG3h1GZ
dskgYRjZng9TisKipWHSlf8AQftvdsb2r/8AI2r/ANdIv6VR8Tf8h66+q/8AoIrPqOSrp0eVp32V
hSqcyfmbOgr9q0vVLGNl+0TKpjRjjdjOcVHpwKeG9aU8EGMEf8CrCPWkqnQbb13af3CjUslpsdja
WA1bRbBrq0mm8oEI9tIgyoONrbiOeO3506zlu5fGqtd25t2ERCR5zhcccjg1z9u+itbIt1DepMvD
NC6kP789PoKbq+prqM0IiiMUECeXGpOTgdyfWuVUZObj01+Rv7RKKfU0fCh/4nk3/XF/5irmlX17
caDFbaXcIl5bsd8RC5kUnORu9M/54rkaK6J4Xmd79jONax0uq3OsxQxw6nKuJDuEY2ZGO521niTg
VmRnFWlJxVwpckbEynzMsk1C55ppY1Gz881SRFxe9OXrUYYZ61l33iS0027a3nguCwAIZUGGB9Mn
8PwrKtWp0Y81R2R14TB18XP2dCPNK17I9B+HUEV18NdPt540lhkWZHR1yrKZXBBB6irl94YuH0bU
tOs9Tna3u7WSFIbxzMI2ZSAVkPz4yedxb2xjFV/hmQPh5pZJwP3v/o16s6h40sLfSb/ULGObUYbO
FpGmt0ZoWI6KJACG54JXdtwd2MV8/Q5vYq21kfQ5lf6/Wt/PL82VdS0LWrz7WYV09Tqdglnd75mP
2cjeCyfJ+8GJD8p2fd68nFC20zUb7UNfsIPsosX1KLzpZHbzUCQwMdq4IbIAHJGOvzdK6S58UaVZ
+R9plmjMsQmINtJ+6Q8Bpfl/dDry+3ofQ4VvFGkR6i9g1wwnjlWGQ+S5RHYAqGfbtXO4YyRknA54
ptK2pzKc0rWMm20DWNKmivLIWNxcK92rxTTPGhSWcyqQwRuRwCNvOevHM114avNQOrG7uIFe/wBN
itPMhVhtkXzSzbc5C/OMfNng8jrVz/hJrC2tkkuLlp3kmmjRbW0ldz5blW/dqGbC4ALdM4PGQKmP
ibSBOsQuw263F1vVGMaxEEh2cDaqkKeSR0pvfUXNO97HPW/hK/KNJKkEM5uLRvm1G4uyUimEjfPL
0yM4UL16nnjpNS06W9vdLmQoFtbhpXDHkgxuvHvlhWNrHjW2g0h5tO843XnwwCOewn3J5jAB2i2h
yuN2MYDEbQc1o6prMukjSjNtcXEpjmZYWycRO3yICTklRxyecdaTa6lL2spK2+pT0/w3c218JppI
jH5d2h2E5/ezB1xkegOff1rNi8HagLC6tnaHf9hktIZXvZ5dxYAZ2txGOBkDd168c9IniLTZDarH
M7tdAmNVicnghW3ADK4JAOcY74qjqHjCxg0q+ubQySywQNLGrQSBZQOAynHzJkjLLkAEHODSly7s
1jUxDdkty1ceGrO7naea41NZGxkQ6pcxJwMcKkgUfgKt6npdvqui3WlXG829zA0DnOW2sMdT3rLh
8UwQQRpew6lLcbQXe30a72HIzxhG7Hpk8/lT7rVtS08Xl/eQQrpNsssxcAiTyljRhwT1LeYMY7D8
d5KbXvHHLSTvuY1/4X1fW5dPi1Sy0FnsponXVwGe4ZY3D4SMoPLLFQDiRgMng1bt/C17DHpqmS3z
a6rd3smGPKS+ftA4+9+9XP0PJ4zZtZvFoa1u7pNMmgmkXzbGCJ0lt0Y9fNZ9shXjI2LnnHOAaGte
OoEurKx0eSRp575rWS4fTLmaGPYHLgFQoZgUxgNxyx4BqE7Am7mhpfhaODw/o9lezXAuLC0SA/Zb
yaOJmCgElVKq4yP4lNVrDTPFVroDaRHNpdr9msTbWl3GzyPJIFCxyMpUCMADJXL5J68c7ukazZa5
Yi8sJJJLc/dkeF4w/AOV3Abhz1GR154NU7Txbol6Z/KvGVIYmnMssMkUbxr950dlCyKOMspI5HqK
TEjnNN8GarHqc1xePEkFx9lWWI6ncXjgQyPJ/rJRkhiV+UBQBnr1PUT6XNJ4psdUVoxBBZzwMpJ3
FneJhgYxjEZzz6VVj8Y6VdWGo3Fq85ksbf7RJDcW0tu+0hipCyKpIO0gEccVlm78Yprljpkmp6Er
3NpLcsw0qU7CjRjb/wAfPP8ArOvHTpzw9WHcgXwpr8/ia11G9uYJY7a+knDm/nYSRMsioot8CKMq
rqMjJbBORk5gHg3W5NO1SyDWlnBcadNaJBDqFxNBJI+AriORcW6rz8ibuGxn5Rnp4/Fmjvqq6X9q
kN0ZGhD/AGaVYXkUEsiyldhYAHKhiRgjsaz9Q8caf/YmqXOlStJd2tjLdwrc2ssaTKo+8hYKJEyV
5QkfMOeRSHqMk8MXltYahpllFZTabKI5reC5lkVkl3ZkG9RuXJG8SAlldi2DxS6N4d1WF7U6jcAw
Q3b3SW5vpboxfu9ir5sihpBku/zYwSAM4zWtL4l0u3F2Jbh82exZ/LhdwrvjagKg7nO5fkGW+ZeO
RmCbxNb3OizXelNvnWdLVY7mF4mSZ2VQHRwrD76tggZHI60PrcXkVNFsPEGmCbT5bLTHsJLu4lNy
l/IJQksruP3fk4yN2Pv9utYd14W1FNA8jVri0trPStJls4Li1EkzyghMSPGEG3AiGUUvkk88DPX+
HtTm1XTJLm4WNXS7uYMRggbY5nQHknnCjPvUNr4v0K8M/l321IYmnMk0TxI8SnDSI7gLIg4yykjk
c8ih7jucdp63njHWr+8hm0qRIxpoMtjdG4gzDcNK6iXYNzbcHGONygnvW6nhfUoLaw8iS08+11O8
veWYKRKJ9g+71HmpnjsevGbq+MNJuwUtb1oJo5LcSJdWMyMqyybEBRgpBY5APQZDEEdbFr4t0W81
JLCC6kad5JIVJt5FjaSMsHQSFdpYbWO3OcDPTmndhd2ITpmsaVY6ZFosttNHaQeTNaXbmNZ+Bh/N
CMysCD2IO45wcEYD+BLkWCyW8FpaTrfm8XTrK8mtYEBiMRVZo1DqT98kIATxt5Jq3qvi66tRCfte
maZa3N5PDHqF+haGNYvl2th1Bd2DkfMowvc9da216Wx0o3GumEkzeXbzWEbSi8UqGV44kLv0zlfm
I2k5I5pCM208M6lpUFje6dHZf2jAZhLbzXc7xypKwZgZ3DuWBVTvK84Pyru4mn0jxHcRWmoTzWE2
pWt811FZ72W3SMxtH5Ql2FicMW3lOTkYAPBc6/fapqmmW3h29sY4Lq2uJ3mu7OSUgxvGmzYJIypB
cghuQVxgGp7TxQLa3vYtbAS7sroWrfZIXk+0koHVo413PypyVG4ja3JAzQGxV0nwvf2mpW19dSWp
k8q+Myxk4WS4mSQBMjlVCkbjgnrjk4ow+CdRj8PX9g01oZrjw/b6WjBmwJY1lDEnbnb864PXg8V0
Mvi3RorG2uxcTSpc7/KjgtZZZTs4fMaKXG08NkDaeDg0Xfi/Q7Jbdpr0mOeFbhZIoXlRIj0kdlUi
NDz8zEDg88GndjuzBuvBV1L4guLgLHNZ3V1FcyNJqd1GIygQFfs6ERyf6sEMxGM8g7edPSdL1zTJ
H05Rp50rz5pRcNI7TssjM4Ty9oVSGb7285C/dGeLcvi3RYdTbT3upBcLOlu5FvIY0kcKUVpAuxS2
9cZIyTgc0Wvi3RbzUksILqRp3lkhUm3kWNpIywdBIV2lhtY7c5wM9OaQutzmf+EM1caXoQZYJLvT
LNrFooNWubNJE+Ta/mxLuz+7GUKkfN14529B8OXGh3ksyC2ZP7Nt7WNEdwN8ZlLctuYKd45JY9c+
9y18WaJePOsd4VEMTTmSaF4keJfvSI7qFkQcZZSRyOeRWdf+PtLttO+128V7ORc28LwtZTxyBZX2
h9hj3FcbsEDDFdoOTQh7hr3h7U9cvIbvfZwyaeizWCZLhrjIJ80lf9X8oAA55LcMq4ZL4Yv7mLUT
IbRZbzVrS+2h2YKkXkblztGT+6bHHOR0yca8/ibSbbUk0+W4kWdmSMt9nkMaO+NqPIF2IxyMKxBO
5eORmfTtasdWkuUspJJPszmORzA6pvBKlQxADEFSDgnHfqKFoK5iDwzejxENQ8yDyf7XN9t3Hd5f
2PyMdPvbufTHfPFdWelZMfiTSpTGsdw7PJcSWwTyJNwkTJYMu3KgAZycDkc8jNCPx74dmjWSK6up
A8QmiCWFwxmTjLRgJlwMjdtzt74o3Vg8yne2s+j6FKs72/2pL957ALJ807NIzhMEcMQzLgZ4Ofo1
7G9sde0yCwjt5bhdPnMnnMY1djJEWbIBwSxJ6Ve/ty9v9amtdMS1nt0gsrmOQ5+aOWSQO2c44RMj
39elW7vVrrSfC8uqajbK11DCXkhhBIJ9OM4HTnnHXpUuCUeZs64YiTfKldu/4mHceDbzEaRSJMj2
qQTFruaBQRnLbIz84O77pI6Y3c8bk/hmyupjNLcamjkAFYNUuYkGBjhUkAHTsKtRazZyRTOZGTyY
lmlWRGQohBIJBAPY/kR2quvibS3u/swnffvWNiYXCqzAFQzYwpO4YyRknA54pxap/C7E1JVqukls
Sa/pb6t4Y1HSoJAklzayQI8hJALKQCT1rlvE3hnxL4igkgaa1ihnsPI8uPUriJLeYhg7bY1Xz1IK
jD4AweDkg9VHr+ny37WaSuZQWUHynCOy/eVXxtZhg5AJIwfQ1BB4ltLyZbe3ttTWZ8hDNpdzEmcd
2aMAfiRVRTlqjCScdHoY1x4a1dtehurX7Nap5sLyXVvfzxsyoFDq9uB5UpIUrvYggEcfIMyaN4Vv
dEv0vbaS3824u7lr5TIxEkLyvJHtyOGTcPl4X55O5zUj+JtR0q80m11mw/ealMkCm1jkcRt5Jdyd
objeMDJHGWyQpNaCeLNGk1caYtzJ9oMrwqxtpBE0iglkEpXYWAByA2Rg+hpu6ZLLd9YyXl/p8hYC
C2kaZl3HLNtKqMY5HzE/UCq50L7Ve/adSvJrsJJvit8+XBHg8fIPvnhTly2GGVC9KzNQ8caf/Ymq
XOlStJd2tjLdwrcWssaTKo+8hYKJEyV5QkfMOeRWnLrDXMslppWye8t5YRdBkbZGrFSw38LvCHdt
zkZUkcjLjKWyCxsUVhf2pqUJsIJ7WN7ySGSe4hhxnagAwmWAyWZOpx1q9p2tWGqGRLWf99EAZbeR
Gjmjz03RsAy5xxkDI5HFDg1qK5foooqBhRRRQAUUUUAFFFFAHJfEz/knuqf9sv8A0aldbXJfEz/k
nuqf9sv/AEaldbWS/iv0X6ndU/3Gn/jn+VM8gUM7BVBZmOAAMkmtH+wNT/59f/Ii/wCNXvCcMbz3
MzIDJGFCMe2c5/lXVV7dfFShPlij5+lh1KN2cP8A2Bqf/Pr/AORF/wAaUaBqf/Pt/wCRF/xrfub+
/uNYm0/TTbRm2hWWWS4RnDFidqgAjH3SSee3BqeXXdOgu/sss5EodY2Ijcojt0VnA2gnI4JB5HrX
N/aEjo+oo5r+wdT/AOfb/wAfX/Gnf2Fqf/Pt/wCPr/jXQReItMnuGgjmlMgd4x/o8gVmTO5VYrhi
MHgEniodP8TWl5pEWoSxzQCRtgi8mRmZueFAXL8DPyg459DR/aL8g+oeTMb+wtS/59v/AB9f8aP7
D1L/AJ9v/H1/xrcfxNpKJC3nyuZt+1Y7aR2+Q4bKhSVwTyCBU51zTRFLJ9qBSK3F07KrECI5w3A5
6Hgc0f2hLyF9R8mc7/Yepf8APv8A+Pr/AI1FcaXe2sXmzQFUzgkMDj8jXbIwdFdTlWGQfahlV1Ks
AykYII4Iq1jZ31RDwsbHB21tNdzCK3jLuecCrv8Awj2q/wDPm3/fS/412OkWNpYh1hTa7HOSck+2
fb/PetWieOlf3VoEMGre8zzn/hHtV/582/76X/Gj/hHtV/582/76X/GvRq5rxFrs2l6nZ2qX+n2M
c0MshlvELAspQBRh167j69KyeYTXQ0jgYydkc9/wj2q/8+bf99L/AI0x/DmrEcWbf99L/jXXr4jt
YLS1fUFltriWBZpYhE8nkAj+MqvyDOeWwOD6GrUms2Md6LPzJGmOAfLhd1UnoGYAqpPuR1HrT/tC
fkH1GJwB8Mazn/jxb/vtf8aT/hGNZ/58W/77X/Guw0fxNBeyG2umMd0bmaGMCF1RwjsAA5G0ttXJ
APrxVlfE2ktHNJ9ocRwxtKXaB1VkXqyEjDgccrnqPUU1mU/IbwCTtqcN/wAIxrP/AD4t/wB9r/jS
f8IxrP8Az4t/32v+Nd6/iDTo4I5S85EjFY1S2kZ3x1KqF3MvT5gMcjmqMvim2tNZngumK2a2sU6S
pBI2NxcEuQCFXCjk4780f2lNdhLAJ9zkP+EY1n/nxb/vtf8AGl/4RjWf+fFv++1/xrvpdd06G9Fo
8z+ZlVLCJzGrNjaGcDapORgEg8j1FaVNZjUe1hPBRW55ivhnWAf+PJv++1/xpLnSL+yh824tmROm
cg/yr0+mTQpPE0cihlYYIIprHzvqhPBxtozyY1C5rf1/QpNMkMsQLWzHg/3PY+3+fryd9qEdq6wg
GW5kH7uFerf4D3PofSvQVenyc7ehzQw1WpU9nCN3/Wvkl1b0XUfdXkNnF5s8gRM4ye5+lZV3YXGt
xh7h/s8Y5hiMYLL7seuSP4R7elW7ezkEwubyUTXAGFwuFjB6hR/U84xVzNZyo/WVasrR7f5tP8Pv
8u2li1l81LCyvUX27XS8opr7299kkruXc/DqCK6+Gun288aSwyLMjo65VlMrggg9RVy+8MXD6NqW
nWepztb3drJCkN45mEbMpAKyH58ZPO4t7Yxiq/wzIHw80sk4H73/ANGvVnUPGlhb6Tf6hYxzajDZ
wtI01ujNCxHRRIAQ3PBK7tuDuxivBoc3sVbayPYzK/1+tb+eX5sq6loWtXn2swrp6nU7BLO73zMf
s5G8Fk+T94MSH5Ts+715OKFtpmo32oa/YQfZRYvqUXnSyO3moEhgY7VwQ2QAOSMdfm6V0lz4o0qz
8j7TLNGZYhMQbaT90h4DS/L+6HXl9vQ+hwreKNIj1F7BrhhPHKsMh8lyiOwBUM+3audwxkjJOBzx
TaVtTmU5pWsZNtoGsaVNFeWQsbi4V7tXimmeNCks5lUhgjcjgEbec9eOZrrw1eagdWN3cQK9/psV
p5kKsNsi+aWbbnIX5xj5s8Hkdauf8JNYW1sklxctO8k00aLa2krufLcq37tQzYXABbpnB4yBUx8T
aQJ1iF2G3W4ut6oxjWIgkOzgbVUhTySOlN76i5p3vY5638JX5RpJUghnNxaN82o3F2SkUwkb55em
RnChevU88dJqWnS3t7pcyFAtrcNK4Y8kGN1498sKxtY8a20GkPNp3nG68+GARz2E+5PMYAO0W0OV
xuxjAYjaDmtHVNZl0kaUZtri4lMczLC2TiJ2+RASckqOOTzjrSbXUpe1lJW31Ken+G7m2vhNNJEY
/Lu0OwnP72YOuMj0Bz7+tZsXg7UBYXVs7Q7/ALDJaQyvezy7iwAztbiMcDIG7r1456RPEWmyG1WO
Z3a6BMarE5PBCtuAGVwSAc4x3xVHUPGFjBpV9c2hkllggaWNWgkCygcBlOPmTJGWXIAIOcGlLl3Z
rGpiG7Jblq48NWd3O081xqayNjIh1S5iTgY4VJAo/AVb1PS7fVdFutKuN5t7mBoHOcttYY6nvWXD
4pgggjS9h1KW42gu9vo13sORnjCN2PTJ5/Kn3Wralp4vL+8ghXSbZZZi4BEnlLGjDgnqW8wYx2H4
7yU2veOOWknfcxr/AML6vrcunxapZaCz2U0Trq4DPcMsbh8JGUHllioBxIwGTwat2/ha9hj01TJb
5tdVu72TDHlJfP2gcfe/ern6Hk8Zs2s3i0Na3d0mmTQTSL5tjBE6S26Mevms+2QrxkbFzzjnANDW
vHUCXVlY6PJI08981rJcPplzNDHsDlwCoUMwKYwG45Y8A1CdgTdzQ0vwtHB4f0eyvZrgXFhaJAfs
t5NHEzBQCSqlVcZH8Smq1hpniq10BtIjm0u1+zWJtrS7jZ5HkkChY5GUqBGABkrl8k9eOd3SNZst
csReWEkklufuyPC8YfgHK7gNw56jI688Gqdp4t0S9M/lXjKkMTTmWWGSKN41+86OyhZFHGWUkcj1
FJiRzmm+DNVj1Oa4vHiSC4+yrLEdTuLxwIZHk/1koyQxK/KAoAz16nqJ9Lmk8U2OqK0Yggs54GUk
7izvEwwMYxiM559Kqx+MdKurDUbi1ecvY2/2iSG4tpbd9pDFSFkVSQdpAI44rLh1LxXevq5jv9Et
BpzrEyzWErhm8iORiXE67RlyOhwB3p6j7kC+FNfn8TWuo3tzBLHbX0k4c387CSJlkVFFvgRRlVdR
kZLYJyMnMA8G63Jp2qWQa0s4LjTprRIIdQuJoJJHwFcRyLi3VefkTdw2M/KM78XjTTI9L0671Ay2
sl3aR3TxrDJKLdHHWRlUiNc5G59o+U+hxStvGiNrmsR3TvHY2M62kUS6bcNNNKUViVIB39W+VVJ2
jfnaRS8g13HSeGLy2sNQ0yyisptNlEc1vBcyyKyS7syDeo3LkjeJASyuxbB4pdG8O6rC9qdRuAYI
bt7pLc30t0Yv3exV82RQ0gyXf5sYJAGcZrUTxXo8psViuZJHvt3kJHbyMx2sFfcoXKbWIDbsbec4
waiTxloLx3UgvHWO2ga5Z3t5UV4l+9JGSoEqjjlNw5HqMjEVNFsPEGmCbT5bLTHsJLu4lNyl/IJQ
ksruP3fk4yN2Pv8AbrWHdeFtRTQPI1a4tLaz0rSZbOC4tRJM8oITEjxhBtwIhlFL5JPPAz1MXi7R
Jbe8mF1IiWYVpRLbyRthyQhVWUFwxBClQdx4GTTh4r0g6eb3zbjYJvIMJtJhP5mN2zydvmZ2/Njb
93npzQx3OM09bzxjrV/eQzaVIkY00GWxujcQZhuGldRLsG5tuDjHG5QT3rdTwvqUFtYeRJaefa6n
eXvLMFIlE+wfd6jzUzx2PXjOpL4u0WKztroTzypcBzGlvaTTSYQ4fdGill2nhtwGDwcHiqPiPxTL
Y6T9t0hrW4U6fPqCyPlkaNEBUjBHVnT8Aad9guyydM1jSrHTItFltpo7SDyZrS7cxrPwMP5oRmVg
QexB3HODgjAfwJciwWS3gtLSdb83i6dZXk1rAgMRiKrNGodSfvkhACeNvJNbaajrml6jp0WrzWF5
bahIYFltLV7cwPsZxuDSPuBCkcYwcdc8WrfxdodybjZeFFgha4Mk0MkSPEv3pI2ZQJEHHzISORzy
KQjCtPDet6PdadeadZ6bNLFFdJPDPqM+A00kb5ErpI8hGzBJC5znA6Ut/wCD9QvoFvpXibVWvvtk
kMN7NbR48oxCNZoxvG1cHdt+Yg/KA3G3F4u0aa0u7g3E8K2gUzJc2ksMgDnCYjdQzbiCFwDkjAye
KQ+MNFW0S5M9wA85thEbOYTebt37DFs3g7fmwV5GD3oYzHs/DOraM1lf6bBYSXiJcRz21xfTlMSu
r7hM6u7MCoBJUbs5+XGKfq3h7Xrpr0wSaZI+q6aljeSSF4xARvzJGmG3jErfIzL90fNycaB8YaTa
xxrdXrTzTSXAiS1sZmZxFJscBFDMSvAJ74LAAdK7+N7GW71O2gkMcNppyX66g1vLLCVYOc/KAGAC
g8NlssBypw+oEcnhS7MWoJHLB/pGrWl5GWY58uHyMhuPvfumx25HI5wQeFbtItNjeSDFvql3eSlW
PKSicKBx94eauc8cHk99abxPpNtqa6dLcsLgsiFhBIYkd/uq0gXYjNkYVmBO4YHIzFF4v0a5vfsV
vcyNcM8sSFraVY2kj3b0DlQpYbWO3OcDPTmi7uF22cvY/Dy6GnS6fdOiLHYSWUF0dSurpm3AAP5U
hCRD5QSq7s5wCAOdnUNO8TavpDxXUOkQXEU9tNbwxXEjq7RSrI2+QoCobaAAEOOuTnAfY+NrBdC0
q61WUx3V3YxXcy29tLIkKsoyzlQ3lpnPzOQODzwa0p/E+kW2qrpstywuC6RlhDI0SO/3UaQLsVmy
MKzAncMDkZWwutznbrwZdz+ILi5KRy2t5dRXUpfVLqMRMoQFRbpiOX/VghmK9eQduDv6Hpt5o+mt
blbeR5L64nciQgBJJncEfLywDAY4HXmktfFui3mpJYQXMjTvLJCpNvIsbSRlg6CQrtLDax25zgZ6
c0W/i7Q7k3Gy9KLBC1wZJoZIkeJfvSRsygSIOPmQkcjnkZOgGZD4c1WLX213dZG8umaC6h3HYltg
BNjbcmQbVJJADZIPCph2keF7vT/7A817c/2dpD2MuwnmRvJ5Xjp+7bk4PI4rZ0rX9P1l5o7R5xLA
FMkVxbS28ihs7TskVWwcHBxg4PoabL4j0uGW4iedxLbzx28kYgcvvfG0BQuWBz1GRweeDgvYdzM8
K+G7zQ5I2uZIHC6VZ2R8pifnh8zceQPlO8Y79eBWzrdjJqeh31jEyrJcQPGrN0BIIGazW8b6As7Q
/apy4kkiG2zmYPIhIaNCEw7jafkXLEDIBHNQXHiW5u7u2i0JYLgXWn3VxD56Mh82N41VWBIK8uwI
IBBHbBp8vNoNScXzLpqRalA91q+n2bNB9quIdl/bxvvxCDuycgErkFASB/rD6VBb2F/fahrNtCLZ
bRtSRpZHYiRdscTYVcYOcY5Ix156V0cdzdQWV3dX8KhomkKCFSxaMfd4GSSR2H5VDo+vW2q2lpIF
eGa5thc+U6sMLwDgkDIBI575B6EVnKCu02dUa0+S8Vp/TMmx8L3Vtq6ySFXto55JkkN7Mx+bdgCL
OxSN2N2T06DPGraeGrKzukuI7jVGdDkCbVLmVT9VaQqfxFNk8VaRG4U3DkFFlLLC5CoxIDsQMKvy
n5jwPxFTya/p8V+tm0reYWVNwjYxqzdFL42hjkYBOTkeoqoy5VaLM6vtqjvNEGu6be3t3o91ZCBn
sbzznSZygZDG8bYIU8jfkDHOMZHWueXwpr0/ia11G9uYJY7a+knDm/nYSRMsioot8CKMqrqMjJbB
ORk56JvE1kLs2v2fVfMD+XuGlXJTOcZ3+Xtx75x3zULaze6Wkt1rywW1ip2K8Ss7FmmZIxgZJypj
7dT+A0UJLV6HPfoc6PButyadqlkGtbOC406a1SCHULiaCSR8BXEci4t1Xn5E3cNjPyjPTaJo8+iX
VzbQGP8AslwskKF2MkUpz5g5HKscPknO5mz1obxZo6XcNs806SS7Bl7SZVRnAKJIxXbG5yMIxDfM
OORWNo/jqG5gurzUGmWFruaG1todKufOCRMVLMMEuPukkKAhO081CfQGdB/Z9z/aV/erLGkssKQ2
5YF1QLuOSvHVmOQDyFHNGn6HDZXJu5ri5vb0qUNxcuCQD2VVAROgztUZ2jOTzUZ8VaKLhIRehy1s
LvzEjZolhIYiRpANqqQrckjpUK+MtDNpPcvdTQpA8aSLcWssUi+Y21DsdQ21jwGxjg88Gq55BY3q
Kw18XaM2nveiefYs/wBmMRtJhP5uN2zydvmFtp3Y29OenNLL4s0eKxt7zz55I7jf5aQ2k0kvyHD5
jVS67Tw2QNpwDgmpA26Kxlv9SuruGawW0n0mYQulwrZLIwcsQQef+WeOP4j17RR+I1iWW4vIpFsj
cSRR3EURdIwh2kyEZ2jIc7iAoA5I737N2uhXN6iore4hu7eO4tpo5oJFDJJGwZWB6EEcEVLUDCii
igDkviZ/yT3VP+2X/o1K62uS+Jn/ACT3VP8Atl/6NSutrJfxX6L9Tuqf7jT/AMc/ypnB+Eut5/wD
/wBmrpq52a80Pwbj7ZeyRfa/ub0Z87ev3V4+8OtRf8LD8Lf9BT/yXl/+JrqxGIpOo3zJfM48Ll2M
nSUoUpNd1FtfkaN1pNydTkv9OvUtppohFMssPmq2CSrAblwwyfUc9KqzeG5JZJ4/t4Fnc3CXM8Zh
y5ddv3XzgAlF42nvz6Qf8LD8Lf8AQU/8l5f/AImj/hYfhb/oKf8AkvL/APE1yudB/aX3nasBmK/5
cz/8Bf8AkW4fDvlfZf8ASs/Z76W8/wBX97fv+Xrxjf19ulU28INJp9raS3dvMtlKz24mtN6bTnKy
KWw/XgjbjFL/AMLD8Lf9BT/yXl/+Jo/4WH4W/wCgp/5Ly/8AxNLmw+3MvvH9SzL/AJ8z/wDAX/kX
LXw7Ha3NpNG8MfkQyxskNusasZCpJAB4xtxjk+prOfwdcJYG1ttUjjWSwWxmZ7XfuVc/MvzjafmP
XNS/8LD8Lf8AQU/8l5f/AImj/hYfhb/oKf8AkvL/APE0OWHf2l94LBZkv+XM/wDwF/5HSRJ5UKR5
ztULn1xT65j/AIWH4W/6Cn/kvL/8TR/wsPwt/wBBT/yXl/8Aia09vS/mX3oy/svH/wDPmf8A4C/8
jqov9cn+8K064IfETwspBGq8jn/j3l/+JqX/AIWZ4b/6C/8A5LSf/EUnWpfzL7xrLMcv+XE//AX/
AJHcVl3+ixahqMdzM4MS20tu8RX7wcqc5zxjb+tc3/wszw3/ANBf/wAlpP8A4ij/AIWZ4b/6C/8A
5LSf/EVLq0nvJfeUsux61VGf/gL/AMi7deDPtk8U9xcWdzN5KwSy3VisrFVJwyZOFbBOSQwJAO3s
dOPSLm11Oaezu4ora4dZJoWgLMWChflbcAoIVeNp7/hz/wDwszw3/wBBf/yWk/8AiKP+FmeG/wDo
L/8AktJ/8RSU6K+0vvKeAzB/8uZ/+Av/ACNmPw0ES0RrrcsF5NdH93jcJPM+XrxjzOvt05rPt/As
MFhd2iyWSCW2e2jlhsFSTawxmRs5c8DptB5yOmK3/CzPDf8A0F//ACWk/wDiKP8AhZnhv/oL/wDk
tJ/8RRz0f5l94fUcw/58z/8AAX/kdFe6TPLcWl1Y3MUFzbRtEGlhMiFG25G0MpzlVwc+tV7zw496
NSMl5899ZLaM3lfdI3/P15zv6e3WsX/hZnhv/oL/APktJ/8AEUf8LM8N/wDQX/8AJaT/AOIo9pR/
mX3iWX49f8uZ/wDgL/yNJ/CEDa0b/FkyvIkr+bZLJMGUAfJIT8oO0cYJGTgjjHTVw/8Awszw3/0F
/wDyWk/+Io/4WZ4b/wCgv/5LSf8AxFNVKS2kvvB5dj5b0Z/+Av8AyO4orgrr4h+Fb2zntLjVN8E8
bRyL9nlG5WGCMhc9DXnPh3xtfWWnQ6FPqctjpoc5ntrdWmVWPzKGJ+UfMzbgCwPTPSs6mKpwaV73
7M7cLkGLxFOU3FxcbaSi1dO+q6tq21uu56l4k8Qi+hv9H0PbcXkKsLycqTFZrjnJ6M55AUdwc42k
VwNtaLaq5LmSaQ7pZW6uf6Adh2rq7fxv4NtdKXS7e+SOyVPLES20oGO/O3OTySepJzVE+IPAB63X
/kOf/Cu3B4qhSfNUkm/XRf13OHGZdjpx9lQoTUet4u79XbbtHZeb1Meiu/8A+Eb0n/n0/wDIj/41
LF4U0uVSy2oxnHMr/wCNer9fp9j576rMqfDqCK6+Gun288aSwyLMjo65VlMrggg9RVy+8MXD6NqW
nWepztb3drJCkN45mEbMpAKyH58ZPO4t7Yxiq/wzIHw80sk4H73/ANGvVnUPGlhb6Tf6hYxzajDZ
wtI01ujNCxHRRIAQ3PBK7tuDuxivDoc3sVbayPo8yv8AX61v55fmyrqWha1efazCunqdTsEs7vfM
x+zkbwWT5P3gxIflOz7vXk4oW2majfahr9hB9lFi+pRedLI7eagSGBjtXBDZAA5Ix1+bpXSXPijS
rPyPtMs0ZliExBtpP3SHgNL8v7odeX29D6HCt4o0iPUXsGuGE8cqwyHyXKI7AFQz7dq53DGSMk4H
PFNpW1OZTmlaxk22gaxpU0V5ZCxuLhXu1eKaZ40KSzmVSGCNyOARt5z145muvDV5qB1Y3dxAr3+m
xWnmQqw2yL5pZtuchfnGPmzweR1q5/wk1hbWySXFy07yTTRotraSu58tyrfu1DNhcAFumcHjIFTH
xNpAnWIXYbdbi63qjGNYiCQ7OBtVSFPJI6U3vqLmne9jnrfwlflGklSCGc3Fo3zajcXZKRTCRvnl
6ZGcKF69Tzx0mpadLe3ulzIUC2tw0rhjyQY3Xj3ywrG1jxrbQaQ82necbrz4YBHPYT7k8xgA7RbQ
5XG7GMBiNoOa0dU1mXSRpRm2uLiUxzMsLZOInb5EBJySo45POOtJtdSl7WUlbfUp6f4buba+E00k
Rj8u7Q7Cc/vZg64yPQHPv61mxeDtQFhdWztDv+wyWkMr3s8u4sAM7W4jHAyBu69eOekTxFpshtVj
md2ugTGqxOTwQrbgBlcEgHOMd8VR1DxhYwaVfXNoZJZYIGljVoJAsoHAZTj5kyRllyACDnBpS5d2
axqYhuyW5auPDVndztPNcamsjYyIdUuYk4GOFSQKPwFW9T0u31XRbrSrjebe5gaBznLbWGOp71lw
+KYIII0vYdSluNoLvb6Nd7DkZ4wjdj0yefyp91q2paeLy/vIIV0m2WWYuARJ5Sxow4J6lvMGMdh+
O8lNr3jjlpJ33Ma/8L6vrcunxapZaCz2U0Trq4DPcMsbh8JGUHllioBxIwGTwat2/ha9hj01TJb5
tdVu72TDHlJfP2gcfe/ern6Hk8Zs2s3i0Na3d0mmTQTSL5tjBE6S26Mevms+2QrxkbFzzjnANDWv
HUCXVlY6PJI08981rJcPplzNDHsDlwCoUMwKYwG45Y8A1CdgTdzQ0vwtHB4f0eyvZrgXFhaJAfst
5NHEzBQCSqlVcZH8Smq1hpniq10BtIjm0u1+zWJtrS7jZ5HkkChY5GUqBGABkrl8k9eOd3SNZstc
sReWEkklufuyPC8YfgHK7gNw56jI688Gqdp4t0S9M/lXjKkMTTmWWGSKN41+86OyhZFHGWUkcj1F
JiRzmm+DNVj1Oa4vHiSC4+yrLEdTuLxwIZHk/wBZKMkMSvygKAM9eptXnw907VrrXLrULSzN5eXK
T2d6sKtPb7Y4wvzEdnQnbkgg89SK1I/GOlXVhqNxavOXsbf7RJDcW0tu+0hipCyKpIO0gEccVVXU
/Emoy3MWmnTIpNPVI7j7RDI4uLgorsiYceWoDKNx3/ePHy8m4XMrU/CGs6pcfbLlLWS5u7KO1vEj
1W7tokZS/wA4WIDzlIf7jbcYxu5yJb/wVeTNcTQPGzrqS3cEKXs1rvT7MsBUyxjehyCeN2QAD1ON
658V6dpsdsuq+bZ3MkCzTQiJpvsyngmV4wyooORvYhflPPBpZfFuiw6mdPe6kFws6W7kW8hjSRwp
RWkC7FLb1xkjJOBzQPoZekeEp7K9sp5RBGiW12kyJcSzsHmkjYYklyz4CEFjjJ6KM4GLB8PtQTRr
rT28jemmS2NtcS6pd3HmF1ChvLf5IBhRlVD9cAgDnsofE2kz6sdNjuJDceY0QYwSCJnUEsiyldjM
ADlQxI2njg4gTxnoLx3Uv2x1jtoGuWd7eVFeJfvSRkqBKo45TcOR6jJfqBQ1Xwve3mo3d7bS26t5
VkbZHZgDJbyvIVfA4U7gMjJHJxxgs1jQtb12ytZ7xLOK8tLszRWtrfzwqUMbIVNwihwfmLZCAfwk
H71Tah4+0m1sPtNstzdEXMELRC1mV9srhRIq7MsmNxDAEMRtByRWjN4p0i31JdPlnlWcyJEW+zSm
JJHxtRpQuxWOVwpYH5hxyKbuwOel8I38elWcdtZWT3CPM8mNXvIJEMjbvluhukccfMGADEA4XAFW
rjwtqdz4f1W1ub2K51C60tLCOeQkBiEbLMAOMu5JxngCn6rr2rnWotP0t7GFZL4WXnXEDTYYW7zO
dqyJnogHIx83WprLxBd2F5q1pr9xZyCwjhl+02du8YYS7gI/LLOd+V4AJLb1wM9VvqIUaZrWr3dm
dZt7CztbNmlSO0u3naWQoyAktGm0AMxxhsnHTHONo3ga8sITBcRWcot7GS0gkur+6vEm3ADLQOQk
SkLyq7uuAQBz0n/CWaN/ZxvfPm2Cb7OYfssvn+bjOzydvmbsfNjbnbz05qWx8S6TqTRLaXfmNKkr
oPLYZETBJM5HBDMBg8/kaAOat/CetmxuQ80cDLLbT2lpJqdxexiSJ95LSSqHUNwu0AhcbuTxWu+m
a1qV3pN3qS6dC1nfNOYbeR5AsfkvGBvZRvbc+fuqAOOcZM83jHQre3tbh7uQw3MC3KyJbSuqRN92
SQhT5Snn5n2jg+hxFa+MLGafXFnjnt49KuBA0jwyYlyqkbflG5izbQq7iflI+8uQDnF03WNH8UaX
DZJY3F15OqT+XNK0aMklzG4G8IxUgOuflPQjvmpz4J1WHTtSsYZ7OVL7RhZNK7shScGU5ChT8hMp
75GOhrov+Et0Y2H2wTXBXzvs/kizmM/mY3bPJ2eZnb82Nv3eenNaFjqlpqenLf2cjS27BsHYwYFS
QwKkbgwIIKkZBGMZp36jbuzmrvw1q0t7eW8LWX9m319b3s07yMJojH5eUVNpDZ8kYYsu3ceDgZkt
/C17DHpqmS3za6rd3smGPKS+ftA4+8PNXP0PJ4zpHxdoa2aXf2xjA1q95vEEh2xJ95mG3K4ORhsH
IIxkGoD458PqXDXVwpjI3g2U4KKekh+TiM4P7w/Jx96hPW4Xe5l6X4d8QeH4bT+zv7MnmbTbayuD
czSKsLwgjegCnzAdx+UlPu9eeJr3w3q01/ewRNYnTr++t76adnYTRGPy8oqbSGz5Qwxcbdx4OBm0
usa1d3uqQWFvayCzvWgG/IOz7Msik/NyfMcD6fnV/VtabRdOtbi5geSSWaKF1hRmwWIBI2gnjnA7
8DqRQ42V2OMZSlyx3MiDwpdxxabG8kGLfVLu8lKseUlE4UDj7w81c544PJ752jeBrywhMFxFZyi3
sZLSCS6v7q8WbcAMtA5CRKQvKru64BAHPY/2vZeTPKZcLBKIZMqcq5xgYxnncuPXIqvb+I9Murv7
NFM28u8YZonVC6khlDEYLDB4znAz05pOSZXs5tbbGZ4c0jWtK+2yTCMJIsawWTarPdopBO5/NlTc
uQQNoGBt9zhuoeHtUufEK69G1n9stJFjs4WY+W0ByJPMbbkOdzYIB24A6M+dWDxHp1z53kvO/lRm
UBbeQmRB/FGNuZB05TPUeoqu3iI31tcxaRaXpv1hZ4VvNOuII2YDgFnRR1xxmmouWqIknF2ZRtPC
93B/ZW97c/ZNWur6TBPKS+ftA4+8PNXP0PJ4yujeGb3TtXtruaWBo4hqG4IxJ/f3KypjjsqkH36Z
61fn19NIjxrO5ZpZpBbxWlvJPI8an72yMM3AIycYGR0yKW78XaHZC3aW9JjnhW4WSKF5USI9JHZV
IjQ8/MxA4PPBpttOwr6GvNGZYHjBwWUiuOurS5sNH0PTjNbpqyAWkaxSZLxbdjMAQDgDa5GOCoGa
2pfFuiw6m2nvdSC4WdLdyLeQxpI4UorSBdilt64yRknA5p8XiTSLjVzpsc8jXIdogxt5BEzqCWRZ
SuxmGDlQxI2njg4zcbmtOq6Zhz6feHX9R0/TI7VYm023t280lfKQmUAqADnA/h4z6innwldJqm5W
WS0aaOYs95Mu3aF48lTsY/LwSR15BxzpJ4y0F47qX7W6x20DXLO9vKivEv3pIyVAlUccpuHI9Rmp
qHj7SbWw+02y3N0RcwQtELWZX2yuFEirsyyY3EMAQxG0HJFJQWhr9bqbI0T4ZsTdm6NzqvmGTzNo
1W5CZzn7nmbce2MdsU/xDpc2r6dDbQtGGS8tp28wnBWOZHYcA84U496Z9r1pLyV2so5LJWcoI8CV
0CIVxuYDcWMg5x0HTqbWna1Yao0iWs/7+LBlt5EaOaPPTdGwDLnHGQMjkcVvJS3epyp9Tlr3wXdT
eI7q5VUms7u6iunaTU7qMRFQgK/Z4yI5P9WCGLDGeQ23mC48E6iv2a4iMc88M17mFNTuLEFJ5/NU
+ZCN2QAAVIIOevAz39FZgcVH4Hk+walYmaCGG70eHT0aIuSjr5u4/MS2394uMsScHkdarweDNQeK
R54reGdp7Nvn1S6viyQziRvnm+7kA4UL16sc8d7RTuO5yFx4a1OPVLjVbNrSS4XU/tsEM0rIjobZ
YGVmCkq3BIIDdAO/EWseHNZ1WbT9SmW2e/hililtrfU7myjCuysMTRAu23YAcqA2c4XGK7SikLzM
zTdNk0rw7Bp9uIRNBbiNAC+zcB6sWbGfUk/WoF0OZdMsdOi1Ge3toIgkxhAEkxAAOXOSoPOSoDZI
IZcc7VFUptbCsVrGxt9OtFtrWMpGpJ5YszEnJZmOSzE8kkkk8mrNFFJtvVjCiiikByXxM/5J7qn/
AGy/9GpXW1yXxM/5J7qn/bL/ANGpXW1kv4r9F+p3VP8Acaf+Of5Uzgtc/wCR68Kf9vf/AKKFb19e
x6fbedIjvllREjALOzHAAzgck9yBWDrn/I9eFP8At7/9FCt3UUWSxkV7OS7Bx+6jKhjz1BZlAI65
yCMcc1pS+OXr+iMsb/Aof4H/AOlzJbaV54Fkkt5bdjnMcpUsPrtJH61LXH32kanfQWhu4bma3jaU
C2UwSSKpI2F/NyjEAEZyTz1PNbyWVynh37FFO6XQtjGsrvuKttwCWAGcHvgV0SglqebGbbsaVFc0
NMZtFuILXRjZOxi82MtGPtIVgXHysRyMjLEZzzxUCaFJM0KtpiQWJv8AzfsblCI4/KKnKgleW5wM
9c+tNQXcXtH2Osork7bw67z20V5YRSWcP2sLG+1lVWkBjAX0wOPT2qnN4e1GeCwW7iuZTHZxwqIn
gJgkGcsWkDEZyvzJk/L3wKfs13B1Guh3FQw3UM808UT7ngYJIMEbSQD+PBFY39nOmttNc6c18WaM
wXRZP9HUAAjJIYcgn5Qc5qjfaFcNc6x9msdr3bpItzF5QLRjZviy3OW2t1BU55PWkoLuDqO17HW0
VyNv4dk8mziNrMLYXvmyQTmEbU8tlPyxgIASeQM5zk9TXWRokUaxxoqIgCqqjAAHQAVMopFQm5dB
1FFFSaBRRRQAUUUUAFFFFABRRRQAUUUUAFcx8Q/+RF1L/tl/6NSunrmPiH/yIupf9sv/AEalY1/4
UvR/kd2V/wC/Uf8AHH80dPV6z/1J/wB6qNXrP/Ut/vVpLY4o7nLfDqCK6+Gun288aSwyLMjo65Vl
Mrggg9RVy+8MXD6NqWnWepztb3drJCkN45mEbMpAKyH58ZPO4t7Yxiq/wz/5J7pf/bX/ANGvXW1j
Qk/YxXkj0szdsdWf9+X5s5HUtC1q8+1mFdPU6nYJZ3e+Zj9nI3gsnyfvBiQ/Kdn3evJxQttM1G+1
DX7CD7KLF9Si86WR281AkMDHauCGyAByRjr83Su9rP1HWdP0nyxd3AWWXPlQIpkllx12RqCz4zk4
BwOa05ObQ5VWlaxg22gaxpU0V5ZCxuLhXu1eKaZ40KSzmVSGCNyOARt5z145muvDV5qB1Y3dxAr3
+mxWnmQqw2yL5pZtuchfnGPmzweR1qzb+KYJNYvbC5tp7MWlol1JLOhVVVt2QzY2DAUHO45yR/Ca
evi7RTZy3T3MkMcTRq4nt5InXedqHYyhtpPAbGODzwaH5j5ql72MS38JX5RpJUghnNxaN82o3F2S
kUwkb55emRnChevU88dJqWnS3t7pcyFAtrcNK4Y8kGN1498sKhi8Q2V5JaC3uvL8y4aBop7aRJCw
jZ9pVtpjOBuyw5HTqDTYvFuizR3Eq3TrFBC07SPBIiPGv3nRioEijjlcjkeopaWDmqXv/WpT0/w3
c218JppIjH5d2h2E5/ezB1xkegOff1rNi8HagLC6tnaHf9hktIZXvZ5dxYAZ2txGOBkDd168c70v
izSIFiaWW4RZF3ktaSjy0yRvk+X92pIOGfAIBIOBUWi67Pq2vaxbgbLSxlECq1pIjM21WLeYxCkc
kbQM4w2cEVLSbuaqvWSbJ7jw1Z3c7TzXGprI2MiHVLmJOBjhUkCj8BVvU9Lt9V0W60q43m3uYGgc
5y21hjqe9Zuk+J4LtmgumEdx506LtjYIQjsAAx4LbVyRnPU4xU3/AAlOlm1juVe4eOXJjCW0rM6g
AlwoXJXkfNjHIGauU+ZasxlRqKWq1MG/8L6vrcunxapZaCz2U0Trq4DPcMsbh8JGUHllioBxIwGT
wat2/ha9hj01TJb5tdVu72TDHlJfP2gcfe/ern6Hk8ZlfxWDrssMYlksILaOZmhsZp2l3k4KFARj
oeAc89NpxdXXJNRjxpNrdeaksXmC9sZrceWXAcqZFXJC5PGe3FVBNq6JnGVNrmK+l+Fo4PD+j2V7
NcC4sLRID9lvJo4mYKASVUqrjI/iU1WsNM8VWugNpEc2l2v2axNtaXcbPI8kgULHIylQIwAMlcvk
nrxzKdT1+7u4NKtf7PtdQjt1ub2aeJ5o4wzMqKqK65JKsc7+AvQ54sLr0ukWS/8ACRqsdw1wbeFr
OF5RdfLuDJGu51JAOVOSCp5IwTLIMDTfBmqx6nNcXjxJBcfZVliOp3F44EMjyf6yUZIYlflAUAZ6
9TsXOna9p2o6hPoSabNFqBErC8meMwTBAm4BUbepCqduU5B5+bil4e8cw6ncSC7eRDcXcsNlbLpd
ykgSOTYWckEHqpJwoTJB5Bx0Oq67YaN5IvHmMk2fLit7eSeRgPvEJGrNgZGTjAyPUU2Bz2p+Gtdk
F2ltdWd2dS0yPT7y5uyY2jK7wZVRUKvnzGOzKjgc8nEsnhS7MWoJHLB/pGrWl5GWY58uHyMhuPvf
umx25HI5xoX/AIz0HTo4pZ7x2iltxdCSC3lmVYT0kcopCKeeWwOD6GqfiPxDqFlMYNLNoGH2VWkn
jaQBp5xGpwrLkBQ5xkZ+Xml0sNN9B+laVrenM+mD+zzpBmnl+0GV2nZZGZ9mzaFUgv8Af3NkL90Z
45G+8H3eieD9Wa6WNkstGuLeGc6ndXLSZTG4RSEJCMLyq7uoAIA56621fVNN11rDXLzTZ4DYyXn2
i3t2txAqMobeGkfghsg5H3W4Parrfjyzt9EluNMM7XgnggEc+m3G6PzXCh2i2q5XG7BGAxXaDnih
iXZFe88Oa/qiNeTjTY7yFbVbaKOZ/LlEUyylnbZlN20DaA231btZvfD2sT+I1vrUW1ojTRSyXNvf
zxsVXbvV7cDypiQCu9iCARx8ozqWfifTZbuPT5LtmvMFDILSWOGSRRl1R2BUsMNlAxYbWz901GPG
mhvYw3kc11LDMT5XlWE7tIoAJdUCFmQBhlwNoJxnNNjvoUbnwcNQtdIg1CCzu44b+W9vYp18xJC6
S8AMuGw0i4yBgL7Cqdx4FmhsNQ0jTPs0GkyTx31pCkrwNDMsgd4w0YyqNtyGB3IWOAQAK27vxr4f
siPNviymCO53wwSSosL52yFkUhU+U/MSAO5GRVifxNpNtqg06S4k+0FkRisEjRo7/cV5ApRGORgM
QTuHqMoRz1t4S1G0ihv4ILRdTgvvtSwTajcXKuPKMRVp5QXztYkEIAMAYPJNLQdO1qfy9UtU097m
K71O1uYpJXjQCS5yWQhCWIMfQgbs9RXXR+JtJl1U6atw/wBo3tGrNBIsTuoJZFlK7GYYOVDEja3H
Bw3TvFOkarcNBaXEpk8ozL5tvJEssYIBeNnUCReR8ykjkeopp2GnY5F/h/qKWdnEDDcMdKg0+5H9
qXVrGhjDAsFix5yneflYr06jccaN74Pv7iDWbRHt1t7m7t721ZLmWJ98SxAxsVG5AfK4dWJG7OOO
bNrrus6y9va6cbG1na2W9mnuIWlRIpGYRIEDqSxCkltwA29Dnia28Y21tayJrZ+z3sF6bB1giklE
0oTzF8tVBY7kIIXk5O3JOCV0C5mr4Rvk0mXFjZNeS3aztHJq947gBNgK3ZzIr+4QDaSuOS1b2iWe
raZo1vbXLx3U48xnaS6d9mSSiB2UtIACFLtgnGcHOKJPFujR2MF3588iTlwkcNpLLL8hw+YlUuu0
8NkDaSAcE05vFWirOsQvg+62F35iRu8awkMRI0gG1VIVsEkdPcUeQjm5vBmriw1eKKaxebXLOZb4
sSix3BDbDHhSSnzkEHngN94tnR1jwvd3/wDwkHkvbr/aOkx2MO4kbXXzclsDhf3i9M9DxSXvxD0i
3sjPbR3s8iz28TwNY3EcirM+1X2NHuI4bGBgkbQckVrT+JtJttSTT5riRZ2ZIy32eQxo742o8gXY
jHIwrEE7l45GWtEMNG0qfTr7V5pmjK3l2s8YQkkKIY05465Q+vGKfr1hc6hYRpaeV58VxFOolYqr
bHVsEgEjOOuDTk1/TJFt2W5yLi4ltYvkb5pI9+9enGPLfk8HHHUVQHjfQns4bqOa8limyYvJ0+4k
aRQAS6qqElBuX5wNuTjOeKUrvccZOMuZFaSBbzxcYIZInhRUuLyNWDeXMv3AR2JyD/2yHrVPR9Nv
tRtvLf7OlhHqF1LvDHzGPmyLt24wBzndk9MY71taZrY1LX7q2t2gksVsba7gmj5L+a0vOc4Iwikc
dzUs/ibSLXVRpstw63BdI2IgkMaO/wB1HkC7EY5GFYgnIwORmORdep0LFSSsl2MjRvCtxaS7b1v3
aWzW6yx6hcO7A4GVBIEXC9FJPIwRjnasNAtNNufPhn1F32lcXGo3Ey/98u5GffFV/wDhLtFOpDT1
u3+0vK0EZNvJ5byKCWVX27WK7TnBOCMHB4qBvGejWWnWdxe6h5nnWi3TTQWkuwRkf6xgAxiU843n
sRkkGtI3irLYwq1JVHzSJdY07VBrVpq+kx2k88VvJbPBdzvCpVyrbgyo+CCnTbyD1GOcvVvD2vXT
Xpgk0yV9V05LG8kkLxiAjfmSNMNvGJW+RmX7o+bk43z4g0wJM5uflhuY7WQ+W3EsmzYvTv5ic9Bn
noajj8TaTLqp01bh/tG9o1ZoJFid1BLIspXYzDByoYkbWyODhWsSZEnhS7MWoJHLB/pGrWl7GWY5
8uHyMhuPvfumx25HI5xPpWk63pzPpgFgdIM88v2gyu07LIzPs2bQqkF/v7myF+6M8X9M8T6TrF19
msp5WlMZlTzbaWISxggb42dQJF5HzKSPmHqKlu/EGmWE91DdXDRyW0AuJFMT8xk4BXA+fnjC5OSB
jkZGwbuee33g+70TwfqzXSxsllo1xbwznU7q5aTKY3CKQhIRheVXd1ABAHO5eeHNf1RGvJxpsd5C
tqttFHM/lyiKZZSztsym7aBtAbb6t22p/Gmg2109tPdyxvHIsUha1l2ROyqyq7bdqkhlwCRknA54
qGXxSlzNpS6X86XV69pMtzBJFJGVgkkwUcKynKr1HQ+4NNdgvqb8i3DWjLE8cVwU+VmUuqtj0yCR
+VUdP0OGyuTdzXFze3pUobi5cEgHsqqAidBnaoztGcnml0mbVpIWbVoIInCRkCE5+YoC46no2QPb
1qvpHiW11SGNmjlt3lnlgjSSN13FCe5Uc4GcduR1BpuTi3G44wlKLaWiNuisi48TaXbS+U0sjyZc
BIoHkY7CA2AoOcEj9fQ0tx4k0u38kvcFkljWUSRozoqHo7MoIVTzyxA4PoajmRXsp9jWorHu/Ell
Z3T28lvqjumMtDpdzKh4zwyRlT+BqKXVNQspLi8v0t4NHg8yVpyG3rEI0IJGc53eZkY6Acet8jtd
mZu0VgzeMtEto4pJp7mNJE8wlrKYeUm4rvk+T92hIOGfapAJBwM1m23jRG1zWI7p3jsbGdbSKJdN
uGmmlKKxKkA7+rfKqk7RvztIqQOworGTxXo8psViuZJHvt3kJHbyMx2sFfcoXKbWIDbsbec4waiT
xloLx3UgvHWO2ga5Z3t5UV4l+9JGSoEqjjlNw5HqMgG9RWHF4u0SW3vJhdSIlmFaUS28kbYckIVV
lBcMQQpUHceBk04eK9IOnm98242CbyDCbSYT+Zjds8nb5mdvzY2/d56c0AbVFYTatfajHBd6Clvc
2UkbZeUMrLIJEUqVJBUgeZkEZDLg46U6TXXgu74yW00tnbSJCWtoWldXKbmJVcsR8yD5VJByTxyL
UG1oK5m/Ez/knuqf9sv/AEaldbXFfEC/tNR+GmpXNjdQ3MDGICSFw6kiZARkehrtawStVlfsv1O+
p/uNP/HP8qZwWuf8j14U/wC3v/0UK0vESRNpRMtnbXSrIn/HzF5iRZODIV9FBJ7cZ5HWs3XP+R68
Kf8Ab3/6KFdFcrcPAwtZYopuMNLGXUfgGX+dXS+OXr+iMsar0KC/uP8A9Lmc+NN8PWdnbveadpdz
JMCyNZ6buEi9cqihzjBHOcc+9XE0Tw3Jai5TStLMBTeJPs0e3b1znFVJvCaTLFJJJaTXKvK7fabM
SQnzCCdse4beQMHce+c5rXbTIW0ZtMPywtCYSUVU4IxkADA/AYrpk13PLjF31WhzluPDc9/dD+xr
BLOG3jlDvp2xmLMw4DKCwOBjA5J71Yt7Xw0bJ7m40nTlIlKeWNO2yAn7q7Cu4tjB4HPbipZfDM14
tz9vvIJjJFFGgW12qvlsWBZS7bsk8jjipovDogtUELWcF1HP56NBZiOINt24KBskYJ6tnJ644qm4
9yVGV9iGW08KQ28Uz6PaYlzsRdNLSHHXKBNwx3yOKjnTwdb4L6bp7KYlm3x2G9RG2cMSqEBeDyeK
0p9NvpWtrlL6Fb6FHRpGtyY2ViCRs3gjG0Y+Y++arDw0iWlxbx3TBJbBbIFkyRjd8x5GfvdOOlJN
dWVyvsQyW/hGK8Nq2l2IkEixMRp+UVmxtBfZtGdwxk96etj4Ve9+yLpNh5m4oGNgAhYdVD7dpbg8
A54PpU7+H98V0n2rHn3EM+fL+75ezjrznZ+tR2vhi3tdUa6VbMoZXlB+xr525skgy56ZJxgA9Bn1
Lx7i5ZdiOKy8LXBlEGj2T+WpbcNP+VwOu1tmG/4CTU2neILB9Gs5xBNbrIgEdtHbSMVAA4VVXJUZ
A3AY6Va03TrjT4hatdRyWcaeXDGISrgdtzbjuIHoBWW3hMvbWkUk1lObNWih+02XmL5Zxwyl+W+U
fMCO/FHuvdjtJaxRrrrNhJcRW8cxkklRZEEcbP8AKxIDZAwBx1PTvV+s2x0eOwvfPjddv2aO3CLG
EA2ljnjAGd3QAdK0qzlboaR5uoUUUUiwooooAKKKKACiiigAooooAK5j4h/8iLqX/bL/ANGpXT1z
HxD/AORF1L/tl/6NSsa/8KXo/wAjuyv/AH6j/jj+aOnq9Z/6k/71UavWf+pP+9WjOKO5zXwz/wCS
e6X/ANtf/Rr11tcl8M/+Se6X/wBtf/Rr11tYUP4UfRHo5p/v1b/HL82FZeo6HBf3Auo7i5s71VCr
c2sm1sDoGUgo4GTgOrAbiRgnNalUNS1rT9J8sXlwFllz5UCKZJZcddkags+M5OAcDmt481/dOExL
7w5qN9c6mstxbNFqGmLaPMAVZJFMmCI+QVPmc/MOnvxla9p2rm3bUb1bGG7luNPt4ooZGlQbLkHc
zFVPJfpjgDqc10Fv4pgk1i9sLm2nsxaWiXUks6FVVW3ZDNjYMBQc7jnJH8Jp48XaKbOW6e4khjha
NXE9vJE67ztQ7GUNtJ4DYxweeDUM3jKcbaGb/wAI3qV5qMWoXptYpGuzLLFBKzhI/s7xAKxUFmy2
ei4/DlG0TX5/C91oM39mpCNPazhlSR2aVtu1WYFR5YwOQN/XrxzrReIbK8ktBb3Xl+ZcNA0U9tIk
hYRs+0q20xnA3ZYcjp1BpsXi3RZo7iVbp1ighadpHgkRHjX7zoxUCRRxyuRyPUUtLC5p9jJ17wnd
3+pyXFuEkiubZLeVH1C4tlj27udsXEoIf7pK9OvPG1o2lS6bPqjO0ZS6uRLEEJ4URRpg575Q+vGK
jl8WaRAkTSy3CLIu8lrSUeWmSN8ny/u1JBwz4BAJBwKi0XXZ9W17WLcDZaWMogVWtJEZm2qxbzGI
UjkjaBnGGzginoDc3HXYrr4cu1gs03wZhvrm4fBPKyebtxx1/eLn6Gq8/ha+FhpCwsjz2dmLWVFv
ZbZW4X5g8YyRlehHOc8Y50NJ8TwXbNBdMI7jzp0XbGwQhHYABjwW2rkjOepxipv+Ep0s2sdyr3Dx
y5MYS2lZnUAEuFC5K8j5sY5AzSfK0bueIjK1ipZ+GDG8sU8rLbtZ29uPss8sLhoy5OGDbgPmH8RJ
5z76mm6NbaW8jQTX0hcAH7TfTTgY9BI7Y/Csh/FYOuywxiWSwgto5maGxmnaXeTgoUBGOh4Bzz02
nF1dck1GPGk2t15qSxeYL2xmtx5ZcBypkVckLk8Z7cVpDmcbLY56/PzJ1N2Q6no99HrMuraXFZXL
3Nstrd2l7I0aSopYqQ6q+CN7AgqQQe2OcfSPBNxp93aXSw6XZqNUa+ks7JCsUK/ZmhCodo3HJVid
qdTx66Tanr93dwaVa/2fa6hHbrc3s08TzRxhmZUVUV1ySVY538BehzxYXXpdIsl/4SNVjuGuDbwt
ZwvKLr5dwZI13OpIBypyQVPJGCZ2MijpPha7stVtrm4kgaONdQDeW7bv9IuFlTBwMYUEHng9M9ak
uPD17peoWmoaDtupIoZYHh1TUJ2yrlG3CVhIwwUHy4wc9Rjmr4e8cw6ncSC7eRDcXcsNlbLpdykg
SOTYWckEHqpJwoTJB5Bx0Oq67YaN5IvHmMk2fLit7eSeRgPvEJGrNgZGTjAyPUU35g9Xqct4o8L+
JfEEUlu15atFNYeQTHeXFqkMxDb38uPPnK2VAV2wuDwckG7e+E5tQ0a5tLpbWWS61C3nnSQl42hi
eP5OV5ykZ4xjLH1zWhf+M9B02OKWe8dopbcXQkgt5ZlWE9JHKKQinnlsDg+hpupX2r3GqPZ6NdWF
utvbLPNJdWzXG4uWCqoWRMcIxJOeopLsNbmVceBI4P7VstFjs7DStXtHjuoYk2eTNt2rJGqjBBHD
LlegI5JzBb+DdQaN5JoreC4M9m3zardXxKQziRvnm+7kA4UL16tzxe0XxHeReGrHWvEV7aMmoRQt
BBYafN5gd13bAoeRpDj+6o4Unp0vnxnof2KC7Se4ljn8zYkFlNLKPLO190aoXXaeDuAwSAetAk7a
mJY+Crq01kO6xyWkd3NdRzPqd0xy5chRbZESEFyN2TkA/KC3DJvBV/Hpnh4Q+XNdabYfYpoo9TuL
FHyEywlhG44KfdK4O7PBHOwPF1ompXjSzwnS47K1uYJolZ2lMzyKAoXJbO1doUZJPfNXJfFWkQak
thJPMsxkSIt9ll8pJHAKo0m3YrHK/KxB+YccinrYexgN4Juk0rVrKB7RPteixadDhpMLIvm5J3bm
2/vF5JY8HNaVvpeuabq959hGnvY31ylzLNPLJ5sPyIrqsYXD5CcHeuN3Q45g1XXtXOtRafpb2MKy
XwsvOuIGmwwt3mc7VkTPRAORj5utTWXiC6sLzVrTX7izkFhHDL9ps7d4wwl3AR+WWc78rwASW3rg
Z6q90DM3TvBd1Z64sjrHLZxXc13HNJqd05y5chRbZESkFyN2TkA/KC3DLTwlraJd2++3srSa1a2a
G21GeWJ9zKC6RyLi32rv2ohI+YDOFBrof+Es0b+zje+fNsE32cw/ZZfP83Gdnk7fM3Y+bG3O3npz
Utj4l0nUmiW0u/MaVJXQeWwyImCSZyOCGYDB5/I0xFS80rUbLWP7W0SKylklt0tri1upWhVlQsUZ
XVHII3MMbSCD1GOef1LStS0280SdHtZ9Xvdae7lV2ZYd32WRRGDgkAIiruwTkbtvO2ukm8Y6Fb29
rcPdyGG5gW5WRLaV1SJvuySEKfKU8/M+0cH0OIrXxfYzT64txHNbx6VcCBpHhkxLlVI2/KNzFm2h
V3E/KR95cpdwMK58F6pJLBqWYpb5nuGntodUuLKNfNZW+WaIb227AMFQGzn5cAVfs/CupaZBf/2d
c2ttcSaTBZ2sih2EUyGU7iHLHbmRcZLHg599X/hLdGNh9rE1wV877P5Is5jP5mN2zydnmZ2/Njb9
3npzQ3iCG7ttMm0uRJVvrnyVMispULuMmVOGDAIwweQ3UdqAucpH4J1wNeXW61WeQWbRQz6pc3Q3
QTmUhpZVLANn+FcA9j1N268GXc/iC4uSkctrd3UV1KX1S6jETKEBUW6Yjl/1YIZivXkHbg7cXjLQ
po7mRbx1it4XuGle3lRHiX7zxsVAkUccoWHI9RRN4y0S2jikmnuY0kTzCWsph5Sbiu+T5P3aEg4Z
9qkAkHAzRuO5kW/hnWo9QtImNh/Z9nqVzepKJnMsizLN8pTZhSrS9dxyBnjpTZvCmpR+HNCsYbey
nubC0FvI66hcWTq21QSk0SlipK8oVwflPG3B6C48TaTa6ouny3DidnSMsIJDEjt91GlC7FY5GFZg
TuXA5GcrWfGltDYSSabcRoI7xbSe+u7eQW1qSzKzM3yhgGXbgMMFlyQDmm2wv0I7bSfE+k6mLuBd
O1R5NOtrWeW6vHt3MkRkLNhYnBB8z1HSm3fhzWJ727hT7CNPv723vp5TK5lhaMR7kVdmHB8oYYsp
G48HAzasdcvhZG4vb/S57SSaBbXU7KJmhuBJJsKBBIxVs8btxX5gexFTnxvoCztD9qnLh5Ihts5m
DyISGjQhMO42n5FyxAyARzSYJs460mafX9J0C0u7C6Sw1S5nYRyN9pjQpMD5sRQeWA0gUNkh8qRj
NT6r4d1fw94MvHthp8x/4R5bK9MrsNhhjf5o/kO8Hew2tt6A55IrrJfGWhQw2khuZ3N2jvBHFaTS
SOEIDjy1QsCpPIIyMHI4OIo/FdsdSvi88J0uGxtrqKeMFmkMrSKAMZ3Z2KFAGSTjnIFO72EtrGVJ
4b1maeZbb7AbC7vrPUGlklcSoYvJ3IECEHIiyG3Dk4x3o07wXdWeuLI6xy2kV3NdxzSandOcuXIU
W2REpBcjdk5APygtx1el6vZaxbvNZSORG5jkSWJ4pI2AB2sjgMpwQeQOCD0IqvH4k0qUxqlw7PJc
SWwTyJNwkTJYMu3KgAZycDkc8jI3qNu5i+HvD+s6VqLzOttb2yW7RrawahPLDM+QVZY5FxbqACAq
bhhsc7RmXXvD2p65eQ3m+zhk09FmsEyXDXGQT5pK/wCr+UAAc8luGVcTR+PfDs0ayRXV1IHiE0QS
wuGMycZaMBMyAZG7bnb3xQNevr3WprXS1tZ7dbeyuUkOfmjlkkDnOcHCJke/r0oSu0IrS+GL+5i1
EyG0WW81a0vtodmCpF5G5c7Rk/umxxzkdMnDx4ZvR4iGoeZB5P8Aa5vtu47vL+x+Rjp97dz6Y754
rRu9XutJ8Ly6nqNsrXUMJeSGHJBb04zgdOecdelWotZs5IpnMjJ5MSzSrIjIUQgkEggHsfyI6ihu
zt2L5ZSjzW0NA9K469tZ9H0KVZ3tvtSX7z2AWT5p2aRnCYI4ZgzLgZ4Ofpsr4m0t7v7MJ3371jYm
FwqswBUM2MKTuGMkZJwOakTXdOnvzZrI5lDMqkxMEZl+8qvjazDByASRg+hrN2lszWn7Sm/h8zAe
xvbHXtMgsI7eW4XT5zJ5zGNXYyRFmyAcEsSelMuPBt5iNIpEmR7VIJi13NAoIzltkZ+cHd90kdMb
ueNyDxJZ3k6wW9tqazPkIZtLuYkzjuzRgD8SKzm8TajpV5pNrrNh+81KZIFNrHI4jbyS7k7Q3G8Y
GSOMtkhSat0erK+tz+yaM/hmyupjNLcamjkAFYNUuYkGBjhUkAHTsKl8Q6XLqvhbUtLtnVZbm0kg
jaVjgFlIBY8nv71EnizRpNXGmLcyfaDK8KsbaQRNIoJZBKV2FgAcgNkYPoaztQ8caf8A2JqlzpUr
SXdrYy3cK3NrLGkyqPvIWCiRMleUJHzDnkU3Jvc5utyn4h8HXeo6tLdWqpLHdWiWsqPqdzaLHtL/
ADbIeJgQ5+Viv3fvfNwy/wDBV5M1xNA8bOupLdwQpezWu9PsywFTLGN6HIJ43ZAAPU46KXWGuZZL
TStk95bSwi6DI2yNWKlhv4XeEO7bnIypI5GYv7U1KE2EE9rG948Mk9xDDjO1ABhMsBksydTjrVKD
YrmbpHhKeyvbKeUQRoltdpMiXEs7B5pI2GJJcs+AhBY4yeijOBiwfD7UE0a609vI3ppktjbXEuqX
dx5hdQoby3+SAYUZVQ/XAIA57rTtasNUaRLWf99EAZbeRGjmjz03RsAy5xxkDI5HFX6lpp6hc5LV
fC97eajd3ttLbq3lWRtkdmAMlvK8hV8DhTuAyMkcnHGCzWNC1vXbK1nvEs4ry0uzNFa2t/PCpQxs
hU3CKHB+YtkIB/CQfvV2FFJ6gZHhzSn0fRxbSJGkrSPK6pPLOAzMTzJKS7nnljjPXA6VHBo97HpQ
tk1BrSeWZ5riaFVkfLMWIQuCBgkDJU/KMYHBG3RVKTQWOG8d6Xa6X8N9XjtlfLtE8kksjSO581Bl
nYljwABk8AADgV3Ncl8TP+Se6p/2y/8ARqV1tY3bqyb7L9Tuqf7jT/xz/KmcFrn/ACPXhT/t7/8A
RQrQ8SO66P8Au5ZIy08KFo3KNgyKCAQQRwT0rP1z/kevCn/b3/6KFF/4l0C/jnspk1SdI5mjc2+m
3bASRvg4eNOcMpGQeoq6TtOTff8ARGWNTdCgl/I//S5iXGrPoGoT2MS3F4jCIwJI0krKzbywLAO5
GEz0Y8+nSyviG4Is2fTvs6TMyySXTPEiEMAACY8ndn5dwXPTrxUeltoGrpcWFrFeLJCUnl+0w3EE
2W3BX3yBXP3GGQTwMdOK0pNDsJYYoXjlMUZyI/tEm1znJLjdh8nk7s5rp5os8vlqLZjbXU7i8uJW
itE+xRyPEZTNhyy5B+TbjGRjO7PtWYms3V6uj3b2ht7e5lygjujuP7tjh12YK8Hv6H2raXSrRLxr
pUkEjEkqJn2ZIwTsztz74zQNKs1t7WBIsR2hzANx+Q7SvrzwT1pXiVyy7mdp+u3V7HAZbGKE3Vs0
9uUuC4O3GQ3yDafmHTPf8cyw1y8WHT7zU0OP7PluC0FxkSbdpJZNgG7njB4ya2tH8P2ukQRAF5p0
iERlkdm47hVYkIDxwOOB6VLDoWnQEbIGICOgWSV3VVbG5QrEgLwOBxVc0EyVGbtdlGXxBc2scq3O
nxrcp5LKkdxuVlkfYPm2jBBByMenPpoaZqEt611FcW6Q3FtL5brHIZFOVDAgkA9G9KZHoWnRRPGI
XYOyMTJM7t8hyo3MScA8gZx19auQ2sME08sSbXnYPIck7iAB+HAFS3G2hUVO+rOfutXubjU7AxII
rFb54WkEx3yFUfIKBcbcg/xdhxTrTxTPeQyyxaRcsnkNNBhJRvxyAS0YAJB42l+/tnU/sSw+3LeC
KQSrIZQBM4QOQQW2Z25OTzjvRDolhB5nlJKm9Sny3Eg8sE5IT5vkHT7uOg9Kd422E4zve4tneyXu
ltcKtuZcMNkUxZQw7FioIPqCuQe1Zml6vcTWNjBZ2xuJvsiTym5ucEK2QPm2nc3B7Ae9bNpYW9jA
0MCMEZizF3Z2YnqSzEkn6mq7aFp5igiEUkawJ5aeXPIh2f3WKsNw9jmknHUdpWRm39/ONXM6CYWt
nNHBKVn2jc+P+We3Dj51ySwx2Ges0PiGZ7qIS2SJay3MtssomLMGTdyV29DsPfPPTvV+bR7Ge9F3
JCxlBViBIwRmX7pZAdrEcYJBIwPQU5dLsk8vbDjyp2uE+Y8SNnJ6/wC0eOnNPmjYXLO+5j2nime8
hlli0i5ZPIaaDCSjfjkAlowASDxtL9/bOzpt4b+yWdvJDEkMsMpcKQehJVSD6ggEHioodEsIPM8q
OVN6lPluJB5YJyQnzfIOn3cdB6VYs7G30+AxW6Mqli7F3Z2Zj1JZiST9TSk49BxU09WWKKKKg1Ci
iigAooooAK5j4h/8iLqX/bL/ANGpXT1zHxD/AORF1L/tl/6NSsa/8KXo/wAjuyv/AH6j/jj+aOnq
9Z/6lv8AeqjV6z/1Lf71aS2OKO5zXwz/AOSe6X/21/8ARr11tcl8M/8Aknul/wDbX/0a9dbWFD+F
H0R6Oaf79W/xy/NhWXqOhwX9wLqO4ubO9VQq3NrJtbA6BlIKOBk4DqwG4kYJzWpVDUta0/SfLF5c
BZZc+VAimSWXHXZGoLPjOTgHA5rePNf3ThMS+8OajfXOprLcWzRahpi2jzAFWSRTJgiPkFT5nPzD
p78ZWvadq5t21G9Wxhu5bjT7eKKGRpUGy5B3MxVTyX6Y4A6nNdBb+KYJNYvbC5tp7MWlol1JLOhV
VVt2QzY2DAUHO45yR/CaePF2imzlunuJIY4WjVxPbyROu87UOxlDbSeA2McHng1DN4ynG2hm/wDC
N6leajFqF6bWKRrsyyxQSs4SP7O8QCsVBZstnouPw5RtE1+fwvdaDN/ZqQjT2s4ZUkdmlbbtVmBU
eWMDkDf168c60XiGyvJLQW915fmXDQNFPbSJIWEbPtKttMZwN2WHI6dQabF4t0WaO4lW6dYoIWna
R4JER41+86MVAkUccrkcj1FLSwuafYyde8J3d/qclxbhJIrm2S3lR9QuLZY9u7nbFxKCH+6SvTrz
xtaNpUumz6oztGUurkSxBCeFEUaYOe+UPrxio5fFmkQJE0stwiyLvJa0lHlpkjfJ8v7tSQcM+AQC
QcCotF12fVte1i3A2WljKIFVrSRGZtqsW8xiFI5I2gZxhs4Ip6A3Nx12K6+HLtYLNN8GYb65uHwT
ysnm7ccdf3i5+hqvP4WvhYaQsLI89nZi1lRb2W2VuF+YPGMkZXoRznPGOdDSfE8F2zQXTCO486dF
2xsEIR2AAY8Ftq5IznqcYqb/AISnSzax3KvcPHLkxhLaVmdQAS4ULkryPmxjkDNJ8rRu54iMrWKl
n4YMbyxTystu1nb24+yzywuGjLk4YNuA+YfxEnnPvqabo1tpbyNBNfSFwAftN9NOBj0Ejtj8KyH8
Vg67LDGJZLCC2jmZobGadpd5OChQEY6HgHPPTacXV1yTUY8aTa3XmpLF5gvbGa3HllwHKmRVyQuT
xntxWkOZxstjnr8/MnU3ZDqej30esy6tpcVlcvc2y2t3aXsjRpKilipDqr4I3sCCpBB7Y5x9I8E3
Gn3dpdLDpdmo1Rr6SzskKxQr9maEKh2jcclWJ2p1PHrpNqev3d3BpVr/AGfa6hHbrc3s08TzRxhm
ZUVUV1ySVY538BehzxYXXpdIsl/4SNVjuGuDbwtZwvKLr5dwZI13OpIBypyQVPJGCZ2MijpPha7s
tVtrm4kgaONdQDeW7bv9IuFlTBwMYUEHng9M9akuPD17peoWmoaDtupIoZYHh1TUJ2yrlG3CVhIw
wUHy4wc9Rjmr4e8cw6ncSC7eRDcXcsNlbLpdykgSOTYWckEHqpJwoTJB5Bx0Oq67YaN5IvHmMk2f
Lit7eSeRgPvEJGrNgZGTjAyPUU35g9Xqct4o8L+JfEEUlu15atFNYeQTHeXFqkMxDb38uPPnK2VA
V2wuDwckHpNJ0qazhvnuGjNzdSbiUYsoUIqKASB2UH6k1Bf+M9B02OKWe8dopbcXQkgt5ZlWE9JH
KKQinnlsDg+hpupX2r3GqPZ6NdWFutvbLPNJdWzXG4uWCqoWRMcIxJOeopLsPqZ8vh7W4fB2h6TZ
zwmWzjijvI1vJbUTqse3CzIpdPm2tkAEgYOATWdF4M1a00a2tlis7q4jnuZDINUurWVRLJvGLhA0
hHZlbO4hSTkc6ei+I7yLw1Y614ivbRk1CKFoILDT5vMDuu7YFDyNIcf3VHCk9Ol8+M9D+xQXaT3E
sc/mbEgsppZR5Z2vujVC67TwdwGCQD1oFcxn8Gam13/aT38U2rW+n2sVrdSMwzcRGQuzqBja4faT
y21n6Z5nvPD2sz+IkvrZbWzV5oZZbi31CdGIXbvR7cL5UxIBXexBCkcfKM3B4utE1K8aWeE6XHZW
tzBNErO0pmeRQFC5LZ2rtCjJJ75q5L4q0iDUlsJJ5lmMiRFvssvlJI4BVGk27FY5X5WIPzDjkU9d
BmVc+DhqFrpEGoQWd3HDfy3t7FOvmJIXSXgBlw2GkXGQMBfYVTuPAs0NhqGkaZ9mg0mSeO+tIUle
BoZlkDvGGjGVRtuQwO5CxwCABV3Vde1c61Fp+lvYwrJfCy864gabDC3eZjtWRM9EA5GPm68VNZeI
LuwvNWtNfuLOQWEcMv2mzt3jDCXcBH5ZZzvyvABJbeuBnqt0LYzrbwlqNpFDfwQWi6nBffalgm1G
4uVceUYirTygvnaxIIQAYAweSaWg6drU/l6papp73MV3qdrcxSSvGgElzkshCEsQY+hA3Z6iuq/4
SzRv7ON7582wTfZzD9ll8/zcZ2eTt8zdj5sbc7eenNS2HiXSdSaJbS68xpUldB5bDIiYJJnI4IZg
MHn8jTVxpnHP8P8AUUs7OIGG4Y6VBp9yP7UurWNDGGBYLFjzlO8/KxXp1G440b3wff3EGs2iPbrb
3N3b3tqyXMsT74liBjYqNyA+Vw6sSN2ccc7M3jHQre3tbh7uQw3MC3KyJbSuqRN92SQhT5Snn5n2
jg+hxFa+L7GafXFuI57eLSrgQNI8MmJcqpG35RuYs20Ku4n5SPvLldAMhfCN8mky4sbJryW7Wdo5
NXvHdQE2ArdnMiv7hANpK45LVo6P4d1CIW51a688w200SYneVkMr5xvYBn2oqKHPzHkkDNXf+Et0
Y2H2sTXBXzvs/kizmM/mY3bPJ2eZnb82Nv3eenNDeIIbu20ybS5ElW+ufJUyKylQu4yZU4YMAjDB
5DdR2oEY39geI5vCN14cm/spLddNeygmSWRnmbbsR2BUCMYHIG/k8EY5Z4h8HXeo6tLdWqpLHdWi
WsqPqdzaLHtL/Nsh4mBDn5WK9PvfNxsxeMtBmjuZFvHWK3he4aV7eVEeJfvPGxUCRRxyhYcj1FE3
jHRLaOKSae5jSRPMJaymHlJuK75Pk/doSDhn2qQCQcDNCAwp/A9wdcmkjWOWxuLiG4Yvqd1GItio
Nv2dD5cn+rBDMwxnkNt51LXRta0vRxHp9zai6TULi6aKTPlXEcksjBGbaWQ4dTuAOCvRh10bjxNp
Nrqi6fLcOJ2dIywgkMSO33UaULsVjkYVmBO5cDkZrXXi2wXStTu7Lzbl7HMe3yXRZJtxQRqzABmL
jbhScEj1FAGN/wAIhfXE93eta6Zp1xdXdnNLb2cjPG/kziVpGfYu6RhkfdHQZJ7XLTwvdwf2Vve3
P2TVrq+kwTykvn7QOPvDzVz9DyeM3tH8QedZQR6sY4NSN09lKkStsMygtx12hkG4ZPRgMk0298ba
Bp5cXF3NiMOZGitJpBEqsUZnKoQi7lYbmwDtODwadwuc0NN1jR/FGlw2aWNxdeTqk/lzStGjJJcx
uBvCMVIDrn5T0I75qV/AN4bGeD7XE7G2swjJLJCWlhmklYbl+ZFO8AMpLDrzjnpJPF2iRakbB7p/
PWdLdiLeQxpI4UorSBdi7t64yRknA5qWHxNpM+rHTY7iQ3HmNEGMEgiZ1BLIspXYzAA5UMSNp44O
C+o29Sn4c0a80eCd3toFnurgPKp1G4uiqBQufNlBZzx02oADjtk1IfDmqxa+2u77I3l0zQXUO47E
tsAJsbbkyDapJIAbJB4VMalp4s0W8edYrwqIYmnLzQvEjxL96RHdQsiDjLKSORzyKsaVr2n6y0y2
ckwkh2mSK4t5IJFDZ2tskVW2nBw2MHB54NLrcWxi6R4Xu9P/ALA817c/2dpD2MuwnmRvJ5Xjp+7b
k4PI4qTwr4bvNDkja5kgcLpVnZHymJ+eHzNx5A4O8Y79eBWnL4j0uGW4ie4cS288dvJGIXL73xtA
ULlgc9RkcHng4pt430BZ2h+1TlxJJENtnMweRCQ0aEJh3G0/IuWIGQCOaLjuaWt2Mmp6HfWMTKsl
xA8as3QEggZrB1KB7rV9Ps2aD7VcQ7L+3jffiEHdk5AJXIKAkD/WH0qW48S3N3d20WhLBcC60+6u
IfPRkPmxvGqqwJBXl2BBAII7YNa8dzdQWV3dX8KhonkKCFSxaMfdOBkkkdh+VDp6XZrSqyg1Ff1c
5y3sL++1DWbaEWy2jakjSyOxEi7Y4mwq4wc4xyRjrz0qex8LXVtq6ySFXto55JkkN7Mx+bdgCLOx
SN2N2T06DPGto+vW2q2dpIFeGa5thc+U6sMLwDgkDIBI575B6EUyTxVpEbhTcOcospZYXIVGJAdi
BhV+U/MeB+IrNKKdzolVrtuKX9bDrTw1ZWd1HcRXGqM6HIE2qXMqn6q0hB/EU3XdNvb270e6shAz
2N55zpO5QMhjeNsEKeRvyBjnGMjrU8mv6fFfrZtK3mFlTcI2Mas3RS+NoY5GATk5HqKhPiayF2bX
7NqvmCTy9w0q5KZzj7/l7ce+cd81t709d7HG4uO6OdXwpr0/ia11G9uYJY7a+knDm/nYSRMsioot
8CKMqrqMjJbBORk5gHg3W5NO1SyDWlnBcadNaJBDqFxNBJI+AriORcW6rz8ibuGxn5RnW1PxLqnh
+3W71TT1e3e4S3UWqO75ecoDhQx/1e1sY5Y7RyQK0brxbo1nqS2E9xKs5eONiLaVo43kxsV5AuxG
ORgMQeR6iiS5dCb9Q0TR59Eurm2gMf8AZLhZIULsZIpTnzByOVY4fJOdzNnrU/8AZ9z/AGlf3qyx
pLLCkNuWBdUC7jkrx1ZjkA8hRzUK+KtJm1BtPinkNxukjRmtpVikdASypKV2Mw2tkKxPyt6HFHTv
E8+qeHrQ2ohk1640xL0W6xv5Ssy5G5uiAtkAMwJwcZwaab+8GtLmpp+hw2Vybua4ub29KlDcXLgk
A9lVQEToM7VGdozk81qViy6jqNuII5ooBcXF8YYlHIMIy2ev3tin8SOKnsNdsb64Npue3vlBZrS5
Xy5QBgEhT95QTjeuVJ6E05Rlu9RJmnRRRWYwooooA5L4mf8AJPdU/wC2X/o1K62uS+Jn/JPdU/7Z
f+jUrrayX8V+i/U7qn+40/8AHP8AKmcFrn/I9eFP+3v/ANFCofD1jqlzp0z6ZeWVtjU9R8z7VZvP
u/0uXGNsqY7+ueOmOZtc/wCR68Kf9vf/AKKFX5fCXhqe4kuJvD2kyTyMXkkeyjLOxOSSSMkk96qC
vKfr+iIxTtRw/wDgf/pcxtpDJD4yvxM8bzf2TYrI8aFFZhJdZIUkkDPbJx6moNNuzYeHdTvBGZDB
cXUmwHG7DscVqWGj6ZpXmf2dp1pZ+bjzPs8Cx78ZxnaBnGT+dRW1loz6jcTW9laC8hfbLKsAVwzD
J+bHOQ3610x0VmedO7ehlwap4gltrhfsMJuFWOSMlUHys2D8gmbOACQdy56dq0ZdVZfDE2pwSRzv
HbvIreWyKzKD/CTkcjoTmrA0bS1tXtV02zFu7bniEC7Gb1IxgmrAtoBa/ZRBH9n2bPK2DZtxjGOm
Mdqbkn0IjGSerMG91XWIDZ28MEU11dI82Y4gQijb8uGlTcfm65HT7tSxarqF68McQtbVxarcytKP
NU7iRtUqwGOD82T1HFa11YWd7CsN3aQTxKcqksYdQfoaS50+yvPK+02dvP5RzH5sStsPtkcdBT5l
bYXLK+5zhvL2w1TVrmFrdrf7dBHJG6Es29Y1yGDYGM+hzVi21zVLjUz/AKEq2JuJIAW2KQU3c58z
JPy527BwevHO1FHZXaSukMTq0uXJi+86nGeRzggYPtTlsLNbx7xbSAXTja0wjG9h6FsZ7CnzLsLk
fRmJbavqc2k6fcuLVZtQdEjxExWHKkkt83zZxwOOuMmmXv8AaDa5pvl3Np9qW2uN0nks0Zwyfw7w
Qf8AgRx71uLb2F1Ym1WG2mtB+7MQVWjG0/dx04I6dsU+KytYBGIbaGMRKUjCRgbFPUDHQHApcyTv
YfK2rXOYbxNqs8Nu9nYxk/Ykupt23b82eMtIm0Dafmw3XpxzrW+oXv8AbRtrwRQQyjNsgjLGXCgn
94Gxkc8FR6gnmrz6Xp8ogEljbOLf/UholPl/7vHHQdKdHYWcV495HaQJdSDDzLGA7D3bGT0H5UOU
ewKEr7liioba6hu42eB96q7Rk4IwynBHPuKmrOxrcKKhtrqG7jZ4H3qrtGTgjDKcEc+4qaiwXQUU
UUAFFFFAwooooAK5j4h/8iLqX/bL/wBGpXT1zHxD/wCRF1L/ALZf+jUrGv8Awpej/I7sr/36j/jj
+aOnq9Z/6lv96qNXrP8A1J/3q0ZxR3Oa+Gf/ACT3S/8Atr/6Neutrkvhn/yT3S/+2v8A6NeutrCh
/Cj6I9HNP9+rf45fmwrL1HQ4L+4F1HcXNneqoVbm1k2tgdAykFHAycB1YDcSME5rUqhqWtafpPli
8uAssufKgRTJLLjrsjUFnxnJwDgc1vHmv7pwmJfeHNRvrnU1luLZotQ0xbR5gCrJIpkwRHyCp8zn
5h09+MrXtO1c27ajerYw3ctxp9vFFDI0qDZcg7mYqp5L9McAdTmugt/FMEmsXthc209mLS0S6kln
Qqqq27IZsbBgKDncc5I/hNPHi7RTZy3T3EkMcLRq4nt5InXedqHYyhtpPAbGODzwahm8ZTjbQzf+
Eb1K81GLUL02sUjXZlliglZwkf2d4gFYqCzZbPRcfhyjaJr8/he60Gb+zUhGntZwypI7NK23arMC
o8sYHIG/r1451ovENleSWgt7ry/MuGgaKe2kSQsI2faVbaYzgbssOR06g02Lxbos0dxKt06xQQtO
0jwSIjxr950YqBIo45XI5HqKWlhc0+xk694Tu7/U5Li3CSRXNslvKj6hcWyx7d3O2LiUEP8AdJXp
1542tG0qXTZ9UZ2jKXVyJYghPCiKNMHPfKH14xUcvizSIEiaWW4RZF3ktaSjy0yRvk+X92pIOGfA
IBIOBUWi67Pq2vaxbgbLSxlECq1pIjM21WLeYxCkckbQM4w2cEU9Abm467FdfDl2sFmm+DMN9c3D
4J5WTzduOOv7xc/Q1Xn8LXwsNIWFkeezsxayot7LbK3C/MHjGSMr0I5znjHOhpPieC7ZoLphHced
Oi7Y2CEI7AAMeC21ckZz1OMVN/wlOlm1juVe4eOXJjCW0rM6gAlwoXJXkfNjHIGaT5WjdzxEZWsV
LPwwY3linlZbdrO3tx9lnlhcNGXJwwbcB8w/iJPOffU03RrbS3kaCa+kLgA/ab6acDHoJHbH4VkP
4rB12WGMSyWEFtHMzQ2M07S7ycFCgIx0PAOeem04urrkmox40m1uvNSWLzBe2M1uPLLgOVMirkhc
njPbitIczjZbHPX5+ZOpuyHU9Hvo9Zl1bS4rK5e5tltbu0vZGjSVFLFSHVXwRvYEFSCD2xzj6R4J
uNPu7S6WHS7NRqjX0lnZIVihX7M0IVDtG45KsTtTqePXSbU9fu7uDSrX+z7XUI7dbm9mnieaOMMz
KiqiuuSSrHO/gL0OeLC69LpFkv8AwkarHcNcG3hazheUXXy7gyRrudSQDlTkgqeSMEzsZFHSfC13
ZarbXNxJA0ca6gG8t23f6RcLKmDgYwoIPPB6Z61JceHr3S9QtNQ0HbdSRQywPDqmoTtlXKNuErCR
hgoPlxg56jHNXw945h1O4kF28iG4u5YbK2XS7lJAkcmws5IIPVSThQmSDyDjodV12w0byRePMZJs
+XFb28k8jAfeISNWbAyMnGBkeopvzB6vU5bxR4X8S+IIpLdry1aKaw8gmO8uLVIZiG3v5cefOVsq
ArthcHg5IPSaTpU1nDfPcNGbm6k3EoxZQoRUUAkDsoP1JqC/8Z6DpscUs947RS24uhJBbyzKsJ6S
OUUhFPPLYHB9DTdSvtXuNUez0a6sLdbe2WeaS6tmuNxcsFVQsiY4RiSc9RSXYfUz5fD2tw+DtD0m
znhMtnHFHeRreS2onVY9uFmRS6fNtbIAJAwcAms6LwZq1po1tbLFZ3VxHPcyGQapdWsqiWTeMXCB
pCOzK2dxCknI509F8R3kXhqx1rxFe2jJqEULQQWGnzeYHdd2wKHkaQ4/uqOFJ6dL58Z6H9igu0nu
JY5/M2JBZTSyjyztfdGqF12ng7gMEgHrQK5jP4M1Nrv+0nv4ptWt9PtYrW6kZhm4iMhdnUDG1w+0
nltrP0zzPeeHtZn8RJfWy2tmrzQyy3FvqE6MQu3ej24XypiQCu9iCFI4+UZuDxdaJqV40s8J0uOy
tbmCaJWdpTM8igKFyWztXaFGST3zVyXxVpEGpLYSTzLMZEiLfZZfKSRwCqNJt2KxyvysQfmHHIp6
6DMq58HDULXSINQgs7uOG/lvb2KdfMSQukvADLhsNIuMgYC+wqnceBZobDUNI0z7NBpMk8d9aQpK
8DQzLIHeMNGMqjbchgdyFjgEACruq69q51qLT9LexhWS+Fl51xA02GFu8zHasiZ6IByMfN14qay8
QXdheataa/cWcgsI4ZftNnbvGGEu4CPyyznfleACS29cDPVboWxnW3hLUbSKG/ggtF1OC++1LBNq
Nxcq48oxFWnlBfO1iQQgAwBg8k0tB07Wp/L1S1TT3uYrvU7W5ikleNAJLnJZCEJYgx9CBuz1FdV/
wlmjf2cb3z5tgm+zmH7LL5/m4zs8nb5m7HzY25289OalsPEuk6k0S2l15jSpK6Dy2GREwSTORwQz
AYPP5GmrjTOOf4f6ilnZxAw3DHSoNPuR/al1axoYwwLBYsecp3n5WK9Oo3HGje+D7+4g1m0R7dbe
5u7e9tWS5liffEsQMbFRuQHyuHViRuzjjnZm8Y6Fb29rcPdyGG5gW5WRLaV1SJvuySEKfKU8/M+0
cH0OIrXxfYzT64txHPbxaVcCBpHhkxLlVI2/KNzFm2hV3E/KR95croBkL4Rvk0mXFjZNeS3aztHJ
q947qAmwFbs5kV/cIBtJXHJatHR/DuoRC3OrXXnmG2miTE7yshlfON7AM+1FRQ5+Y8kgZq7/AMJb
oxsPtYmuCvnfZ/JFnMZ/Mxu2eTs8zO35sbfu89OaG8QQ3dtpk2lyJKt9c+SpkVlKhdxkypwwYBGG
DyG6jtQIxv7A8RzeEbrw5N/ZSW66a9lBMksjPM23YjsCoEYwOQN/J4IxyzxD4Ou9R1aW6tVSWO6t
EtZUfU7m0WPaX+bZDxMCHPysV6fe+bjZi8ZaDNHcyLeOsVvC9w0r28qI8S/eeNioEijjlCw5HqKJ
vGOiW0cUk09zGkieYS1lMPKTcV3yfJ+7QkHDPtUgEg4GaEBhT+B7g65NJGkctjcXENwxfU7qMRbF
Qbfs6Hy5P9WCGZhjPIbbzZHg+5uLS0068nQWCahdX1wLaeSOSQtK7wgMu0jG8MSCOUAGRzW5ceJt
JtdUXT5bhxOzpGWEEhiR2+6jShdiscjCswJ3LgcjODr3ji3gNqmm6nZWaNfNaXN7qVtJ9niKpKSA
xaNWO6Pbw3GfcULsMLjwVNaT37aNP8tzEk6G/upp2S8iYGJyXLMVIAVvm4CjA5NUte8Fa3fWB0u0
vI2sTp/2ZGe+ntzHMQ2+RkiGJt+V4dgBg8HJB19K8T24srm9vfE2i6paxvHGZdKt2CwljgeYRLLg
HI5O0DBJ9tC78WaNYs6z3MgZbj7KAltK++bYX2LtU72wDwueeOvFAjKbwrfNBfr5lsHudVs71Tub
hIhBuB+Xr+6bHbkdOcWNK0nW9OZ9MAsDpBnnl+0GV2nZZGZ9mzaFUgv9/c2Qv3Rni5J4t0aOxgu/
PnkScuEjhtJZZfkOHzEql12nhsgbSQDgmqWuePNI0fTbi5haW+lSzF7HHbQySK8ZBKMXRGCKdp+Y
8UN3Y27mDZfDy6GmzadduiImnyWMN1/aV1cs24BQ4ikISEYUEqu70DDHO34e0HUNKnu72W1gW6kj
SFFfV7q83KCSSZJh8o54VU6jljnjefVbaLRzqkonS2WHzmzbyb1XGeY9u/PtjPtVO58VaLaq7y3n
7tFhdpFidkAlYLH8wBGSSOM5wQenNG2gtzN1Dw9ql14hXX42s/tlpIsdnCzHy2gORJ5jbchzubBA
O3AHRnylp4Xu4P7K3vbn7Jq11fSYJ5SXz9oHH3h5q5+h5PGbtv4z0O5njgjuLgSvKISsllNH5Uhx
hZNyDyycjaHxuyMZzVWw1jX9StjPa2tmyLPcwsTkYMdz5a/xd4w5PuB06U4K+iC43RvDN7p2r213
NLbtHENQ3BGJP7+5WVMcdlUg+/TPWunmjMsDxg4LKRWdqmtJpl9ptq8EshvZjFuRGYJhScnAPcDr
jjJ6A1MNZsTbRXAm/dyyGJPlOS4zkYxkEbWz6YNJyuaKE9JJbnM3Vpc2Gj6HpzTW6asgFpGsUmS8
W3YzAEA4A2uRjgqBmln0+8Ov6jp+mR2qxNptvbt5pK+UhMoBUAHOB/Dxn1Fblp4l0i9RpYrjCLD5
4kljaNWjxkspYAEDIzjpnnFKniLT5Lae4RbtvJK74hZzGYBuh8vbvIPPIGOD6GoUU3odPtqkVrH+
rmKfCd0mqblZZLRpo5iz3ky7doXjyVIRj8vBJHXkHHOwfDNibs3RudV8wyeZtGq3ITOc/c8zbj2x
jtimrrkmox40m1uvNSWLzBe2M1uPLLgOVMirkhcnjPbiqen+Kz/al5perW5tbixso7u4nEbiEBi+
4biNoACg53HOWH8JrWMHTWmhzVa0qvxF/wATabd6po4hsTD9pjuILiMTsVRjHKsm0kAkZ24zg9el
c5rfhbxBrGrvK9xAbYXVvPATqE6LGkbIzRGBVEbksrkSMSeQMDAxuQeNNDuLe5mW4uE+zLG0kc1l
NFIRIcJtjZAz7iCBtByeBzUL+LLe5udKGnsGhuL57W5FxDJFJDtgeXBRwrKflU/MOhz3BqSNSnb+
G9Wh8SG6j+z2ln50skhtr6crcKwbCm2YeXG2SGZ1JJKk4G44k8KeF7zwvFYW8LwG3aySO/XzGYm4
QACRCRkgjKkHGAqYHGKvHV77U44LvQY4bixkjJEsyMm5t6AFc4ypQyEMMg4BBIPMkmuvBd3zSW00
tnbSJCWtoWldXKbmJVcsR8yD5VJByTxyNFBtaEt6FuWwkl1uK9Zl8uC3eONck/OxGSR7BQAc92qC
10ILdpfaheT394hJQyHbFESP4Ix8oxlgGbc+CRuIq/ZX1pqVstzY3UNzAxIEkLh1JBwRkehqxSc5
LQYUUUVABRRRQByXxM/5J7qn/bL/ANGpXW1yXxM/5J7qn/bL/wBGpXW1kv4r9F+p3VP9xp/45/lT
OC1z/kevCn/b3/6KFdPXMa5/yPXhT/t7/wDRQrp6un8U/X9EZ4z+Dh/8D/8AS5hWBZ3P2TW9Vikg
ug1xcIYXFrI0bfu1Gd4UqBkdzW/WTHqV/candW1vZWzQ20qxvJJcsrHKhiQoQjo3rXRDqedPoYGn
waq0NybrUL+OVrZxcbbSc7JDjBQlyGIOceUAMenFdDoTyvpXzwTxFXZVM7SFpAD979584B9D09xg
lZ9cshb+ZaXVpct5yQlVukUBmOMZz1xk46nFWf7SsS0i/bbbdEpeQeauUUHBJ54AIINVJtrYzjFJ
7nJtJqEOm3UofUknTT5mvWnMgRZuNpjLcf3/APV8Yx7VKDqD6fe/2W2oiAxw/NdLKz7tx80oHIc/
JjoRz93mupims9TtGaGWC7tpAVJRhIjdiPQ0q3VqFQLcQ7S5jXDjlhnKj3GDx7Gnz+Qcl9bnL21r
qDQWcQu797d73DMIpoWWLy2yDvdpAu7uxGD07VLI2oReKoPKS7W1jlWJhieRZIzH98sW2feIHQtx
knGa6C21OwvJHjtb62ndAGZYpVYqPUgHgU60v7O/Rms7uC4VDtYwyBwD6HBo532DkVrJnH/ZLy0s
ri3tzfwsb92uW2XEv7os5UptYE5JXOw59e9X4JL+w/s+a4kv7i3Mc6MVt5S2SVMe5Ms3QHBbn1wa
6H7dafafs32qDz8keV5g3cDJ469CD9DTbfUrG7hkmtr23mii/wBY8cqsqd+SDxRzvsHIk9zn9Gt9
Qnkga/k1BFj0+FsM7r++y2c/3mAxkHOeMg8Ve8MmVbaaGRbtxGwAubnzlMxxyQkvzLj0HHp3Amuv
ENhBFaXEdzbS2s85ha4WddkeFZsk9O2Pxq3JqunQ2iXct/apbScJM0yhG+jZwehobb6Akk9zmhFP
ATDdR6ilotzdNJ9kWUMWZ90ZzH8xXaW6cZ61WvX1RXsxqE95D/o8DSTq0yLE2795nylKMSAAdxAG
eK7F7+zjlSJ7uBZJNuxDIAW3Z24Gec4OPXFZepT6Iftd6YNPvb/T4jIV+RpU28gZwSvP5U1LuhSh
fZmaFu4raJL06n9iWe5DGJp2l+/+6yU+fbjPt09qqQ3uoponmZ1GZrnSEEDxJJIfO+bJJAO1uV5O
PrxXWW2q2F5ayTxXls8ca5mKyqwj4ydx7fjUljNZTWiNp8lvJbL8qG3YFBjsMcUc3dAo32ZzU0Wr
ya4C11dRYeLyFS3ldCmF3bmDiMHO/O8E+meK0NEMyapfRMLydCS/2mcTIoJY4QJJ8vA/iTgjqBxm
3c65ZRBlt7q0nnSZIni+0opUs2MHJ69TjqcYqaTWNLhdkk1KzRkOGVp1BU5xzz6jFJttbDUUnuXa
KqnU7AXwsjfWwuz/AMsPNXf0z93OenNVoNctDZvdXksNnGtxJADNKFBKsR1OOuM4rPlZrzI06KRW
DKGUgqRkEdCKWkMK5j4h/wDIi6l/2y/9GpXT1zHxD/5EXUv+2X/o1Kxr/wAKXo/yO/K/9+o/44/m
jp6vWf8AqW/3qo1es/8AUt/vVpLY4o7nNfDP/knul/8AbX/0a9dbXJfDP/knul/9tf8A0a9dbWFD
+FH0R6Oaf79W/wAcvzYVl6jocF/cC6juLmzvVUKtzaybWwOgZSCjgZOA6sBuJGCc1qVQ1LWtP0ny
xeXAWWXPlQIpkllx12RqCz4zk4BwOa3jzX904TEvvDmo31zqay3Fs0WoaYto8wBVkkUyYIj5BU+Z
z8w6e/GVr2naubdtRvVsYbuW40+3iihkaVBsuQdzMVU8l+mOAOpzXQW/imCTWL2wubaezFpaJdSS
zoVVVbdkM2NgwFBzuOckfwmnjxdops5bp7iSGOFo1cT28kTrvO1DsZQ20ngNjHB54NQzeMpxtoZv
/CN6leajFqF6bWKRrsyyxQSs4SP7O8QCsVBZstnouPw5RtE1+fwvdaDN/ZqQjT2s4ZUkdmlbbtVm
BUeWMDkDf168c60XiGyvJLQW915fmXDQNFPbSJIWEbPtKttMZwN2WHI6dQabF4t0WaO4lW6dYoIW
naR4JER41+86MVAkUccrkcj1FLSwuafYyde8J3d/qclxbhJIrm2S3lR9QuLZY9u7nbFxKCH+6SvT
rzxtaNpUumz6oztGUurkSxBCeFEUaYOe+UPrxio5fFmkQJE0stwiyLvJa0lHlpkjfJ8v7tSQcM+A
QCQcCotF12fVte1i3A2WljKIFVrSRGZtqsW8xiFI5I2gZxhs4Ip6A3Nx12K6+HLtYLNN8GYb65uH
wTysnm7ccdf3i5+hqvP4WvhYaQsLI89nZi1lRb2W2VuF+YPGMkZXoRznPGOdDSfE8F2zQXTCO486
dF2xsEIR2AAY8Ftq5IznqcYqb/hKdLNrHcq9w8cuTGEtpWZ1ABLhQuSvI+bGOQM0nytG7niIytYq
WfhgxvLFPKy27Wdvbj7LPLC4aMuThg24D5h/ESec++ppujW2lvI0E19IXAB+03004GPQSO2PwrIf
xWDrssMYlksILaOZmhsZp2l3k4KFARjoeAc89NpxdXXJNRjxpNrdeaksXmC9sZrceWXAcqZFXJC5
PGe3FaQ5nGy2Oevz8ydTdkOp6PfR6zLq2lxWVy9zbLa3dpeyNGkqKWKkOqvgjewIKkEHtjnH0jwT
cafd2l0sOl2ajVGvpLOyQrFCv2ZoQqHaNxyVYnanU8euk2p6/d3cGlWv9n2uoR263N7NPE80cYZm
VFVFdcklWOd/AXoc8WF16XSLJf8AhI1WO4a4NvC1nC8ouvl3BkjXc6kgHKnJBU8kYJnYyKOk+Fru
y1W2ubiSBo411AN5btu/0i4WVMHAxhQQeeD0z1qS48PXul6haahoO26kihlgeHVNQnbKuUbcJWEj
DBQfLjBz1GOavh7xzDqdxILt5ENxdyw2Vsul3KSBI5NhZyQQeqknChMkHkHHQ6rrtho3ki8eYyTZ
8uK3t5J5GA+8Qkas2BkZOMDI9RTfmD1epy3ijwv4l8QRSW7Xlq0U1h5BMd5cWqQzENvfy48+crZU
BXbC4PByQek0nSprOG+e4aM3N1JuJRiyhQiooBIHZQfqTUF/4z0HTY4pZ7x2iltxdCSC3lmVYT0k
copCKeeWwOD6Gm6lfavcao9no11YW629ss80l1bNcbi5YKqhZExwjEk56ikuw+pny+Htbh8HaHpN
nPCZbOOKO8jW8ltROqx7cLMil0+ba2QASBg4BNZ0XgzVrTRra2WKzuriOe5kMg1S6tZVEsm8YuED
SEdmVs7iFJORzp6L4jvIvDVjrXiK9tGTUIoWggsNPm8wO67tgUPI0hx/dUcKT06Xz4z0P7FBdpPc
Sxz+ZsSCymllHlna+6NULrtPB3AYJAPWgVzGfwZqbXf9pPfxTatb6faxWt1IzDNxEZC7OoGNrh9p
PLbWfpnme88PazP4iS+tltbNXmhlluLfUJ0Yhdu9HtwvlTEgFd7EEKRx8ozcHi60TUrxpZ4Tpcdl
a3ME0Ss7SmZ5FAULktnau0KMknvmrkvirSINSWwknmWYyJEW+yy+UkjgFUaTbsVjlflYg/MOORT1
0GZVz4OGoWukQahBZ3ccN/Le3sU6+YkhdJeAGXDYaRcZAwF9hVO48CzQ2GoaRpn2aDSZJ4760hSV
4GhmWQO8YaMZVG25DA7kLHAIAFXdV17VzrUWn6W9jCsl8LLzriBpsMLd5mO1ZEz0QDkY+brxU1l4
gu7C81a01+4s5BYRwy/abO3eMMJdwEfllnO/K8AElt64Geq3QtjOtvCWo2kUN/BBaLqcF99qWCbU
bi5Vx5RiKtPKC+drEghABgDB5JpaDp2tT+XqlqmnvcxXep2tzFJK8aASXOSyEISxBj6EDdnqK6r/
AISzRv7ON7582wTfZzD9ll8/zcZ2eTt8zdj5sbc7eenNS2HiXSdSaJbS68xpUldB5bDIiYJJnI4I
ZgMHn8jTVxpnHP8AD/UUs7OIGG4Y6VBp9yP7UurWNDGGBYLFjzlO8/KxXp1G440b3wff3EGs2iPb
rb3N3b3tqyXMsT74liBjYqNyA+Vw6sSN2ccc7M3jHQre3tbh7uQw3MC3KyJbSuqRN92SQhT5Snn5
n2jg+hxFa+L7GafXFuI57eLSrgQNI8MmJcqpG35RuYs20Ku4n5SPvLldAMhfCN8mky4sbJryW7Wd
o5NXvHdQE2ArdnMiv7hANpK45LVo6P4d1CIW51a688w200SYneVkMr5xvYBn2oqKHPzHkkDNXf8A
hLdGNh9rE1wV877P5Is5jP5mN2zydnmZ2/Njb93npzQ/iGC6tdNm0ySOVb258oNIrLtVdxkypwwY
BGGDyG6jtQIxv7A8RzeEbrw5N/ZSW66a9lBMksjPM23YjsCoEYwOQN/J4IxyzxD4Ou9R1aW6tVSW
O6tEtZUfU7m0WPaX+bZDxMCHPysV6fe+bjbtPF+h3plEV26LFA1yXnt5IUeJesiM6gOgyPmUkcj1
FNtfGWh3Yk2XE8bI0KslxaTQv++bZGQroCQzcbgMe9CAwp/A9wdcmkjSOWxuLiG4Yvqd1GItioNv
2dD5cn+rBDMwxnkNt5sHw3rFnaaa9klhPc2erXV8Y5rh4kdJTNgbhGxDASrn5ex5roY9e02XVJdN
S5/0uMsrIUYAFVRiNxGOkiHr39jipH4w0OW4t4Uu5CZ9gST7NL5QLgFFaTbtRmyMKxBO5cD5hkvY
ZFcx+JtT026s7ix0mzM4EXmR3r3OEbhztaFQSB0ByCevHXnL3SNT0Gbw9ptitnLDb6s7af50jBnQ
28zMkpCnByWAcbieCQTnPVL4t0V9UTTVunNzJM0Ef+jyeXJIoJZVk27GK7TnBOCMHB4qGLxv4em8
8reyKkMD3JkktZUR4kIDPGzKBIoyOUJ6ijZ3EYNz4L1SSWDUsxS3zPcNPbQ6pcWUa+ayt8s0Q3tt
2AYKgNnPy4Aqx/whNyul6tZRSWsYu9Fi06IqZCEdfNyTuLNt/eL1Yng5q14g8eadpmg3V3avK12t
pJcQxy2U+0YyFMnyjYrMpALFQ3YmtWXxPpVvqMenz3DrcMyIWEEhiR3xtRpAuxWORhWYE7lwORkW
gyVm1r+zNsdtYLe/Z+A1w7RiX0zsBK988E9MDrXMw+Cr6xsm0u1mtZbBru1vTJNlZPNSVGlG1Vxt
KpleflJ28KBjqdO1qx1aS5Sykkk+zSGORzA6pvBKlQxADEFSDgnHfqKhj8SaVKY1S4dnkuJLYJ5E
m4SJksGXblQAM5OByOeRk63EZVz4YvJjqZWS3Bu9Ytb5CWPEcXkbgePvfumwOnI5HONbw9pk2k6b
JbTtGztd3M4MZJG2SZ3XqBzhhn3rPj8e+HZo1kiurqQPEJoglhcMZk4y0YCZkAyN23O3viga9fXu
tTWulpaz2629lcpIc/NHLJIHOc4OETI9/XpTWrsNmhq9hc3d1plxa+UTa3PmOsjFcqUZDggHkbs4
746isa2gS61rUmhkjmsrUu6FCGCXDrh146FcEn/rqa1LvVrrSfC8up6jbK11DCXkhhyQW9OM4HTn
nHXpVmHV7F4pmLmPyYlmlWSNkKoQSCQQD2P5EdRUOKva+x0U5zULpabHLaVoeoav4a09Lh7eGAaW
IoHiZizF0XBYYG3GOgJznqK0tL8MyhLoah5kRmVEzb6ncySYUk/60lWUZP3QB3yTnA0E8TaU119m
Ez796xkmFwqMwBUM2MKTuGMkZJwOalj1/T5b9rNJXMoLKD5ThHZfvKr42swwcgEkYPoaUEk7rcup
VrSTi1ZD9N0a20t5GgmvpC4AP2m+mnA+gkdsfhWTqGj6yda1W90u4tYTe6alvFNIxLwTIZCrbdpD
KfM554x0OauQeJbS8mW3t7bU1mfIQzaXcxJnHdmjAH4kVnN4m1HSrzSbTWbD95qUyQKbWORxG3kl
3J2huN4wMkcZbJCk1s4yestzjWmxk2ngzVkOqTzxWcjXdvBGlvcandXWGjkZifOcB0J3ZVlA2Ngg
HHMy+Cr6/trK31iRJbWLUHuHtHv5rnZCYGj8sSuA8mWbcQ2BhivIHPQp4s0aTVxpi3Mn2gyvCrG2
kETSKCWQSldhYAHIDZGD6Gs7UPHGn/2JqlzpUrSXdrYy3cK3NrLGkyqPvIWCiRMleUJHzDnkVNxm
1otvqFppaW2ozRzzxFkWZCSZIwfkZuBhyuM44znFVYNHvY9KFsmoNaTyzPNcTQqsj5ZixCFwQMEg
ZKn5RjA4IfLrDXMslppWye8tpYRdBkbZGrFSw38LvCHdtzkZUkcjMX9qalCbCCe1je8khknuIYcZ
2oAMJlgMlmTqcda0ipW0JNHTtLtdLheO2V8yNvkklkaR3PTLOxLHgADJ4AAHAq5VDTtasNUaRLWf
99EAZbeRGjmjz03RsAy5xxkDI5HFX6iV7+9uMKKKKkAooooA5L4mf8k91T/tl/6NSutrkviZ/wAk
91T/ALZf+jUrrayX8V+i/U7qn+40/wDHP8qZwWuf8j14U/7e/wD0UK6euY1z/kevCn/b3/6KFdPV
0/in6/ojPGfwcP8A4H/6XMKyLbQ4o9XvtRmgtnnlkDQTeWGkjAQL1I45B6HvWvXOQ3lxc+JL21fU
L+JYZlWOKG1VoiuxWIZzGcZJPVhXRC+tjzZtK1ynD4b1T941xPE8kgg8x2uZJCzRy7y3K4XIJ+UY
A985F9/D8r6Hd2e9Flmu2uQUdlDfvN4BYYI4AGR07ZqObxRBcRzRWxmhmguIY5Cnky7Qz7ecORg4
IP8AEM5xVtvEtpHa3V1JDPHbWztE0r7FUuH27Rlu57nA9SOa0bmZpQJtG05rCKdpI1jlmfcwFzJP
0AAy8nJPHoPTtk5y6LqK3cKf6L9khvZboSea29g4f5du3AwX67u1aeka1a61BJJbHmN9jrvR8HGe
qMyng9jTV1y2ZYSEmxLcvarwPvJuyTz0+Q/pU3lcq0XFGWPDNw+n2Vq80cflafLaSPGTnc+3kcDI
+U+lXtE0qWxllnniRJWRYxtvJrjIGT1k6DnoBxzyc8Nt/E9pLGJZoLm1ha2a6SWYLh41xuxtYnIy
OCB7ZqXR/ENlrUksdscSRAMVMkb/ACnocozDt0Jz7U2521EuS6sRvobzLritIqf2j8qumSyjywvP
TvmqcfhydrO5EiRxTusYX/TJrgNsbdgmTopPGAOOeT0rSfXbeO4vY3inEdlk3E5C7EGwNnrk5B7A
1WtPFum3kFxIpYGEKSgeOQtuOFxsZhknjBINJOdgahfUllsb29lsZriK1heC6850jkLgrsZRyVGT
kjsOKzn8NXSmKVCkjxzXDeUt3LbjbK+4HegzkYGRjBz7Vc1DV7yL+z3jsrqJpLvypLdhGXddjHAO
4r1A53DpSXHi7Tra1hmkWRJJXdBDI8cbKUOGyXcLwfRjntmmuboJ8nUk03RDYX/nDyhGtlHbJsLE
qVLE43ZOOR1JPFQJpF+NCn0kpaBBbPBDP5jFnJ4BYbfl9TgtzVu38QW15cQw2sM8/mwpPvUKFVGJ
GSSR0xyBz6ZqC71x5dFv7uzt7iJEtpJbe6dUKPgcEDJPv8wGaPevqUuXoQ6h4dnvHuGSSNA9vboo
DspLRuWwSvIByBkcitDRtOawimaWNUlmfcwFzJP0AAy8nJ6eg9O2TWHia2gtZ3voZ7V7eOORlm2D
eHOFIIYgZIxyRjvgVb0jWrXWoJJLY8xvsdd6Pg4z1RmU8HsaHzWFHkumtzLk0TUZPPhQ29vaGaOV
IBO0g3CUOzZKgpkD7oyMntzmKXwzePFOqyW4Mkd4o+Y9ZmBXt2A5/rV6fxTY29/cWcscokgG59rx
thcgFiA5KgbgfmAOM4Bp2oeJrPTYpJpo5TDHKYjJvjUEgAnbuYFsZI4BOQeKacxWgZ6aZqNxf39u
YYktWu4JWuJGbcdixn5F24PK4zu4544pZfDl4J1ljKSCOadkQXstvuWVg2SyDIIIxjkEc8VpSeIb
eO6eL7NctHHMkMlwoTYrOF2/xbsHcOgqxBqqXF08UVtO0CO0bXWF8sMvUfe3cEEZxjPehykHLB6E
2n2i2On29qoUCJAuFJI49NxJ/MmrNc3Z+L9Nu7y4f7Xtt44DKo3RsCq8s3ysWBwRwwX6Zzi9o/iG
y1qSWO2OJIgGKmSN/lPQ5RmHboTn2qHGW7NIzjsjWrmPiH/yIupf9sv/AEaldPXMfEP/AJEXUv8A
tl/6NSuav/Cl6P8AI9LK/wDfqP8Ajj+aOnq9Z/6lv96qNXrP/Un/AHq0exxR3Oa+Gf8AyT3S/wDt
r/6Neutrkvhn/wAk90v/ALa/+jXrrawofwo+iPRzT/fq3+OX5sKy9R0OC/uBdR3FzZ3qqFW5tZNr
YHQMpBRwMnAdWA3EjBOa1KoalrWn6T5YvLgLLLnyoEUySy467I1BZ8ZycA4HNbx5r+6cJiX3hzUb
651NZbi2aLUNMW0eYAqySKZMER8gqfM5+YdPfjK17TtXNu2o3q2MN3LcafbxRQyNKg2XIO5mKqeS
/THAHU5roLfxTBJrF7YXNtPZi0tEupJZ0KqqtuyGbGwYCg53HOSP4TTx4u0U2ct09xJDHC0auJ7e
SJ13nah2MobaTwGxjg88GoZvGU420M3/AIRvUrzUYtQvTaxSNdmWWKCVnCR/Z3iAVioLNls9Fx+H
KNomvz+F7rQZv7NSEae1nDKkjs0rbdqswKjyxgcgb+vXjnWi8Q2V5JaC3uvL8y4aBop7aRJCwjZ9
pVtpjOBuyw5HTqDTYvFuizR3Eq3TrFBC07SPBIiPGv3nRioEijjlcjkeopaWFzT7GTr3hO7v9Tku
LcJJFc2yW8qPqFxbLHt3c7YuJQQ/3SV6deeNrRtKl02fVGdoyl1ciWIITwoijTBz3yh9eMVHL4s0
iBImlluEWRd5LWko8tMkb5Pl/dqSDhnwCASDgVFouuz6tr2sW4Gy0sZRAqtaSIzNtVi3mMQpHJG0
DOMNnBFPQG5uOuxXXw5drBZpvgzDfXNw+CeVk83bjjr+8XP0NV5/C18LDSFhZHns7MWsqLey2ytw
vzB4xkjK9COc54xzoaT4ngu2aC6YR3HnTou2NghCOwADHgttXJGc9TjFTf8ACU6WbWO5V7h45cmM
JbSszqACXChcleR82McgZpPlaN3PERlaxUs/DBjeWKeVlt2s7e3H2WeWFw0ZcnDBtwHzD+Ik8599
TTdGttLeRoJr6QuAD9pvppwMegkdsfhWQ/isHXZYYxLJYQW0czNDYzTtLvJwUKAjHQ8A556bTi6u
uSajHjSbW681JYvMF7YzW48suA5UyKuSFyeM9uK0hzONlsc9fn5k6m7IdT0e+j1mXVtLisrl7m2W
1u7S9kaNJUUsVIdVfBG9gQVIIPbHOPpHgm40+7tLpYdLs1GqNfSWdkhWKFfszQhUO0bjkqxO1Op4
9dJtT1+7u4NKtf7PtdQjt1ub2aeJ5o4wzMqKqK65JKsc7+AvQ54sLr0ukWS/8JGqx3DXBt4Ws4Xl
F18u4Mka7nUkA5U5IKnkjBM7GRR0nwtd2Wq21zcSQNHGuoBvLdt3+kXCypg4GMKCDzwemetSXHh6
90vULTUNB23UkUMsDw6pqE7ZVyjbhKwkYYKD5cYOeoxzV8PeOYdTuJBdvIhuLuWGytl0u5SQJHJs
LOSCD1Uk4UJkg8g46HVddsNG8kXjzGSbPlxW9vJPIwH3iEjVmwMjJxgZHqKb8wer1OW8UeF/EviC
KS3a8tWimsPIJjvLi1SGYht7+XHnzlbKgK7YXB4OSD0mk6VNZw3z3DRm5upNxKMWUKEVFAJA7KD9
Sagv/Geg6bHFLPeO0UtuLoSQW8syrCekjlFIRTzy2BwfQ03Ur7V7jVHs9GurC3W3tlnmkurZrjcX
LBVULImOEYknPUUl2H1M+Xw9rcPg7Q9Js54TLZxxR3ka3ktqJ1WPbhZkUunzbWyACQMHAJrOi8Ga
taaNbWyxWd1cRz3MhkGqXVrKolk3jFwgaQjsytncQpJyOdPRfEd5F4asda8RXtoyahFC0EFhp83m
B3XdsCh5GkOP7qjhSenS+fGeh/YoLtJ7iWOfzNiQWU0so8s7X3Rqhddp4O4DBIB60CuYz+DNTa7/
ALSe/im1a30+1itbqRmGbiIyF2dQMbXD7SeW2s/TPM954e1mfxEl9bLa2avNDLLcW+oToxC7d6Pb
hfKmJAK72IIUjj5Rm4PF1ompXjSzwnS47K1uYJolZ2lMzyKAoXJbO1doUZJPfNXJfFWkQakthJPM
sxkSIt9ll8pJHAKo0m3YrHK/KxB+YccinroMyrnwcNQtdIg1CCzu44b+W9vYp18xJC6S8AMuGw0i
4yBgL7Cqdx4FmhsNQ0jTPs0GkyTx31pCkrwNDMsgd4w0YyqNtyGB3IWOAQAKu6rr2rnWotP0t7GF
ZL4WXnXEDTYYW7zMdqyJnogHIx83XiprLxBd2F5q1pr9xZyCwjhl+02du8YYS7gI/LLOd+V4AJLb
1wM9VuhbGdbeEtRtIob+CC0XU4L77UsE2o3FyrjyjEVaeUF87WJBCADAGDyTS0HTtan8vVLVNPe5
iu9TtbmKSV40AkuclkIQliDH0IG7PUV1X/CWaN/ZxvfPm2Cb7OYfssvn+bjOzydvmbsfNjbnbz05
qWw8S6TqTRLaXXmNKkroPLYZETBJM5HBDMBg8/kaauNM45/h/qKWdnEDDcMdKg0+5H9qXVrGhjDA
sFix5yneflYr06jccaN74Pv7iDWbRHt1t7m7t721ZLmWJ98SxAxsVG5AfK4dWJG7OOOdmbxjoVvb
2tw93IYbmBblZEtpXVIm+7JIQp8pTz8z7RwfQ4itfF9jNPri3Ec9vFpVwIGkeGTEuVUjb8o3MWba
FXcT8pH3lyugGQvhG+TSZcWNk15LdrO0cmr3juoCbAVuzmRX9wgG0lcclq09D0HUbV7SXVLlbh7e
3lSMGZ5tpkk3bSzAM4VVRQ7cn5sgZq3/AMJboxsBdia4K+d9n8kWcxn8zG7Z5OzzM7fmxt+7z05o
bxBDd22mTaXIkq31z5IMispULuMmVOGDAIwweQ3UdqBGDYeGfEVkt59kuLXTCbKSGBIL2e4hMxxs
kEMo2wKuDhELD5sc7RmnF4J1sNfXRe2S4lW0aGKbUrm7G+CYy4aWVdwVs4+VRt9D36iLxjoky3DJ
czFYIWuCfskw8yJTgvF8v71RkcpuHI9RU8niXSYlmY3e5IYY5nZI3ddsn3ACAQzNxhRljkYHIovY
dznpfCer3ttqM00tla6hdX63EbQu8iwxtCkMq7iqkttDkHAGdpOKjuPA8/8Abs8kMccmn3FzFcHf
qd1EIdioNv2eMiOT/VghiwxnkNt56D/hLNG/s43vnzbBP9nMP2WXz/NxnZ5O3zN2Pmxtzt56c1Yt
PEGmXzW629wWa4ikmjVo3U7Y2CvkEAqVZgCpwc9uDRuBwFlO83iDSNCs7ywuV0/Vbmc+W7G5jUpN
kywlR5YDSBQ2SHypGM1M3gXxHeRXD311bNdS6Xc2TyPqNxOsssoT94EdQsK5U/Ii4HqcADp7Dxpp
t/q11bRiRLSGwh1AXskUiRNG4Y5LMoVQAoPJ5ywxlWqdfGOhtZz3LXM8SQNGsiT2k0Ug8w7UIjZQ
xDHgEDBIPoad9mLbQyfEPhrW7n+149JbT2i1awFpL9qkdDAyhgGUKjbwQ+MHbjGeelRXXgq6l8QX
FwFjms7q5iuZGk1O6jEZQICv2dCI5P8AVghmIxnkNt56q51mystMj1G5eWG1fZ8zwOCu8gDeuMpy
RncBjviql14r0ezd0muJdy3H2XEdtK++XYX2LtU7zgHhc88deKXkAaHpt5o+mtblbeR5L64nciQg
BJJncEfLywDAY4HXmsuHw5qsWvtru+yN5dM0F1DuOxLbACbG25Mg2qSSAGyQeFTGjaeL9G1CWOGz
uZHllVvLLW0qIWUHchZlAEgwcoTuGDkcVV0TVte1aw0q+NtafZ7u2tppGXIILoxkwC3Y+Xj6nr2p
RcncL2RFpHhe70/+wPNe3P8AZ2kPYy7CeZG8nlePu/u25ODyOKk8K+G7zQ5I2uZIHC6VZ2R8pifn
h8zceQODvGO/XgVo3evRWevRaZJBMfMtnuDIkbsBtI44Ujue/HA/iFSz67p1tZx3UlyBDJA1wrKp
bMYAJbgdMEfnU8yNHTnppuP1uxk1PQ76xiZVkuIHjVm6AkEDNYOpQPdavp9mzQfariHZf28b78Qg
7snIBK5BQEgf6w+la6eI9NeCebznUQ43K8Tqx3HClVIywY8AgHJ4GaafEWnizF4qXki+Z5TLDZTS
SI2M4ZFQsvHPIHUeoqeXmdkaQlUpLVbGHb2F/fahrNtCLZbRtSRpZHYiRdscTYVcYOcY5Ix156VP
Y+Frq21dZJCr20c8kySG9mY/NuwBFnYpG7G7J6dBni++r3t/brLolpIcM6yi+tZbc/6tiuBIFJy+
wEjPBP4V7HxlayLrP9oRS2o0mZYJpDBLtkYoh+T5fmJZtoVdxPykZ3DNey5feY3i5tNLYvWnhqys
7qO4iuNUZ0OQJtUuZVP1VpCD+Ipuu6be3t3o91ZCBnsbzznSdygZDG8bYIU8jfkDHOMZHWo08Y6I
9m9ys1ydlx9maD7FN5/m7d23ydnmZ2/N93pz0qufF9m2oWckdxCNJlsbm6lnlVkaMwvGpBDYK43O
CCMgjHGDTbctWcyMpfCmvT+JrXUb25gljtr6ScOb+dhJEyyKii3wIoyquoyMlsE5GTmAeDdbk07V
LINaWcFxp01okEOoXE0Ekj4CuI5FxbqvPyJu4bGflGeoS+1W6u4ZrS2j/s2URMHnjeOUKd+/Ktgg
jEeAR3P4Rx+I1iWW4vIZFsjcyRR3EURdIwh2kyEZ2jIc7iAoA5I73yStoHMP0TR59Eurm2gMf9ku
FkhQuxkilOfMHI5Vjh8k53M2etT/ANn3P9pX96ssaSywpDblgXVAu45K8dWY5APIUc1ft7iG7t47
i2mjmgkUMkkbBlYHoQRwRUtTzNXAy9P0OGyuTdzXFze3pUobi5cEgHsqqAidBnaoztGcnmtSiik5
N7gFFFFIAooooA5L4mf8k91T/tl/6NSutrkviZ/yT3VP+2X/AKNSutrJfxX6L9Tuqf7jT/xz/Kmc
Frn/ACPXhT/t7/8ARQrp65jXP+R68Kf9vf8A6KFdPV0/in6/ojPGfwcP/gf/AKXMKqwWEUE95Kpc
m6cPIGPAIULx+Aq1XK2tjFP4n1WebTLCdI7hCbibmWPESEbRsOf++hXRBXuedN2sXYfCtpDGsf2q
7dFSNFDFMBY3DIBhR0Ofc5Oc8EXP7Gtv7Pls98uySZpw+RuRy+8EHHZun65rm5ddutQgkjnhheES
2s8ReEx+ZG8uAcCUkHIBBOPda0G1zUU0y8vvKgdUuWtoYkQ5J83YGJLgY9uOnUZ40al3MlKHY3bS
2a1iKvcz3LsctJMRk9uigADjsB+dZ48PQC9ScXd15aTtcJb5TYrsCCfu7v4jxnvUujXl9dRTrqEC
xTRSbeNoyCAeVV32nnu3PB71STXbki23JCGl1Ca1YYPCpvwRz1+UVNpXLvFxVy0vh6yFvbQOZZIo
LZ7UKzD5kbGc4HX5R0xVuysnsw3mXtzdMQAGnK/KB2AUAfjjJ7ngVz8HiPUIrOG7u47eZJ9Pku0j
gjZGUoF+Ukscg7uuBj3rS0TUNTuppYtQtkjwiyIy7FJBz/Csj8ccNkZ544pyUraslSjdWRb/ALKt
mF+rhnS+OZlY8fdC4GOnAqMaMr2ktvc3t3c79u15WXMe05UqFUDIPOSCT3yKpzaxexS6xN5cLW2n
AkIFO+X92GxnOFwT1wePTFV4tc1aK0uHvLOMOFiMR+RR87bQSqyOdo65yM4I7UkpDco32NYaSGNs
1xeXNxJbzecrybASdpXBCqBjBPQCof7AhTa1vdXNvMskriaMoWxI25lwykYzjtnjrVHVRqBk0mN7
m0a6F9hZEhYIP3T9U3k5/wCBelQnxBqskdvb29rHJePJOrukYKkRPt4VpE65B+8ce/UNKXRicord
G9BpsNveNcq8rO0CQHe27KqSQcnkn5jkk1WXQYlsp7I3l0bSWJoUgym2JT/dIXJx23E1WstV1G+v
44fLtoYxaxXMo/1pJYsCqlWxzjg8/jmqt3eXl94Uv7ud7ZYLiyleOBUIkTjoWLEN78DBotLuO8ex
q3Gh2txJLI7yh3ijjBVgCnlsWVhx1BOfTjpVu0tmtomV7me5djlpJiMn8FAAHHYD8656TW9R02G4
gljguZY4YGhMSFAPMcphgz4OMZzlc+3WtbRry+uop11CBYpopNvG0ZBAPKq77Tz3bng96TUrCjKL
e2pHB4dtYbszCad0zLiFtuwCQ5cfdycnnkk8dccUybwzZy21vAJrmNYoXgLK4LSI+NwYkE5JGcjB
96q22tardamVWzRLJriS3VnCAgruGc+buY/LnbsHHfjJhHiO/lsbmSMWqSwSxQfMjMrlnC+aoyPk
POPcHninaYrw7Gr/AGBbGCaNpp286WKZ2JXO6MLjoMc7Bn8elTQ6UtvdPJFdXCwO7ObX5PL3N1P3
d3JJON2M9qyLjXdSgR7VIobm9W8FqJIUwhzH5mdjSDnHGN/v7U+DVtWuLixtfKtoJplm81nG8L5b
KM4RyBnJBXccHvxyOMu41KHYvwaFBFbSWr3NzPaNEYUt5HGyND2GACeMAFiSOx61ZsrJ7MN5l7c3
TEABpyvygdgFAH44yfXgVQ0l719b1kTXKvbxzqqR7GyuY0PBLEAc9Mdefatqpk2tC4pPoFcx8Q/+
RF1L/tl/6NSunrmPiH/yIupf9sv/AEalc1f+FL0f5HpZX/v1H/HH80dPV2z/ANS3+9VKr1n/AKk/
71aS2OKO5zXwz/5J7pf/AG1/9GvXW1yXwz/5J7pf/bX/ANGvXW1hQ/hR9Eejmn+/Vv8AHL82FZeo
6HBf3Auo7i5s71VCrc2sm1sDoGUgo4GTgOrAbiRgnNalUNS1rT9J8sXlwFllz5UCKZJZcddkags+
M5OAcDmt481/dOExL7w5qN9c6mstxbNFqGmLaPMAVZJFMmCI+QVPmc/MOnvxla9p2rm3bUb1bGG7
luNPt4ooZGlQbLkHczFVPJfpjgDqc10Fv4pgk1i9sLm2nsxaWiXUks6FVVW3ZDNjYMBQc7jnJH8J
p48XaKbOW6e4khjhaNXE9vJE67ztQ7GUNtJ4DYxweeDUM3jKcbaGb/wjepXmoxahem1ika7MssUE
rOEj+zvEArFQWbLZ6Lj8OUbRNfn8L3Wgzf2akI09rOGVJHZpW27VZgVHljA5A39evHOtF4hsryS0
FvdeX5lw0DRT20iSFhGz7SrbTGcDdlhyOnUGmxeLdFmjuJVunWKCFp2keCREeNfvOjFQJFHHK5HI
9RS0sLmn2MnXvCd3f6nJcW4SSK5tkt5UfULi2WPbu52xcSgh/ukr0688bWjaVLps+qM7RlLq5EsQ
QnhRFGmDnvlD68YqOXxZpECRNLLcIsi7yWtJR5aZI3yfL+7UkHDPgEAkHAqLRddn1bXtYtwNlpYy
iBVa0kRmbarFvMYhSOSNoGcYbOCKegNzcddiuvhy7WCzTfBmG+ubh8E8rJ5u3HHX94ufoarz+Fr4
WGkLCyPPZ2YtZUW9ltlbhfmDxjJGV6Ec5zxjnQ0nxPBds0F0wjuPOnRdsbBCEdgAGPBbauSM56nG
Km/4SnSzax3KvcPHLkxhLaVmdQAS4ULkryPmxjkDNJ8rRu54iMrWKln4YMbyxTystu1nb24+yzyw
uGjLk4YNuA+YfxEnnPvqabo1tpbyNBNfSFwAftN9NOBj0Ejtj8KyH8Vg67LDGJZLCC2jmZobGadp
d5OChQEY6HgHPPTacXV1yTUY8aTa3XmpLF5gvbGa3HllwHKmRVyQuTxntxWkOZxstjnr8/MnU3ZD
qej30esy6tpcVlcvc2y2t3aXsjRpKilipDqr4I3sCCpBB7Y5x9I8E3Gn3dpdLDpdmo1Rr6SzskKx
Qr9maEKh2jcclWJ2p1PHrpNqev3d3BpVr/Z9rqEdutzezTxPNHGGZlRVRXXJJVjnfwF6HPFhdel0
iyX/AISNVjuGuDbwtZwvKLr5dwZI13OpIBypyQVPJGCZ2MijpPha7stVtrm4kgaONdQDeW7bv9Iu
FlTBwMYUEHng9M9akuPD17peoWmoaDtupIoZYHh1TUJ2yrlG3CVhIwwUHy4wc9Rjmr4e8cw6ncSC
7eRDcXcsNlbLpdykgSOTYWckEHqpJwoTJB5Bx0Oq67YaN5IvHmMk2fLit7eSeRgPvEJGrNgZGTjA
yPUU35g9Xqct4o8L+JfEEUlu15atFNYeQTHeXFqkMxDb38uPPnK2VAV2wuDwckHpNJ0qazhvnuGj
NzdSbiUYsoUIqKASB2UH6k1Bf+M9B02OKWe8dopbcXQkgt5ZlWE9JHKKQinnlsDg+hpupX2r3GqP
Z6NdWFutvbLPNJdWzXG4uWCqoWRMcIxJOeopLsPqZ8vh7W4fB2h6TZzwmWzjijvI1vJbUTqse3Cz
IpdPm2tkAEgYOATWdF4M1a00a2tlis7q4jnuZDINUurWVRLJvGLhA0hHZlbO4hSTkc6ei+I7yLw1
Y614ivbRk1CKFoILDT5vMDuu7YFDyNIcf3VHCk9Ol8+M9D+xQXaT3Esc/mbEgsppZR5Z2vujVC67
TwdwGCQD1oFcxn8Gam13/aT38U2rW+n2sVrdSMwzcRGQuzqBja4faTy21n6Z5nvPD2sz+IkvrZbW
zV5oZZbi31CdGIXbvR7cL5UxIBXexBCkcfKM3B4utE1K8aWeE6XHZWtzBNErO0pmeRQFC5LZ2rtC
jJJ75q5L4q0iDUlsJJ5lmMiRFvssvlJI4BVGk27FY5X5WIPzDjkU9dBmVc+DhqFrpEGoQWd3HDfy
3t7FOvmJIXSXgBlw2GkXGQMBfYVTuPAs0NhqGkaZ9mg0mSeO+tIUleBoZlkDvGGjGVRtuQwO5Cxw
CABV3Vde1c61Fp+lvYwrJfCy864gabDC3eZjtWRM9EA5GPm68VNZeILuwvNWtNfuLOQWEcMv2mzt
3jDCXcBH5ZZzvyvABJbeuBnqt0LYzrbwlqNpFDfwQWi6nBffalgm1G4uVceUYirTygvnaxIIQAYA
weSaWg6drU/l6papp73MV3qdrcxSSvGgElzkshCEsQY+hA3Z6iuq/wCEs0b+zje+fNsE32cw/ZZf
P83Gdnk7fM3Y+bG3O3npzUth4l0nUmiW0uvMaVJXQeWwyImCSZyOCGYDB5/I01caZxz/AA/1FLOz
iBhuGOlQafcj+1Lq1jQxhgWCxY85TvPysV6dRuONG98H39xBrNoj2629zd297aslzLE++JYgY2Kj
cgPlcOrEjdnHHOzN4x0K3t7W4e7kMNzAtysiW0rqkTfdkkIU+Up5+Z9o4PocRWvi+xmn1xbiOe3i
0q4EDSPDJiXKqRt+UbmLNtCruJ+Uj7y5XQDIXwjfJpMuLGya8lu1naOTV7x3UBNgK3ZzIr+4QDaS
uOS1aWjeHtQh+zNqt0J2gtpok/ftKUMr5xvcAvtRUUO3J+YkDNXP+Et0Y2H2sTXBXzvs/kizmM/m
Y3bPJ2eZnb82Nv3eenNDeIIbu20ybS5ElW+ufJUyKylQu4yZU4YMAjDB5DdR2oEc7oXhDVtDCPFF
aSXFlaNbWk1xqt3OshO0BjG/ywjC5KqG7AFQMlW8C3lvo93o9rcRPaPJDexyGV4JTco6l1LRgFUb
YMMpymcAEBQOhtPFuiXrTCK8KpFE05lmhkijeNfvOjuoV1HGWUkcjnkVGvjTQTYz3j3csEUDRrIL
i1lhdfMO1G2Oobax4DYxweeDQBjW3hPU7NINQt4bRdShvftP2ebUrm4SRTEYiGnkBbODkEJgY24P
3qvXWmeIpb7TtUC6W97HBPb3EPmyJGiSsjAq20lyvlgchd2Sfl6Vfh8S2F9JZi1vPLMty1u0NxaS
pKXEbPsKttMZwN2WGCBx94GmxeMdClS5cXjrHbwNcM8lvIivEv3pIyygSKOPmTcOR6igFpqc/beC
dSTS5dMmntfJudAg0yaaN23RyxBxuVcDcp8z+8pGPfgg8GahJFI88VvDO09m3z6pdXxZIZxI3zzf
dyAcKF69WOeOt/tqz/sZ9WP2hbNEaRi1tIH2rnJ8srvPTI45HI4qtc+KtFtVd5bz92iwu0ixOyAS
sFj+YAjJJHGc4IPTmi9hpkmsW2pX2n3NlaraRibEXmysWxG3Dts24LAZwCSD39DiWPhS+sZtLtEa
2bTdLv3uLdmdjK0TQyKVcbcFg8n3s8jk/NnOjb+M9DuZ44I7i4EryiErJZTR+VIcYWTcg8stkbQ+
N2RjOaq2Gsa/qVsZ7W1s2RZ7mFicjBjufLX+LvGHJ9wOnSnGN2Ijt/C17DHpqmS3za6rd3smGPKS
+ftA4+8PNXP0PJ4zteHNOm0jw1pmnXDI01raxQu0ZJUsqgHGQDjj0puqa0mmX2m2rwSyG9mMW5EZ
gmFJycA9wOuOMnoDUw1mxNtFcCb93LIYk+U5LjORjGQRtbPpg0uboack2k7bkF3YXJ8Q2mox+SYE
t5YJg7EEBijAjgg8pjBx1rlZbdZvC/iC7ikjltIrae3sZUIYGLljtI7ZIT/tmK6i08TaTexs8Vzi
MQ+fvljaNWjxksCwAIGRnHTPOKWPxFpz2k86LdkQld8S2cxlAbofL27yDzyBjg+hqOVSehvGpUpr
VbWMi68Panqkck1y1vFMqxLAkMzqGCPuyzgBkLZxxnb1y3SrWn+GAbCWK/aeF5J/OP2TUrndwoUb
pdys3TpwOnHGTZXXJNRj26Ta3PmpLF5gvbGa3Xyy4DlTIq5IXJ4z24qnp/is/wBqXml6tbm1uLGy
ju7icRuIQGL7huI2gAKDncc5YfwmtFTcHzdTOeJnOPK9ja07TINLieOCS7kVm3E3N3LOc+xkZiB7
CuevNC15T4gXT57WNdQuobmJ/tDxuQEjSSMlUJjysZw6kkbs4BGavweNNDuLe5mW4uE+zLG0kc1l
NFIRIcJtjZAz7iCBtByeBzUT+LLe5udKGnsGhuL57S6FxDJFJDtgeXBRwrKflU/MOhz3Bod29TFa
GHbeDdVt7C+3w2dxNcXyXSRyapdb4wIhGQt1gyqwI+9jlSVwoPEw8D3t9/ZrareeY9pbXKq4uHke
GV5EeIqzAGTywnDPySqnGem2dXvtTjgu9BjhuLGSMkSzIybm3oAVzjKlDIQwyDgEEg8ySa68F3fG
S2mls7aRIS1tC0rq5TcxKrliPmQfKpIOSeORShK2grl22GpHRUF2LYal5OH8pm8oyY6gkZxn2496
procy6ZY6dFqM9vbQRBJjCAJJiAAcuclQfmyVAbJBDLjnSsr601K2W5sbqG5gYkCSFw6kg4PI9DV
ijmlHQCtY2Nvp1ottax7I1yeWLMxJyWZjksxPJJJJPJqzRRUtt6sAooopAFFFFABRRRQByXxM/5J
7qn/AGy/9GpXW1yXxM/5J7qn/bL/ANGpXW1kv4r9F+p3VP8Acaf+Of5Uzgtc/wCR68Kf9vf/AKKF
dPXMa5/yPXhT/t7/APRQrp6un8U/X9EZ4z+Dh/8AA/8A0uYVRjvbFdSltYVY3DN+9aO3Yru2/wAb
gbQcY4JzjHtV6sKWRrXWiunRXTvNKDcxNAwhI28yCQgDdwowGIPpnkdEVc86bsaMek6bFny9PtEy
cnbCo5yDnp6gH6gVP9lt/IeDyIvKk3F49g2tnrkd8964u1k1nyLtyl+oYQT+XsnzGRJ+8RS7Et8u
OmA3YdauiXVJbu81CzW9KC4EcUEyOisjRqNwR8YCvznHTd61bg+5mqi7HT21rb2cAgtYIoIlziOJ
Aqj8BUP9l6f9sN59gtftROTN5K7ycY+9jPSuae01WLWlhN9ebY3iWAiCaQPGAu4swkEeSd+d4J9M
8CoI57+PU7lpDePOiXIjheS4QXRydoUFRGuFBxsJJ69aOTzE6i2aOxS0to/L2W8S+UpSPagGxT1A
9BwOPaoBHpuiWzNHBBaQvIoIhiCgsxCjIUepAzXL2Meqy+TavLqHkm+UmQJPGTCYjkZdi4G4EcnI
ODxkVJrNvO948MkeoyFLi2+yCPzni8sMpYuVypOd2S/PAo5NbNj59LpHXLDEjSMkaK0hy5CgFjjG
T68ACoINNsbaCSC3sraKGXPmRxxKqvkYOQBg8VztpFqx153nurpXE0m6IW8vlmLnbhy/l9Nv3V3Z
69zWt4ct54dGtpLuS5e6liUzfaHYkHHTBPy/gBnvScbLcqMuZ7F2DTrG2jjjgs7eKON96LHEqhWx
jIAHBwetJNplhcweRPY20sW8yeW8Ssu49WwR15PPvXPpcagLu3tCt+ZU1CZpH8uTYYSHK/PjaRyv
GeOPSoLaDWYLO1e3a9a7n02UyfaJHdRMAuzIY4U9fTPemovuLmWyR1ywRJKZViRZCoQsFAO0dBn0
5NV10vT1knkWxtg9wCJmEK5kB67uOfxrJ8NRXSPO0t1dSwlVws9vNHh+c4812Y8Y6YX05zSPb6k8
+uTwyXPnpkWKu7CPJiHIXO1vm9eAR25qba2uNSur2NxrS2ffvt4m8xPLfKA7k5+U+o5PHvUS/YdK
S3tYo4rZJZCkUcUe1S2C3QDA6E1zVnHqiabetBdXsoIjyJLeaN1+b95s812Ytt/u8ZxjnNWLizjv
Y9Mjtl1M24viXaZplkUeW2Tuf51GeMk9+Krl8yefqkb502xNzJcmytzPIuySXyl3OvTBOMke1QX+
i2GoWy281vGEUKo2ovCKwbZyPu5UZFc3PHq32W3iknvY7VJrhWfyp5ZCA/7vPlsshG3POSOmexrS
sLW/k1RPtk94yRWcLAktGrS7mzkKxBOMZGSOmc8UcttbhzX0sadxaaXZ6RLFNaWyafGpd4vJBQAc
k7QOfXpViG2tUSFoYIkEabYtqAbFOOB6Dgce1cwY5ptB1GKVNSk1N7ORZ1dZTEXx0QH5D7bO1Fza
6pZx3sFhJe+U1tA+ZGklKneRJsyc52/wqR7YOKOXzDmt0Oo+yW32v7X9nh+07dnnbBv2+m7rj2qa
sbw7HcR2k3nXE80Zk/dGaGSMgYGcCRmfGc/eP04xWzWclZ2NIO6uFcx8Q/8AkRdS/wC2X/o1K6eu
Y+If/Ii6l/2y/wDRqVhX/hS9H+R6OV/79R/xx/NHT1es/wDUn/eqjV6z/wBSf96tGcUdzmvhn/yT
3S/+2v8A6Neutrkvhn/yT3S/+2v/AKNeutrCh/Cj6I9HNP8Afq3+OX5sKy9R0OC/uBdR3FzZ3qqF
W5tZNrYHQMpBRwMnAdWA3EjBOa1KoalrWn6T5YvLgLLLnyoEUySy467I1BZ8ZycA4HNbx5r+6cJi
X3hzUb651NZbi2aLUNMW0eYAqySKZMER8gqfM5+YdPfjK17TtXNu2o3q2MN3LcafbxRQyNKg2XIO
5mKqeS/THAHU5roLfxTBJrF7YXNtPZi0tEupJZ0KqqtuyGbGwYCg53HOSP4TTx4u0U2ct09xJDHC
0auJ7eSJ13nah2MobaTwGxjg88GoZvGU420M3/hG9SvNRi1C9NrFI12ZZYoJWcJH9neIBWKgs2Wz
0XH4co2ia/P4XutBm/s1IRp7WcMqSOzStt2qzAqPLGByBv69eOdaLxDZXkloLe68vzLhoGintpEk
LCNn2lW2mM4G7LDkdOoNNi8W6LNHcSrdOsUELTtI8EiI8a/edGKgSKOOVyOR6ilpYXNPsZOveE7u
/wBTkuLcJJFc2yW8qPqFxbLHt3c7YuJQQ/3SV6deeNrRtKl02fVGdoyl1ciWIITwoijTBz3yh9eM
VHL4s0iBImlluEWRd5LWko8tMkb5Pl/dqSDhnwCASDgVFouuz6tr2sW4Gy0sZRAqtaSIzNtVi3mM
QpHJG0DOMNnBFPQG5uOuxXXw5drBZpvgzDfXNw+CeVk83bjjr+8XP0NV5/C18LDSFhZHns7MWsqL
ey2ytwvzB4xkjK9COc54xzoaT4ngu2aC6YR3HnTou2NghCOwADHgttXJGc9TjFTf8JTpZtY7lXuH
jlyYwltKzOoAJcKFyV5HzYxyBmk+Vo3c8RGVrFSz8MGN5Yp5WW3azt7cfZZ5YXDRlycMG3AfMP4i
Tzn31NN0a20t5GgmvpC4AP2m+mnAx6CR2x+FZD+KwddlhjEslhBbRzM0NjNO0u8nBQoCMdDwDnnp
tOLq65JqMeNJtbrzUli8wXtjNbjyy4DlTIq5IXJ4z24rSHM42Wxz1+fmTqbsh1PR76PWZdW0uKyu
XubZbW7tL2Ro0lRSxUh1V8Eb2BBUgg9sc4+keCbjT7u0ulh0uzUao19JZ2SFYoV+zNCFQ7RuOSrE
7U6nj10m1PX7u7g0q1/s+11CO3W5vZp4nmjjDMyoqorrkkqxzv4C9DniwuvS6RZL/wAJGqx3DXBt
4Ws4XlF18u4Mka7nUkA5U5IKnkjBM7GRR0nwtd2Wq21zcSQNHGuoBvLdt3+kXCypg4GMKCDzweme
tSXHh690vULTUNB23UkUMsDw6pqE7ZVyjbhKwkYYKD5cYOeoxzV8PeOYdTuJBdvIhuLuWGytl0u5
SQJHJsLOSCD1Uk4UJkg8g46HVddsNG8kXjzGSbPlxW9vJPIwH3iEjVmwMjJxgZHqKb8wer1OW8Ue
F/EviCKS3a8tWimsPIJjvLi1SGYht7+XHnzlbKgK7YXB4OSD0mk6VNZw3z3DRm5upNxKMWUKEVFA
JA7KD9Sagv8AxnoOmxxSz3jtFLbi6EkFvLMqwnpI5RSEU88tgcH0NN1K+1e41R7PRrqwt1t7ZZ5p
Lq2a43FywVVCyJjhGJJz1FJdh9TPl8Pa3D4O0PSbOeEy2ccUd5Gt5LaidVj24WZFLp821sgAkDBw
CazovBmrWmjW1ssVndXEc9zIZBql1ayqJZN4xcIGkI7MrZ3EKScjnT0XxHeReGrHWvEV7aMmoRQt
BBYafN5gd13bAoeRpDj+6o4Unp0vnxnof2KC7Se4ljn8zYkFlNLKPLO190aoXXaeDuAwSAetArmM
/gzU2u/7Se/im1a30+1itbqRmGbiIyF2dQMbXD7SeW2s/TPM954e1mfxEl9bLa2avNDLLcW+oTox
C7d6PbhfKmJAK72IIUjj5Rm4PF1ompXjSzwnS47K1uYJolZ2lMzyKAoXJbO1doUZJPfNXJfFWkQa
kthJPMsxkSIt9ll8pJHAKo0m3YrHK/KxB+YccinroMyrnwcNQtdIg1CCzu44b+W9vYp18xJC6S8A
MuGw0i4yBgL7Cqdx4FmhsNQ0jTPs0GkyTx31pCkrwNDMsgd4w0YyqNtyGB3IWOAQAKu6rr2rnWot
P0t7GFZL4WXnXEDTYYW7zMdqyJnogHIx83XiprLxBd2F5q1pr9xZyCwjhl+02du8YYS7gI/LLOd+
V4AJLb1wM9VuhbGdbeEtRtIob+CC0XU4L77UsE2o3FyrjyjEVaeUF87WJBCADAGDyTS0HTtan8vV
LVNPe5iu9TtbmKSV40AkuclkIQliDH0IG7PUV1X/AAlmjf2cb3z5tgm+zmH7LL5/m4zs8nb5m7Hz
Y25289OalsPEuk6k0S2l15jSpK6Dy2GREwSTORwQzAYPP5GmrjTOOf4f6ilnZxAw3DHSoNPuR/al
1axoYwwLBYsecp3n5WK9Oo3HGje+D7+4g1m0R7dbe5u7e9tWS5liffEsQMbFRuQHyuHViRuzjjnZ
m8Y6Fb29rcPdyGG5gW5WRLaV1SJvuySEKfKU8/M+0cH0OIrXxfYzT64txHPbxaVcCBpHhkxLlVI2
/KNzFm2hV3E/KR95croBkL4Rvk0mXFjZNeS3aztHJq947qAmwFbs5kV/cIBtJXHJatHR/DuoRC3O
rXXnmG2miTE7yshlfON7AM+1FRQ5+Y8kgZq7/wAJboxsPtYmuCvnfZ/JFnMZ/Mxu2eTs8zO35sbf
u89OaJPEMFzaabPpkiSre3PlBpEZSqqGMmVOGDAIwwRkN1HagRkweH9dn8MTeG719Ohsl09rKK5h
Z5JJTt2q7IQoQADJXL5z1GOcrxHpmtG0l1O/XT7e8ln021gigkeaMbLoNvZiqE5L/dxwB1OeOhj8
e+HZo1eK6upA8QmiCWFwxmTjLRgJlwMjdtzt74q1eeLdEsRAZ7wlJoVuA8UMkiJEekjsqkRoefmc
gcHng0IadjITwzql7q0Gq35s4ZWvfOlgglaRUjFvJCArlF3MS+TlVAHHOOciD4fagmjXWnt5G9NM
lsba4l1S7uPMLqFDeW/yQDCjKqH64BAHPRa94wtNNuIrK1k8y9N5bW7gwSNEvmyIpUyAbA+xiwUt
nocEVk6v44lt723tLS/t408u7nuL2TSLmaKNIZNhXCsOR8wLbsZUcDeoproFnY6+7GopayR2ENoZ
BDiJp5WVfM6YICn5cc8HPbA61ykPgq+sbJtLtZrWWwa7tb0yTfLJ5qSo0o2quNpVMrz8pO3hQMdF
N4m0q21JNPmuXE7MkZYQSGJHfG1GkC7EY5GFZgTuXjkZn07WrHVpLlLKSST7M5jkcwOqbwSpUMQA
xBUg4Jx36il1uIxLnwxeTHUysluDd6xa3yEseI4vI3A8fe/dNgdORyOca3h7TJtJ02S2naNna7uZ
wYySNskzuvUDnDDPvSR+JNKlMapcOzyXElsE8iTcJEyWDLtyoAGcnA5HPIzQj8e+HZo1kiurqQPE
JoglhcMZk4y0YCZcDI3bc7e+KLjbNDV7C5u7rTLi18om1ufMdZGK5UoyHBAPI3Zx3x1FY1tAl1rW
pNDJHNZWpd0KEMEuHXDrx0K4JP8A11NWRr19e6zNa6WtrPbrb2Vykhz80cskgc5zg4RMj39elWrr
VbnSPC02pahaqbmGIvJDACQW9OM4HTnnHXpScLLmbN6VWStBLyMDStD1DV/DWnpcPbwwDSxFA8TM
WYui4LDA24x0BOc9RWlpfhmUJdDUPMiMyombfU7mSTCkn/WkqyjJ+6AO+Sc4GxDrFlJFKxkaPyIl
mlWRGQohBIJBAPY/kR1FQL4m0t7v7MJ3371jYmFwqswBUM2MKTuGMkZJwOamKjB3RpOrWmnG2hPp
ujW2lvI0E19IXAB+03004H0Ejtj8KydQ0fWTrWq3ul3FrCb3TUt4ppGJeCZDIVbbtIZT5nPPGOhz
WnHr+ny37WaSuZQWUHynCOy/eVXxtZhg5AJIwfQ1BB4ltLyZbe3ttTWV8hDNpdzEmcd2aMAfiRWq
Up67nI4uG6scxaeDNWQ6pPPFZyNd28EaW9xqd1dYaORmJ85wHQndlWUDY2CAcczL4Kvr+2srfWJE
ltYtQe4e0e/mudkJgaPyxK4DyZZtxDYGGK8gc6D+JtR0q80m11mw/ealMkCm1jkcRt5JdydobjeM
DJHGWyQpNaKeLNGk1caYtzJ9oMrwqxtpBE0iglkEpXYWAByA2Rg+hod0xXLOi2+oWmlpbajNHPPE
WRZkJJkjB+Rm4GHK4zjjOcVVg0e9j0oWyag1pPLM81xNCqyPlmLEIXBAwSBkqflGMDgjP1Dxxp/9
iapc6VK0l3a2Mt3CtxayxpMqj7yFgokTJXlCR8w55FacusNcyyWmlbJ7y3lhF0GRtkasVLDfwu8I
d23ORlSRyMuLeyCxc07S7XS4XjtlfMjb5JJZGkdz0yzsSx4AAyeAABwKuVhf2pqUJsIJ7WN7ySGS
e4hhxnagAwmWAyWZOpx1q9p2tWGqGRLWf99EAZbeRGjmjz03RsAy5xxkDI5HFEoy3eoi/RRRUDCi
iigAooooAKKKKAOS+Jn/ACT3VP8Atl/6NSutrkviZ/yT3VP+2X/o1K62sl/Ffov1O6p/uNP/ABz/
ACpnBa5/yPXhT/t7/wDRQrp65jXP+R68Kf8Ab3/6KFdPV0/in6/ojPGfwcP/AIH/AOlzCsqPVLqb
U7uBLW3W1tJAks8lyVblAxIXYR37sK1awYtLu7XX72/jsdPm+0MCs7ylZUUIBt/1Z4yPXvXRC2tz
zp30sa32602b/tUGzyvO3eYMeX/e/wB336VDa6taz6e9+1xbJaqzDzROrJtBwCW6D6dqxB4ZuxY3
dsJYSLl0uG2s0eyVXDGNSoBEZxweoOTzniePQriOBJkjiW6S6W48p7uWVXwu0BpHBPTkELxgDHeq
5Y9zPmlfY24r21nEZhuYZBKpeMpIDvUdSMdQMispLnw9YaxbrDHYxXV+jOk8axr5gyONw5JYnjrn
Bpbmx1J7izvoobP7RGksckJmZUw5ByGCEkjb6DOe1Q2ui31nFo5QwSSWlu1vMPMZBhtuWU7Tkjb0
IHXqKEl3G230NZNU0+Rp1S+tma3BMwEykxY67uePxqaC6t7lHeCeKVUYqxjcMFYdQcd65eDwrcx6
fNany962kltDM15NJu3DGSjfLGOBkDd7Yxz1EEAhtI4AAAiBML0GBjilJJbDi5PdDDf2YjWQ3cAR
0Mit5gwUHVgfQZHNNi1OwnimlhvraSOHPmukqkR/7xB4/Gub/wCEd1SSzjtJDZrHBYTWkbrKxLl9
oViNo2/d5GTVzUPD0949wVkRFe3t0UB2TLROWwSvIByBkcinyx7i5pdEbltd217CJrW4iniJIDxO
GU/iKj/tKxLSL9ttt0Sl5B5q5RQcEnngAgg1W0bTmsIp2kjWOWZ9zAXMk/QADLyck8eg9O2TSfw/
K+h3dnvRZZrtrkFHZQ37zeAWGCOABkdO2aVo3HeXLe2prLqVg9k16l7bNaL1nEqlB/wLOKp3HiGw
trq0V7m2FrcxPIt006hPlKjAPQ53evaqcehXEcCTJHEt0l0tx5T3csqvhdoDSOCc45BC8YAx3q3/
AGddTajZ3kyW0ZjhmSRI2LAM5UjBIGehyePpTtG4ryaLs2pWNt5Pn3ttF5/+q3yqvmf7uTz1HT1p
/wBttPtItvtUP2gkgReYN2QMnjr0IP0NcuPCl0lvbRny5f8AQ0tZV+1zQqu3PICY3g7j8px06jNa
qaGwXWYzIsYvwER0yWVRGE5z7gnrQ4x7gpTfQlvNfsYLCS6t7i3ukilSKTy5lITcwXkjOMZz+FWl
1XTmsmvVv7U2qnBnEy7Af97OKzZ9N1C90wWs8FlCyPBt8uVnDKjhjklBjgcDn61BfeHri4uLm4Rk
Ja8W5SMTvDuAiEZBdBlT1ORn9aEo7BzT3R0MM0VxCk0EqSxOMq6MGVh6gjrT6o6TY/2fYCEqquXZ
2CyvIAWOT8znLfU4z1wOlXqh76Gkb21CiiikMK5j4h/8iLqX/bL/ANGpXT1zHxD/AORF1L/tl/6N
Ssa/8KXo/wAjvyv/AH6j/jj+aOnq9Z/6k/71UavWf+pP+9WjOKO5zXwz/wCSe6X/ANtf/Rr11tcl
8M/+Se6X/wBtf/Rr11tYUP4UfRHo5p/v1b/HL82FZeo6HBf3Auo7i5s71VCrc2sm1sDoGUgo4GTg
OrAbiRgnNalUNS1rT9J8sXlwFllz5UCKZJZcddkags+M5OAcDmt481/dOExL7w5qN9c6mstxbNFq
GmLaPMAVZJFMmCI+QVPmc/MOnvxla9p2rm3bUb1bGG7luNPt4ooZGlQbLkHczFVPJfpjgDqc10Fv
4pgk1i9sLm2nsxaWiXUks6FVVW3ZDNjYMBQc7jnJH8Jp48XaKbOW6e4khjhaNXE9vJE67ztQ7GUN
tJ4DYxweeDUM3jKcbaGb/wAI3qV5qMWoXptYpGuzLLFBKzhI/s7xAKxUFmy2ei4/DlG0TX5/C91o
M39mpCNPazhlSR2aVtu1WYFR5YwOQN/XrxzrReIbK8ktBb3Xl+ZcNA0U9tIkhYRs+0q20xnA3ZYc
jp1BpsXi3RZo7iVbp1ighadpHgkRHjX7zoxUCRRxyuRyPUUtLC5p9jJ17wnd3+pyXFuEkiubZLeV
H1C4tlj27udsXEoIf7pK9OvPG1o2lS6bPqjO0ZS6uRLEEJ4URRpg575Q+vGKjl8WaRAkTSy3CLIu
8lrSUeWmSN8ny/u1JBwz4BAJBwKi0XXZ9W17WLcDZaWMogVWtJEZm2qxbzGIUjkjaBnGGzginoDc
3HXYrr4cu1gs03wZhvrm4fBPKyebtxx1/eLn6Gq8/ha+FhpCwsjz2dmLWVFvZbZW4X5g8YyRlehH
Oc8Y50NJ8TwXbNBdMI7jzp0XbGwQhHYABjwW2rkjOepxipv+Ep0s2sdyr3Dxy5MYS2lZnUAEuFC5
K8j5sY5AzSfK0bueIjK1ipZ+GDG8sU8rLbtZ29uPss8sLhoy5OGDbgPmH8RJ5z76mm6NbaW8jQTX
0hcAH7TfTTgY9BI7Y/Csh/FYOuywxiWSwgto5maGxmnaXeTgoUBGOh4Bzz02nF1dck1GPGk2t15q
SxeYL2xmtx5ZcBypkVckLk8Z7cVpDmcbLY56/PzJ1N2Q6no99HrMuraXFZXL3Nstrd2l7I0aSopY
qQ6q+CN7AgqQQe2OcfSPBNxp93aXSw6XZqNUa+ks7JCsUK/ZmhCodo3HJVidqdTx66Tanr93dwaV
a/2fa6hHbrc3s08TzRxhmZUVUV1ySVY538BehzxYXXpdIsl/4SNVjuGuDbwtZwvKLr5dwZI13OpI
BypyQVPJGCZ2MijpPha7stVtrm4kgaONdQDeW7bv9IuFlTBwMYUEHng9M9akuPD17peoWmoaDtup
IoZYHh1TUJ2yrlG3CVhIwwUHy4wc9Rjmr4e8cw6ncSC7eRDcXcsNlbLpdykgSOTYWckEHqpJwoTJ
B5Bx0Oq67YaN5IvHmMk2fLit7eSeRgPvEJGrNgZGTjAyPUU35g9Xqct4o8L+JfEEUlu15atFNYeQ
THeXFqkMxDb38uPPnK2VAV2wuDwckHpNJ0qazhvnuGjNzdSbiUYsoUIqKASB2UH6k1Bf+M9B02OK
We8dopbcXQkgt5ZlWE9JHKKQinnlsDg+hpupX2r3GqPZ6NdWFutvbLPNJdWzXG4uWCqoWRMcIxJO
eopLsPqZ8vh7W4fB2h6TZzwmWzjijvI1vJbUTqse3CzIpdPm2tkAEgYOATWdF4M1a00a2tlis7q4
jnuZDINUurWVRLJvGLhA0hHZlbO4hSTkc6ei+I7yLw1Y614ivbRk1CKFoILDT5vMDuu7YFDyNIcf
3VHCk9Ol8+M9D+xQXaT3Esc/mbEgsppZR5Z2vujVC67TwdwGCQD1oFcxn8Gam13/AGk9/FNq1vp9
rFa3UjMM3ERkLs6gY2uH2k8ttZ+meZ7zw9rM/iJL62W1s1eaGWW4t9QnRiF270e3C+VMSAV3sQQp
HHyjNweLrRNSvGlnhOlx2VrcwTRKztKZnkUBQuS2dq7QoySe+auS+KtIg1JbCSeZZjIkRb7LL5SS
OAVRpNuxWOV+ViD8w45FPXQZlXPg4aha6RBqEFndxw38t7exTr5iSF0l4AZcNhpFxkDAX2FU7jwL
NDYahpGmfZoNJknjvrSFJXgaGZZA7xhoxlUbbkMDuQscAgAVd1XXtXOtRafpb2MKyXwsvOuIGmww
t3mY7VkTPRAORj5uvFTWXiC7sLzVrTX7izkFhHDL9ps7d4wwl3AR+WWc78rwASW3rgZ6rdC2M628
JajaRQ38EFoupwX32pYJtRuLlXHlGIq08oL52sSCEAGAMHkmloOna1P5eqWqae9zFd6na3MUkrxo
BJc5LIQhLEGPoQN2eorqv+Es0b+zje+fNsE32cw/ZZfP83Gdnk7fM3Y+bG3O3npzUth4l0nUmiW0
uvMaVJXQeWwyImCSZyOCGYDB5/I01caZxz/D/UUs7OIGG4Y6VBp9yP7UurWNDGGBYLFjzlO8/KxX
p1G440b3wff3EGs2iPbrb3N3b3tqyXMsT74liBjYqNyA+Vw6sSN2ccc7M3jHQre3tbh7uQw3MC3K
yJbSuqRN92SQhT5Snn5n2jg+hxFa+L7GafXFuI57eLSrgQNI8MmJcqpG35RuYs20Ku4n5SPvLldA
MhfCN8mky4sbJryW7Wdo5NXvHdQE2ArdnMiv7hANpK45LVpaLoGpWxtpNTuhPJb200cYM7ylDJJn
aXYBn2qqKHPzH5iQM1c/4S3RjYfaxNcFfO+z+SLOYz+Zjds8nZ5mdvzY2/d56c0P4hgurXTZtMkj
lW9ufKDSKy7VXcZMqcMGARhg8huo7UCM7SPC93p/9gea9uf7O0h7GXYTzI3k8rx0/dtycHkcVmL4
P1y00dbC1fTpPtejQaXdvNI48gxq6mSMbD5gxI3ynZ90c8nHQReNNBmiuJRdypHBbtdM8trLGHhX
70kZZR5ijI5TcOR6irOoeJdI0szi9uxF9nWF5SUYhRK5SM8Duyke3fFMerOfufDGtpPNZ2b2D6bN
qVtftLPI4mTy2jLIFCkHPl5Dbh1xjvVe68EanNY3UCz2gaW01SBSXbAa5nEkefl6ADn0PTNb7eM9
CS0S4e5nQPP9mWJrSYTebtLhDEU3hioyAV5yMZyMyDxZozizEVzI8l5v8lEtpWb5WCvuULlNpIDb
sbe+MUJgm9jBuvBV1L4guLgLHNZ3V1FcyNJqd1GIygQFfs6ERyf6sEMxGM8htvO/oem3mj6a1uVt
5HkvridyJCAEkmdwR8vLAMBjgdeaqL420S3tLZrvUfMd7WK6eWGzmCCNwcSsMN5aHaeWPy9zVyPx
Vo8ttd3AuZFS02+aJLeRGO44QorKC4Y8KVBDHgZNIRlQ+HNVi19td3WRvLpmguodx2JbYATY23Jk
G1SSQA2SDwqYdpHhe70/+wPNe3P9naQ9jLsJ5kbyeV46fu25ODyOKvnxhogs0uTcT4ec2wh+xzed
5oXdsMWzeG2jdgryMHoRWld6naWEtpHcyNGbqUQwkoxBcgkAkDC5xxnGTx1oTsh3MLwr4bvNDkja
5kgcLpVnZHymJ+eHzNx5A+U7xjv14FbOt2Mmp6HfWMTKslxA8as3QEggZqhN4y0OBYybi4fzfNMS
xWc0jSCNgrlVVCWALDkZBHI4BNU9R8baf/YWqXekTrcXFrYyXkJkgkEUyquQysQBIuSAdhOM4OKH
qrDjJxkpIZqUD3Wr6fZs0H2q4h2X9vG+/EIO7JyASuQUBIH+sPpUFvYX99qGs20ItltG1JGlkdiJ
F2xxNhVxg5xjkjHXnpW7bTaw+qHzra2FkXbbIp+fZsQr367jIOnQD8Yn8SWtvrF/ZTxyxR2cCTPO
Y3K4YnPO3GBgc59f7pqZ00tJPc6oV5tNRWy/UzrHwvdW2rrJIVe2jnkmSQ3szH5t2AIs7FI3Y3ZP
ToM8atp4asrO6S4juNUZ0OQJtUuZVP1VpCp/EVPfa5p+nMVup9hAQn5Scbm2r0Hc8VF/wkem/Y/t
PmS48zyvK8iTzd+M7fL27845xjpz05pxlyqyZlU9rVtKSI9d029vbvR7qyEDPY3nnOkzlAyGN42w
Qp5G/IGOcYyOtc8vhTXp/E1rqN7cwSx219JOHN/OwkiZZFRRb4EUZVXUZGS2CcjJz0k3iTT4raC4
C3s8c4O021jNPjBwQwRDtIPGGwcg+hqGTU9TvBFPpFoDbMh3fbIJIZA4dBja+1sbTIenUD8bjF7m
LunZnNjwbrcmnapZBrWzguNOmtUgh1C4mgkkfAVxHIuLdV5+RN3DYz8oz02iaPPol1c20Bj/ALJc
LJChdjJFKc+YORyrHD5JzuZs9ap6d430670V9SuIrq2QXklmkRtZmkkdXZRsTZuYkLkhQdvzA/dN
WD4z0P7FBdpPcSpP5mxILKaWUeWdr7o1Quu08HcBgkA9aWq0EW/7Puf7Sv71ZY0llhSG3LAuqBdx
yV46sxyAeQo5o0/Q4bK5N3NcXN7elShuLlwSAeyqoCJ0GdqjO0Zyeazh4utE1K8aWeE6XHZWtzBN
ErO0pmeRQFC5LZ2rtCjJJ75q/Dc6u2osZYLddP3uVk5D7NiFSQTwdxkB46AfjacmtxM1qK5+28UQ
RWNtdasDaQ3MfnJdMhECoSSod8kIdu3ltoJOFz0G+rBlDKQQeQR3qZRcdx3FoooqQCiiigAooooA
5L4mf8k91T/tl/6NSutrkviZ/wAk91T/ALZf+jUrrayX8V+i/U7qn+40/wDHP8qZ5x4tv4NL8V+G
by5bbFH9qycgcmNQBk4AySByQPWtWDxXp89o10BIII5PLmcMkiwnGQWKMwwcjkZwTziszxTaR33j
DwvbyM6hjdMGQ4ZWCKQR7ggH8K3H0WK4gWG9ubi8j3l5EnKlZTjADAKBgdcAAZ5OTW1HlvO/f9EY
Y7m9lh7fyP8A9LmUZfEQtbu5luIrtIkhhZbd0jXl2IDbt/HYENjGPerM2rXUes6fZjT5fLuYXeQE
pujIKjn58YGecZ7YzT00JYt7RX94krQpD5p8tm2KSQPmUg/exkg8e/NJH4ftoYbGOCe4iNojRqyl
SXRsFlIKkYOB0Ax2xXR7p5tpkCeK7F1usRSmS2dEeNHjcku20Y2uR16gkEelNvfEUkemzT29jMLi
C6jt5beXZuXcV9Hwchhjnqee9Oh8K2kMax/art0VI0UMUwFjcMgGFHQ59zk5zwRbn0S2nS8VpJlN
1KkzMpGUdQoUrx22g85o9y4L2lipP4s0621FbGbdHNlFkDSRZjZsYUrv3E8jlQw568Gt2syPRhHc
+ct/eDeVaZAUAmdQAGbCgg8DIUgHHI61p1EuXoXDm+0FFFFSaBRRRQAUUUUAFFFFAgooooAKKKKB
hRRRQAUUUUAFcx8Q/wDkRdS/7Zf+jUrp65j4h/8AIi6l/wBsv/RqVjX/AIUvR/kd2V/79R/xx/NH
T1es/wDUn/eqjV6z/wBSf96tGcUdzmvhn/yT3S/+2v8A6Neutrkvhn/yT3S/+2v/AKNeutrCh/Cj
6I9HNP8Afq3+OX5sKy9R0OC/uBdR3FzZ3qqFW5tZNrYHQMpBRwMnAdWA3EjBOa1KoalrWn6T5YvL
gLLLnyoEUySy467I1BZ8ZycA4HNbx5r+6cJiX3hzUb651NZbi2aLUNMW0eYAqySKZMER8gqfM5+Y
dPfjK17TtXNu2o3q2MN3LcafbxRQyNKg2XIO5mKqeS/THAHU5roLfxTBJrF7YXNtPZi0tEupJZ0K
qqtuyGbGwYCg53HOSP4TTx4u0U2ct09xJDHC0auJ7eSJ13nah2MobaTwGxjg88GoZvGU420M3/hG
9SvNRi1C9NrFI12ZZYoJWcJH9neIBWKgs2Wz0XH4co2ia/P4XutBm/s1IRp7WcMqSOzStt2qzAqP
LGByBv69eOdaLxDZXkloLe68vzLhoGintpEkLCNn2lW2mM4G7LDkdOoNNi8W6LNHcSrdOsUELTtI
8EiI8a/edGKgSKOOVyOR6ilpYXNPsZOveE7u/wBTkuLcJJFc2yW8qPqFxbLHt3c7YuJQQ/3SV6de
eNrRtKl02fVGdoyl1ciWIITwoijTBz3yh9eMVHL4s0iBImlluEWRd5LWko8tMkb5Pl/dqSDhnwCA
SDgVFouuz6tr2sW4Gy0sZRAqtaSIzNtVi3mMQpHJG0DOMNnBFPQG5uOuxXXw5drBZpvgzDfXNw+C
eVk83bjjr+8XP0NV5/C18LDSFhZHns7MWsqLey2ytwvzB4xkjK9COc54xzoaT4ngu2aC6YR3HnTo
u2NghCOwADHgttXJGc9TjFTf8JTpZtY7lXuHjlyYwltKzOoAJcKFyV5HzYxyBmk+Vo3c8RGVrFSz
8MGN5Yp5WW3azt7cfZZ5YXDRlycMG3AfMP4iTzn31NN0a20t5GgmvpC4AP2m+mnAx6CR2x+FZD+K
wddlhjEslhBbRzM0NjNO0u8nBQoCMdDwDnnptOLq65JqMeNJtbrzUli8wXtjNbjyy4DlTIq5IXJ4
z24rSHM42Wxz1+fmTqbsh1PR76PWZdW0uKyuXubZbW7tL2Ro0lRSxUh1V8Eb2BBUgg9sc4+keCbj
T7u0ulh0uzUao19JZ2SFYoV+zNCFQ7RuOSrE7U6nj10m1PX7u7g0q1/s+11CO3W5vZp4nmjjDMyo
qorrkkqxzv4C9DniwuvS6RZL/wAJGqx3DXBt4Ws4XlF18u4Mka7nUkA5U5IKnkjBM7GRR0nwtd2W
q21zcSQNHGuoBvLdt3+kXCypg4GMKCDzwemetSXHh690vULTUNB23UkUMsDw6pqE7ZVyjbhKwkYY
KD5cYOeoxzV8PeOYdTuJBdvIhuLuWGytl0u5SQJHJsLOSCD1Uk4UJkg8g46HVddsNG8kXjzGSbPl
xW9vJPIwH3iEjVmwMjJxgZHqKb8wer1OW8UeF/EviCKS3a8tWimsPIJjvLi1SGYht7+XHnzlbKgK
7YXB4OSD0mk6VNZw3z3DRm5upNxKMWUKEVFAJA7KD9Sagv8AxnoOmxxSz3jtFLbi6EkFvLMqwnpI
5RSEU88tgcH0NN1K+1e41R7PRrqwt1t7ZZ5pLq2a43FywVVCyJjhGJJz1FJdh9TPl8Pa3D4O0PSb
OeEy2ccUd5Gt5LaidVj24WZFLp821sgAkDBwCazovBmrWmjW1ssVndXEc9zIZBql1ayqJZN4xcIG
kI7MrZ3EKScjnT0XxHeReGrHWvEV7aMmoRQtBBYafN5gd13bAoeRpDj+6o4Unp0vnxnof2KC7Se4
ljn8zYkFlNLKPLO190aoXXaeDuAwSAetArmM/gzU2u/7Se/im1a30+1itbqRmGbiIyF2dQMbXD7S
eW2s/TPM954e1mfxEl9bLa2avNDLLcW+oToxC7d6PbhfKmJAK72IIUjj5Rm4PF1ompXjSzwnS47K
1uYJolZ2lMzyKAoXJbO1doUZJPfNXJfFWkQakthJPMsxkSIt9ll8pJHAKo0m3YrHK/KxB+Yccinr
oMyrnwcNQtdIg1CCzu44b+W9vYp18xJC6S8AMuGw0i4yBgL7Cqdx4FmhsNQ0jTPs0GkyTx31pCkr
wNDMsgd4w0YyqNtyGB3IWOAQAKu6rr2rnWotP0t7GFZL4WXnXEDTYYW7zMdqyJnogHIx83XiprLx
Bd2F5q1pr9xZyCwjhl+02du8YYS7gI/LLOd+V4AJLb1wM9VuhbGdbeEtRtIob+CC0XU4L77UsE2o
3FyrjyjEVaeUF87WJBCADAGDyTS0HTtan8vVLVNPe5iu9TtbmKSV40AkuclkIQliDH0IG7PUV1X/
AAlmjf2cb3z5tgm+zmH7LL5/m4zs8nb5m7HzY25289OalsPEuk6k0S2l15jSpK6Dy2GREwSTORwQ
zAYPP5GmrjTOOf4f6ilnZxAw3DHSoNPuR/al1axoYwwLBYsecp3n5WK9Oo3HGje+D7+4g1m0R7db
e5u7e9tWS5liffEsQMbFRuQHyuHViRuzjjnZm8Y6Fb29rcPdyGG5gW5WRLaV1SJvuySEKfKU8/M+
0cH0OIrXxfYzT64txHPbxaVcCBpHhkxLlVI2/KNzFm2hV3E/KR95croBkL4Rvk0mXFjZNeS3aztH
Jq947qAmwFbs5kV/cIBtJXHJatPQ9B1G1e0l1S5W4e3t5UjBmebaZJN20swDOFVUUO3J+bIGat/8
JboxsBdia4K+d9n8kWcxn8zG7Z5OzzM7fmxt+7z05ok8QwXNpps+mSJKt7c+UGkRlKqoYyZU4YMA
jDBGQ3UdqBHOQ+DNXks9SsZZLextLnT5rQRW99PcQu74CusUgxAq84RCRhsZ+UZqeINL11be41K+
XToLi5l0u3ijgleZFeO6JyxZFJB8wcY9R7nq7DxnoGpRtLbXx8oW5uRLNDJEjxAfMys6gMFyN2Cd
p4OKZH420CW3uJjc3ES2/lGRJ7KaJ8SNtjIR0DMGPAIBGaaY07M5vVNP1qDW9J1GSPT11O71UMls
sztCqpaTAKZCgbJ5+bZxkcHHOvpfhi/t9Yi1O7e1814rwzJEzEJJM8TKEJAyAIyCxwSecDOBPp/j
jTbxNYmmiu7S30yZYmee0mQybkQjCsgO4l9oQZY/KcfMKsr4x0R7J7oT3GEn+zNAbOYT+btDbfJ2
eYTtO77vTnoKNlYSdjBh8E6jH4ev7BprQzXHh+30tGDNtEsayhiTtzt+dcd+DxVvXPCF1qtzqEsc
0aLLBZCFVmeIl4JXkILJ8yA7gAykkcnHGDpnxloZsYryO6mnileREFvayyuTGdrnYilsKeC2MDI5
5FWYfEelXOoQWNtcmeeeFbiPyYndPKYEq5dQVUHacEkZ6dxRd7DuYGm+Eby3u7C7ljt4ZItRN3Mh
v7i8Yr9neIfvZuWOWB6KAOOSMnY13S73XbL+zZFt4bKabFy6ysZDCORs+UbWJAGc/KOQScEWbvxB
plhPdQ3Vw0cltALiRTE/MZOAVwPn54wuTkgY5Gac/jTQba6e2nu5Y5I5FikLWsuyN2VWVXbbtUkM
uASMk4HPFLdCKemeHtTt7/TpbtrMx2Flc2UbREgujNF5bFdoCnbGdwHAPTg4GdP4J1GTw9Y6ek1o
JYPD8+lsdzbTK4iAYfL93922T15HFa8vilLmbShpfzpdXr2ky3MEkUkZWCSTBRwrKcqvUdD7g1pa
TNq0kLNq0EEThIyBCc/MUBcdT0bIHt61XTmHfoaKKVjVT1AxWJdWBj1fUL66a2GmT2SxTNJJtKbC
5OeMbSHPORjFO0jxLa6pDGzJLbvLPLBGkkbruKE9yo5wM47cjqDT7nxLpdvL5LyyPJlxsigeQnYQ
GwFBzgkZ/H0NZtp63NowqQk1Y5hre4k8N2947JJczX1okUrjIeNJVWNjjs3L/wDAzWhd+G9TvVa7
lMCXhuRL5EN1LGm0Jsx5qgNnvnbjtjvWxP4i0q28ndPuSSNZQ8cbOiIejsyghFPPLEDg+hpLvxJZ
WV09vJb6o7pjLQ6XcyoeM8MkZU/gaFSUttbG0sTUjra25VtfC8LabBBeSXcUiM7kWeo3MYy7ZOWD
gufdvfAGcVs2NjFp9qLeF7h0BJBnneZuf9pyWP51z+teINV0Ow1DVZ7COXTrVJJUVFbzHUIhTIGS
MuXBO3gDJxjNWr7xloumRRSXk1zF5kAuWAspmMUZ/ilAQmIdeX29D6GtJXS5b6HHKTk+ZmRJ4d8Q
xaQ9hbSWvljU57lkjvprZriCRncKZUQtEwZ1+7nIXGQCRVSLwZq1po1tbLFZ3VxHPcyGQapdWsqi
WTeMXCBpCOzK2dxCknI56ibxTpEGpCwkuJPOMiRF1t5GhV3xtRpQuxWOVwCwJ3L6jNXSvE6XkCRX
LIL+e6u4YIYo3bKwysm5sZ2jAXLHAywHGQKSuF+plP4M1Nrv+0nv4ptWt9PtYrW6kZhm4iMhdnUD
G1w+0nltrP0zz1Gp2lzf6LNaIyxTTxeW5VzhQ3DbWxnIBOOOuOlZx1LWrXSZJr+3tY7thBFAqZKm
VwqnPzdA7Hv0H41dh16ya/8A7PuGe0vCxWOK5XZ52MnMZ+7JwMnaSQCN2DxV8slquhIl5o8l9IkT
39xBYIgX7Nat5Rc/7Ug+cAcY2FehyWBwNC3t4bS2jt7eJIoY1CoiDAUDoAKloqXJtWGFFFFSAUUU
UAFFFFAHJfEz/knuqf8AbL/0aldbXJfEz/knuqf9sv8A0aldbWS/iv0X6ndU/wBxp/45/lTOC1z/
AJHrwp/29/8AooV09cxrn/I9eFP+3v8A9FCunq6fxT9f0RnjP4OH/wAD/wDS5hWAttZXuu6k+pRx
vJa+WYPNI/dR7Qd6/wB3LbvmGPujnit+qFxDpV9e+TdQW09zbIJQJYgxjVicEEjjlT09K6Iux501
dGdHrN415E7fZvss13LarCFPmqUDfMWzg52HjAwCOeOcy41nULjQWN39hlF5p0tyI1iddgXblW+f
JBDYyCuCO9dLawabdldUtYLdnuIxi5WMB3UjjnGfSq1vpOj6DpMwFtCtukOLiRolLSKByXwPm79q
tNLoZ8sn1M865qf9oNDbWKm0t3iikLbBncFOdzSAj73A2NnHXnjS0e9vb83E05gWBJ5YUREO47XI
DEk46Dpj3z2ps1zognN5JDE9xbMsKyC2LyqSuQq4UseGzge/vV6xmtJ4HezCiPzXDbU2fOGO7IwO
c55pSemwQWu5lXWt3FudQASHNveQQJuB5V9mSeevzHFRQa1qDXMDyi2a1mvJrXy0jYSDZvw27dg/
c6Y79e1bE2l6fcXS3U9jbS3C42yvErOMdMEjNSi0tl24t4hscyLhBw5zlh7nJ59zRzRtsU4yb3MP
Q9a1PUbiFrmzSK1uYjLEcoCoGOOJGL9eTtXHpzVyS+vW1+Syh8lbeGBJ3ZkLO2WYFR8wx93r29Dn
i9BYWdrNLNb2kEMsxzI8cYVnPuR1qURRiZphGglZQpfaNxA6DPpyfzpOSvsCi0rNnMWPiPU5Ld72
508C1a1e5iVSithQDgYkYt1wTtXHpzin6w9/JoObie0eR5rZ4/KjZQmZV6gscj34zzxW/BYWdrNL
Nb2kEUsxzI8cYVnPuR160yHStOt43jgsLWJHYOypCoDMDkEgDqD3p8yvdIXI7WbMKfXdUtxLaCGG
4vVvBbJJFHtUgx+ZnY0g57Y3+/tUsGratcXFjamK2gmmWbzWcbwvlsozhHIGcnK7jg9+Oduaxs5o
pkntYJI5SGlV4wQ5GMFhjnoPyplithPa2tzZxReSI8QMse3ahxwBjgcDj2p8y7ByO+5Ttb28vJZp
S9vHaLLJAIWQ+YSuRnduxzjONvTvWFpWr3uk6JZCVYbiA6a9xGkaFHXywvBJJBzu64GPeus/s+y+
2G8+yQfaiNpn8sbyMYxuxnpTktLaPy9lvEvlKUj2oBsU9QPQcDj2pKSXQHBvqZmiahqd1NLFqFsk
eEWRGXYpIOf4VkfjjhsjPPHFbNUtPj02Brm30+CCAxSATJDEEG4qDzgAE4I5q7Uy1ZcNFqwoooqS
wooooAK5j4h/8iLqX/bL/wBGpXT1zHxD/wCRF1L/ALZf+jUrGv8Awpej/I7sr/36j/jj+aOnq9Z/
6k/71UavWf8AqT/vVozijuc18M/+Se6X/wBtf/Rr11tcl8MyB8PNLJOAPN/9GvWzZeILHUpmWwZ7
qFAS11EuYB7CT7rnqDtJwRziscPFulG3ZHo5p/v1b/HL82alZeo6HBf3Auo7i5s71VCrc2sm1sDo
GUgo4GTgOrAbiRgnNZej+MI726uILyI26w2aXxnKOsYicuRliNowgUk7uTuxjacXB4u0U2ct09zJ
DHE0auJ7eSJ13nah2MobaTwGxjg88GtruDOPkl2KN94c1G+udTWW4tmi1DTFtHmAKskimTBEfIKn
zOfmHT34yte07VzbtqN6tjDdy3Gn28UUMjSoNlyDuZiqnkv0xwB1Oa6aLxDZXkloLe68vzLhoGin
tpEkLCNn2lW2mM4G7LDkdOoNNi8WaLNHcSi6cRQRNOZHgkVHjX7zoxUCRRxyuRyPUVGhrGc49DM/
4RvUrzUYtQvTaxSNdmWWKCVnCR/Z3iAVioLNls9Fx+HKNomvz+F7rQZv7NSEae1nDKkjs0rbdqsw
Kjyxgcgb+vXjnUl8WaRAsTSy3CLIu8lrSUeWmSN8ny/u1JBwz4BAJBwKz7XxZLLrGrK9tcvYWMwt
8Q6dM0gOxW3k/wAQycbUUnGG+6c0KN9EK87Xa2Ide8J3d/qclxbhJIrm2S3lR9QuLZY9u7nbFxKC
H+6SvTrzxtaNpUumz6oztGUurkSxBCeFEUaYOe+UPrxir9lfWmpWy3NjdQ3MDEgSQuHUkHBGR6Gr
FO1tCHUk1ZnLr4cu1gs03wZhvrm4fBPKyebtxx1/eLn6Gq8/ha+FhpCwsjz2dmLWVFvZbZW4X5g8
YyRlehHOc8Y57Cik4pqxqsVURzVn4YMbyxTystu1nb24+yzywuGjLk4YNuA+YfxEnnPvqabo1tpb
yNBNfSFwAftN9NOBj0Ejtj8K0aKpNpcq2MZzc3zSOe1PR76PWZdW0uKyuXubZbW7tL2Ro0lRSxUh
1V8Eb2BBUgg9sc4+keCbjT7u0ulh0uzUao19JZ2SFYoV+zNCFQ7RuOSrE7U6nj17miktCbnJaT4W
u7LVba5uJIGjjXUA3lu27/SLhZUwcDGFBB54PTPWpLjw9e6XqFpqGg7bqSKGWB4dU1Cdsq5RtwlY
SMMFB8uMHPUY56mim3cHqcJ4o8L+JfEEUlu15atFNYeQTHeXFqkMxDb38uPPnK2VAV2wuDwckHpN
J0qazhvnuGjNzdSbiUYsoUIqKASB2UH6k1r0UlpoBx8vh7W4fB2h6TZzwmWzjijvI1vJbUTqse3C
zIpdPm2tkAEgYOATWdF4M1a00a2tlis7q4jnuZDINUurWVRLJvGLhA0hHZlbO4hSTkc+g0UBc4d/
Bmptd/2k9/FNq1vp9rFa3UjMM3ERkLs6gY2uH2k8ttZ+meZ7zw9rM/iJL62W1s1eaGWW4t9QnRiF
270e3C+VMSAV3sQQpHHyjPY0UXA5G58HDULXSINQgs7uOG/lvb2KdfMSQukvADLhsNIuMgYC+wqn
ceBZobDUNI0z7NBpMk8d9aQpK8DQzLIHeMNGMqjbchgdyFjgEACu6ooA4e28JajaRQ38EFoupwX3
2pYJtRuLlXHlGIq08oL52sSCEAGAMHkmloOna1P5eqWqae9zFd6na3MUkrxoBJc5LIQhLEGPoQN2
eor0WimnYadjzh/h/qKWdnEDDcMdKg0+5H9qXVrGhjDAsFix5yneflYr06jccaN74Pv7iDWbRHt1
t7m7t721ZLmWJ98SxAxsVG5AfK4dWJG7OOOe2opdLBc4ZfCN8mky4sbJryW7Wdo5NXvHdQE2Ardn
Miv7hANpK45LVo6RoWo2a282qXQne2tpkjHnvKUMj7tu5gC+1VRQ7cn5iQM11FFAjzbw1o/iHUPC
OiTRT2Fm1rpBWwnjLOzSSRKFZ0K4UKPQtuPPHQy23gfVzcz3E7wJ5z2J8qTUri8KiC48xv3kozyC
cAAAH869Eopp22Hc5G80LXgfEC6fNaxrqF1DcxP9oeNyAkaSRkqhMeVjOHUkjdnAIzXPSaTc+EWT
V7690+CV9S86JL2/neHDW/llJLmRWZSNuQzDBIC4GRj0+ikJ6nl+l+G7/VtLstYtwkshnvmESalc
WCSRzTl1kWSEFiMKCARhgwPGOeq0Hw5caHeSzILZk/s23tY0R3A3xmUty25gp3jklj1z79NRTvqB
ymveHtT1y8hu99nDJp6LNYJkuGuMgnzSV/1fygADnktwyrhkvhi/uYtRMhtFlvNWtL7aHZgqReRu
XO0ZP7pscc5HTJx11FJaDucoPDN6PEQ1DzIPJ/tc323cd3l/Y/Ix0+9u59Md88V1Z6UUUPVWEcde
2s+j6FKs72/2pL957ALJ807NIzhMEcMQzLgZ4Ofo17G9sde0yCwjt5bhdPnMnnMY1djJEWbIBwSx
J6V2RUHqM4pcDOe9RyHUsU0tV3/E4m48G3mI0ikSZHtUgmLXc0CgjOW2Rn5wd33SR0xu543J/DNl
dTGaW41NHIAKwapcxIMDHCpIAOnYVtUVcPc+Eyq1p1fiMvX9LfVvDGo6VBIEkubWSBHkJIBZSASe
tct4m8M+JfEUEkDTWsUM9h5Hlx6lcRJbzEMHbbGq+epBUYfAGDwckHvaKDI4y48Nau2vQ3Vr9mtU
82F5Lq3v542ZUCh1e3A8qUkKV3sQQCOPkGZNG8K3uiX6XttJb+bcXdy18pkYiSF5Xkj25HDJuHy8
L88nc5rr6Kdwepn31jJeX+nyFgILaRpmXccs20qoxjkfMT9QKrnQvtV79p1K8muwkm+K3z5cEeDx
8g++eFOXLYYZUL0rYopqclsAUUUVIBRRRQAUUUUAFFFFAHJfEz/knuqf9sv/AEaldbXJfEz/AJJ7
qn/bL/0aldbWS/iv0X6ndU/3Gn/jn+VM4LXP+R68Kf8Ab3/6KFdPXMa5/wAj14U/7e//AEUK6erp
/FP1/RGeM/g4f/A//S5hXG6hpuo3Oo319bRyK88wsSTlSLcqoLgezbiD9a7Ks6DUbi51K4gitohb
W0nlyyvMQ+7aG4TaQRyOSw7/AI9EG07o82ok1ZmBHbS2MENjNHqKabbSzoPsiyhzyGi/1fzFdrMM
jjI5qHVo9Rm0nytRTUHdtNxGtssh3XBB3CTyuP7v3vl5Ndcb+zEayG7gCMhkVvMGCg6sDnoMjmok
1jTJLSS7TUbRraM7XmWdSin0LZwOoq+d9iORLS5zf9nXU2qQCVb8wx6irr+9lCqpgySOeF3cegyR
3IqOeHVVtoInnvYrVbi5DN5dxNJ9/wDd58t1k27c4OSOme1dUNU09rVboX9qbdyQsomXYSMk4Occ
YP5Gq8GuWUguZZLq0jtopAizfaUZX+UMc8/KevB9M0+eT6C5I9yjp9rfSarH9tnvGjis4WyS0atL
ubOQrEE4xkZI6ZzxVnVbie01Wzn23TWvlSpIsEbyfOdpUlVB9G5xx+NXo9SsZUmeO9tnWAZlZZVI
jGM/Nzx+NIuq6c1styt/am3YkLKJl2kgEkZzjgA/lUttu9i0layZyiW+rT6ZI8rams8WlRvEBJIp
M/z5yAfmb7uQc9sirE6avLr257m5h+eIwJHbSshTA3ZIcRjnfneCfTPFdSbmBYEnM8YhfbtkLja2
emD75GPrUc2o2NsHM95bxBG2uXlVdpxuwcng45+lPnd9iXTXcpa1Fczy6bFA9wkbXOJzAzL8mxs5
I6DOOfXHesi5t9UHiAot1dxxpJGLZUhmkVowBu3P5gjzndneC3pniuik1XTobRLuW/tUtpOEmaZQ
jfRs4PQ1YeaKOAzvIixBdxkLAKB659KlSa6FSipdTDtPMOpzi7/tA3nmybQol+z+Vzt/6Z9Mf7Wa
yrCy1Wx06yWxF4s8mmy70mZ2RJgF2Daxwh5PAx711Emr6bFAZ5NQtEhD+WZGmUKH/u5z19qfcahZ
WgiNzeW8IlOIzJKq7z7ZPNUpNdBOMX1OUhh1QabceReag+6SADNvNGynzBvI812Y/L1x8uPxrTvY
Tb38cMzambFYR5BtnmdjLuO7eykk8bcbzt61eh120fVLnT5poIZ4pRHGjzDdLlQ2Qp57479KtjUL
JrxrMXdubpRuaESDeB6lc5ocn2Eox7nN3Njdpf6lewC9Sb7db+X5buFdMRhztHysMbskg4x2xS2M
WqnxEXuLq5VhPJuiFvL5Ri52/OX8rpt+6u7PXua6Aapp7QyzC/tTFEA0jiZdqA9CTnjPaqlx4hsL
a6tFe5tha3MTyLdNOoT5SowD0Od3r2oUm9LA4x3ua1FVZtSsbbyfPvbaLz/9VvlVfM/3cnnqOnrV
qsmmjZNPYKKKKBhXMfEP/kRdS/7Zf+jUrp65j4h/8iLqX/bL/wBGpWNf+FL0f5Hdlf8Av1H/ABx/
NHT1es/9Sf8AeqjV6z/1J/3q0ZxR3PNfBvjLwtYeBrTSNWvUEgWVJoHt5HUq0jHBwpBBBH51JP4r
8NR2N1Z2Xiq5NrcxmIw3Uc8hiDcEpIUL5wWPzFucAbRXp1FY0vbU4qMZKy8v+CetiMVg69WVWVKV
5Nv4111/kPK9S8U+Gry91VItagjs7/TEs932ebfE6+Zg7PLwy/vPUdPes/U/F2n36S3smo2KXzSW
SRwwxzyRqkU/mM7M0aE/ePy44C8Ek17JRS5av8y+7/ghHE4OO1OX/ga/+QPJf+Ep0G81KLUL3WLW
KVrsyyxQR3DhI/s7xAKxiBZstnouPw5RvGWnz+F7rQZtX01IRp7WcMqRXLNK23arMDGPLGByBv69
eOfWz0rxnWf+Q7qH/XzJ/wChGt8PhqlZ8vMlby/4JhWx2DppfupP/t9f/Kyxr3iDw1f6nJcW+rJJ
Fc2yW8qPPe26x7d3O2JcSgh/ukr0688X7bxd4eg/tJIfE4s0u7tZlkgs5HkVBDGmBvjKg7k7huPc
5DPh54b0LWbbXbjVNF06+nXU9iyXVqkrBfs8BwCwJxknj3Ndl/wgvhD/AKFXQ/8AwXxf/E1k41IS
aUl93/BNPrODlGzpy/8AA1/8rMbTvHPgbS4XjttVfMjb5JJY7iR3bplnZSx4AAyeAABwKuf8LM8I
f9Bf/wAlpf8A4ir3/CC+EP8AoVdD/wDBfF/8TR/wgvhD/oVdD/8ABfF/8TSftW7uS+7/AIJPtMD/
AM+5f+Br/wCVlH/hZnhD/oL/APktL/8AEUf8LM8If9Bf/wAlpf8A4ir3/CC+EP8AoVdD/wDBfF/8
TR/wgvhD/oVdD/8ABfF/8TRap/Mvu/4Ie0wP/Puf/ga/+VlH/hZnhD/oL/8AktL/APEUf8LM8If9
Bf8A8lpf/iKvf8IL4Q/6FXQ//BfF/wDE0f8ACC+EP+hV0P8A8F8X/wATRap/Mvu/4Ie0wP8Az7l/
4Gv/AJWUf+FmeEP+gv8A+S0v/wARR/wszwh/0F//ACWl/wDiKvf8IL4Q/wChV0P/AMF8X/xNH/CC
+EP+hV0P/wAF8X/xNFqn8y+7/gh7TA/8+5f+Br/5WUf+FmeEP+gv/wCS0v8A8RR/wszwh/0F/wDy
Wl/+Iq9/wgvhD/oVdD/8F8X/AMTXI+JbeG1vbe3t4o4YYoikccahVRRI4AAHAAHatKNGpUly8y+7
/gmdXEYGnG/sp/8Aga/+VnQf8LM8If8AQX/8lpf/AIij/hZnhD/oL/8AktL/APEV5h4n48K6r/16
yf8AoJr1z/hBfCH/AEKuh/8Agvi/+Jqq9CpSlbmT+X/BFSxGBqK/sp/+Br/5WUv+FmeEP+gv/wCS
0v8A8RR/wszwh/0F/wDyWl/+Iq9/wgvhD/oVdD/8F8X/AMTSf8IL4Q/6FXQ//BfF/wDE1jap/Mvu
/wCCa+0wP/Puf/ga/wDlZS/4WZ4Q/wCgv/5LS/8AxFH/AAszwh/0F/8AyWl/+Iq9/wAIL4Q/6FXQ
/wDwXxf/ABNH/CC+EP8AoVdD/wDBfF/8TRap/Mvu/wCCHtMD/wA+5/8Aga/+VlH/AIWZ4Q/6C/8A
5LS//EUf8LM8If8AQX/8lpf/AIir3/CC+EP+hV0P/wAF8X/xNH/CC+EP+hV0P/wXxf8AxNFqn8y+
7/gh7TA/8+5/+Br/AOVlH/hZnhD/AKC//ktL/wDEUf8ACzPCH/QX/wDJaX/4ir3/AAgvhD/oVdD/
APBfF/8AE0f8IL4Q/wChV0P/AMF8X/xNFqn8y+7/AIIe0wP/AD7n/wCBr/5WUf8AhZnhD/oL/wDk
tL/8RR/wszwh/wBBf/yWl/8AiKu/8IL4Q/6FXQ//AAXxf/E0h8J+HNMeK7sNA0q0uY5U2TQWccbr
lgDhgMjgkfjRy1P5l93/AAROpgV/y7n/AOBr/wCVlP8A4WZ4Q/6C/wD5LS//ABFH/CzPCH/QX/8A
JaX/AOIrjaUV6Cy+q1fnX/gP/wBscjx+BT/gz/8AA1/8rOx/4WZ4Q/6C/wD5LS//ABFH/CzPCH/Q
X/8AJaX/AOIrP8FnOty/9e7f+hLXe1x1qNWnPl5k/l/wTop18DON/ZT/APA1/wDKzkv+FmeEP+gv
/wCS0v8A8RR/wszwh/0F/wDyWl/+IrraKytV7r7v+Cae0wP/AD7n/wCBr/5Wcl/wszwh/wBBf/yW
l/8AiKP+FmeEP+gv/wCS0v8A8RXW0UWq9193/BD2mB/59z/8DX/ys5L/AIWZ4Q/6C/8A5LS//EUf
8LM8If8AQX/8lpf/AIiutootV7r7v+CHtMD/AM+5/wDga/8AlZyX/CzPCH/QX/8AJaX/AOIo/wCF
meEP+gv/AOS0v/xFdbRRar3X3f8ABD2mB/59z/8AA1/8rOS/4WZ4Q/6C/wD5LS//ABFH/CzPCH/Q
X/8AJaX/AOIrraKLVe6+7/gh7TA/8+5/+Br/AOVnJf8ACzPCH/QX/wDJaX/4ij/hZnhD/oL/APkt
L/8AEV1tFFqvdfd/wQ9pgf8An3P/AMDX/wArOS/4WZ4Q/wCgv/5LS/8AxFH/AAszwh/0F/8AyWl/
+IrraKLVe6+7/gh7TA/8+5/+Br/5Wcl/wszwh/0F/wDyWl/+Io/4WZ4Q/wCgv/5LS/8AxFdbRRar
3X3f8EPaYH/n3P8A8DX/AMrOS/4WZ4Q/6C//AJLS/wDxFH/CzPCH/QX/APJaX/4iutootV7r7v8A
gh7TA/8APuf/AIGv/lZyX/CzPCH/AEF//JaX/wCIo/4WZ4Q/6C//AJLS/wDxFdbXiNn/AMf2tf8A
YXvv/SmSmo1X9pfd/wAEHUwK/wCXc/8AwNf/ACs9B/4WZ4Q/6C//AJLS/wDxFH/CzPCH/QX/APJa
X/4isPwr/wAjJaf8D/8AQGr0mhxqr7S+7/giVXAv/l3P/wADX/ys5L/hZnhD/oL/APktL/8AEUf8
LM8If9Bf/wAlpf8A4iutopWq9193/BH7TA/8+5/+Br/5Wcl/wszwh/0F/wDyWl/+Io/4WZ4Q/wCg
v/5LS/8AxFdbRRar3X3f8EPaYH/n3P8A8DX/AMrPMfHPjnw5rPg2/sLDUfOupfL2J5Ei5xIpPJUD
oDXp1FFOEJKTlJ/1r5vuTiMRSnSjSpRaSberT3UV0jH+U4LXP+R68Kf9vf8A6KFdPXMa5/yPXhT/
ALe//RQrp6qn8U/X9ETjP4OH/wAD/wDS5hWRd2N5datDMsNrBHEwzcrKxmkjwcxldoGCT/eI4zjP
TXrk7nV7iPWb6KPVP38NxFHBp+Iz5qsqFjjbvPVjkHAx6CuiCbeh5tRpLUgudD1WLSjG8du6WmnT
20fkuzyTFgNp27Rg/L0yetS32nao9nLeSW0P2h/skcdvA7PkJLu3M20EfeP8JwB3rUl8T2UF5e2s
iSCW0heZgrxsWVcZwAxIPI4YLTbzXbiIac9vps7pdXHl7W2BmTYWBX5wBnHf0OQOK1vLsZNQ7kK6
HdzXcV3ci2Rzfi6kijYsqgRbBgkDccgHOB+nL5dDuZNUa63w+Wb0XABJztEOz065/SpZfFFhBe3d
rOHjktYmlb50fKrjPCsSDyPvAVHN4rtLaKdru2ntZIpVi8qZ4lLMy7hht+3pzyw/Ol74/cKK+Frz
+z/s7zxAi0t4gEkdQzxOWwSACAcgZHI9Ksw+HpQ9rK8cSMl4LmVTcyzkgRlR878k5wegAH0ybEHi
e0ultfssE9w9yJNiRFDgoQGBbdt79QSDjg9M6V1ex2k1rHIrlrmXyk2gcHaW59sKaTlMajB6oh1m
ylv9NaGAoJQ6SJvJCkqwbBIBwDjGcVlxaLqEmoC8uRaoTfC5MccjOAoh8vAJUZOeegq03iKEuscF
ndzyM0wCRhAf3bBWPzMB1PHNQXXjLSrRLd3ckTQrPgvGhRD0JDMCTweFyeOnTJHmS0HJwb1ZWk8N
3YMUqMkjxzXDCJbuW3G2V9wO9BnIxyMYOfatSbSmPhiTSoPLVzamFeW2glcdyTj8zVm+1OCwsBey
B3iJQDyxkncQBx+NZt/4ssdLeOK8jkhmZPMeJ5YlaNckAnL/ADdDwu4+1K8mFoRdw1LQ5p2sJbYB
jaxNF5Iu5LYYO3kPGM8behGDn2oi0e60+WF7KK1mX7Kts8c0rqqAEnK5DFgc9CR0HNXhq0cl59nt
7a4uFUqJZowuyMsARnJBPBB4Bxms7TNfkaUwXsM/7y7mhiudqeWdrMQvBzwq9SMcdafvWFaC1HXO
h3E/9obWhzcXkE6ZJ4VNmQeOvynFRWvh2WDUjI4WSJZ5LhJWvJictuOPK+4CNxG7ngdOeHQeNNKu
RcGNmYRQvONrxsZEXrgBiV7cMF/nV5taXZDssbt5p8mKAbA7oACX5YADkdSDz0ovNaBaD1KkWiXF
toel20XkNc2DLJsLFY5GAIOTgkfeznB5FWP7OuptRs7yZLaMxwzJIkbFgGcqRgkDPQ5PH0qpda/N
ZarcGW2uZLOOzjndEVMw5L7i2SCeAOBnp0qa48WaXbamLF5MvuRWbzEG0tjA2lg56jop6+xwe9uF
4IzB4Uukt7aM+XL/AKGlrKv2uaFV255ATG8HcflOOnXmutRBHGqDooAFOoqJSctzSMFHVBRRRUlh
XMfEP/kRdS/7Zf8Ao1K6euY+If8AyIupf9sv/RqVjX/hS9H+R3ZX/v1H/HH80dPV6z/1J/3qo1es
/wDUn/erRnFHcsUUUVJYUUUUAB6V41rP/Ic1D/r5k/8AQjXsp6GvGdZ/5Dmof9fMn/oRr0Mv+N+h
x4z4Ubvg/U7Hw5Y3qS3sMj3t19qK7ZB5f7uNNvCHP+rzn3x2yej/AOE203/ntD/5E/8AjdeWXFzB
aQtNcypDEvV5GCqPxNVYdc0q4mSGHUrSSWRgiIkyszMeAAAeTWtTCUlL3pGcK9RrRHrn/Cbab/z2
h/8AIn/xuj/hNtN/57Q/+RP/AI3Xms8L288kMq7ZI2KsOuCDg0zFUsvg1dMn63NdD03/AITbTf8A
ntD/AORP/jdL/wAJrpv/AD2h/wDIn/xuvMsUlH9nQ7h9ckenf8Jtpv8Az2h/8if/ABuj/hNdN/57
Q/8AkT/43XmNLT/s6HcX1yR6b/wmunf89of/ACJ/8bo/4TXTf+e0P/kT/wCN15mKKX9nQ7h9ckem
f8Jrp3/PaH85P/jdch4h1G3vr+OW3kEi+WdxUEAEuzY5APQisKlrWlgo05cyZFTEymrMS9s01awu
NPe5W2S5jaIzMpYICMZwOT9P5V6b/wAJlp//AD2h/OT/AON15nS062EjVldsKeIlBWR6X/wmen/8
9Yfzk/8AjdH/AAmen/8APWH85P8A43XmmTRmsf7Oh3NPrkj0v/hM9P8A+esP5yf/ABuj/hM9P/56
w/nJ/wDG680zis6fxDpdtO8Mt0BIhwwCM2D6ZAqZYGnHeRtSqVqztCNz13/hM9P/AOesP5yf/G6U
eMbA/wDLWH85P/jdePf8JPo//P5/5Cf/AAp6+KdGA/4/f/IT/wCFZ/VaP8x0Klin9g9fHi+xP/LS
H85P/jdL/wAJZZ/89Ifzk/8AiK8jHivRB/y+/wDkJ/8ACnjxbof/AD/f+Qn/APiaX1al/MP2OK/k
PWf+Ess/78P/AH1J/wDEVHN4nsZ1VGmiUb1YkeYejA9NntXlf/CXaH/z/f8AkJ/8KT/hLdD/AOf7
/wAhP/hR9WpfzB7HFfyG3jNB4FYv/CW6H/z/AH/kJ/8ACp7TxBpeo3At7W7V5SCQpRlzj0yBmu6N
SGyZyTwVeKcnFnZ+Cv8AkNy/9cG/9CWu/rgPBX/Ibl/692/9CWu/ry8Z/FZthvgCiiiuU6AooooA
KKKKACiiigAooooAKKKKACiiigAooooAKKKKACvEbP8A4/ta/wCwvff+lMle3V4jZ/8AH9rX/YXv
v/SmSqiJnS+Ff+RktP8Agf8A6A1ek15t4V/5GS0/4H/6A1ek0S3CIUUUVIwooooAKKKKAPOPFuo2
uleLPDN7ey+Vbxfat77S2MooHABPUirX/Cw/C3/QU/8AJeX/AOJrp648X+u2XhRJNCtIJ5Drdwsx
kmZWVDqLBgFEb5UqXDNxsGWGSMVDhOMm4ta+XlbudqxGGqUoQrQk3BWupJfactnF9+5Z/wCFh+Fv
+gp/5Ly//E1Wt/G3hG2ubqdNWctcyCRw0EmAQoXj5PQCr2mXEtz411SSdESb+yrDzEjcuqt5l1kB
iASM98DPoKl07Ufs2h399dPJIlvcXLHks21XbAH4DAq4xrNaSX3P/MznUwCetOf/AIGv/lZzD614
LczA69dCOQTKIxC21RLy+P3eeuDk5PHpxV+88YeEryG3T+2poXt3DxSx277lIBH8SEHgkcjvWlH4
kvHtJ5f7GnEkewqNswQhjg5LRBuOpwrcVtQ3LXGmrcxmB3ePcvlS74ycdmxyPfH4VTVdbyX3f8Ez
jVy16KnP/wADX/ys4KXXfCKxzmDXblmZJgkbRsijzeWGRETycHJyRj04qLS/EHh2CzaG41lLYpMJ
bc2lsd0TbcE5ECKcg4wUP1PbasdV1qc6LM0cMs01nLIyG5KJIB5eGbCcNyeMHr1qa78UG5gtha2N
3J5kEd1KsQk3BSSQgMaNydp6lR79cW44j+Zfd/wTP2uW7+yn/wCBr/5WVYvF/hKO5trltbnlmgR0
DSQyHdvIJJ+T24AwB6U7UPGfhPUI4gdalgkhkEscsVu+5WwR/EhHQkcjvWnN4iuFvmtoLBGAmECt
LOUJcx+YMjacDGR9e3ox/FaKunOturJdJE8iq7l4d7BQSAhXGT1Zlzg4qfZ4juvu/wCCae3y1K3s
5/8Aga/+VmNZ+JfBtlLFIut3EkkfnfNJC/zGRgzE4jHccYxTI/EXg+3jgS28QXcHlwrA5jhfMqLn
AYmPg8nlcHnr0rUu9U1IXOoxyIptYb6CJXiuTHIgby+MbOQc85Pcir51+Y3sSpZxtaS3L2wlM5D7
lDEnZtxjKkfep8mI/mX3f8ESq5bt7Kf/AIGv/lZl33jXwjf2wgl1Z1QOj5WCTOVYMOqeoqC68XeE
7i7+0x6/c20jII5fIhceaoJIBzGSMZPK4PPWtn/hJ40srS6ltmWOeyku2CtuKhAp2jjnO726VHH4
kvHtJ5f7GnEkewqNswQhjg5LRBuOpwrcUuTELqvu/wCCN18t605/+Br/AOVmWfF/hQX7XUOvXEAk
ZWlijgbbKQMAkmMt0AHBHSo08UeDEEI/teUiK5e6AMEnLPuyD8nT5jXaWc4urSKcNC3mKGzDJ5if
g2Bke+KmqX7ZfaX3f8EtSy9q/sp/+Br/AOVnAr4k8ILZTWTeILx7V4WgSJonxEh4wuI+eMAFt2Pz
zZuvGHhO48h49cmtp4FKpNFbsW2nGR80ZGDgdu1drRSvW/mX3f8ABC+X/wDPqf8A4Gv/AJWcLN4o
8HXAufM1qdjc2otZGMMmdo3c/c+98x/wpV8V+Eo7szQ6/dRI5VpYUhcJIygAEny9w4AzggHHPeu5
oovW/mX3f8EL5f8A8+p/+Br/AOVnMf8ACw/C3/QU/wDJeX/4mj/hYfhb/oKf+S8v/wATXT0VNqv8
y+5/5le0wP8Az7n/AOBr/wCVnMf8LD8Lf9BT/wAl5f8A4mj/AIWH4W/6Cn/kvL/8TXT0UWq/zL7n
/mHtMD/z7n/4Gv8A5Wcx/wALD8Lf9BT/AMl5f/iawfGXjLQNW8J3tlZX/m3Evl7E8mRc4dSeSoHQ
GvRaKmdOpKLi5LXy/wCCbYfFYKhVjWjSleLTXvro7/yBV6z/ANSf96qNXrP/AFJ/3q2Z5kdyxRRR
UlhRRRQAHpXjOs/8hzUP+vmT/wBCNezHpXjGtf8AId1D/r5k/wDQjXoZd/EZxYz4UZx/5COkf9ha
x/8ASmOvb77H9nXP/XJv5GvGbW7ls5vOhKBwMAtGr4/Bgau/8JFqX/PWH/wGj/8Aia2xOFqVKnNE
zo14whZkWs/8h3UP+vmT/wBCNcjHqEUFtcXBu92pKG8yCWdsR/NjPl5xtA5zgZAznnNdHNNJcTyT
StukkYuxxjJJyab2rtjTaikc/Ors55NbvXDmN7SSOLJMqRsVmXcB8vzcdcZy3IP4Nm1y+gg81kgb
zFDKQmBGNxUlizgHp6rye9dIOlPFJwl3Hzq+xz1vq95NNbxt9kRZVG6T7wRiDtX5WIJbgj5uBxzk
E14tbuo4oEBt9xijIhbc0km5SS6ktnaD169DyK6wU7FHLLuHNHsY2n3txJFcG68omNFkzEhGAy5x
jJJI/X0rJtfFEjwvJO0CoGZRIQFVvk3L0dhyQw684xwa7DZmk8sUWlpqK67HJrrV3G1x515ZoTLG
FEkeBCjIpLn5hlcnHbk9e1SRaxqFwsZj+yoCY1JMbNu3kgMPmHHAOOcg9e9dMY8dKaUNCg+43Ndj
mU8QXD31nbZh3SjbJ+7+6x3YYfPnGQP4cc43ZpkGsXf2C1uXnhupRaO7iNWG2QbMhgGI43c8Z44x
muoxQRin7OXcOeNtjm18QtH5plu7GaFWZBPEpVC3l7gv3jznI681Lp2tXd5qv2Z4Ylj25K5UOowD
uxv3EE/7I6jk1tpDHHJLIq4eUguc9cDA/QU+iMJq12DlHXQK8y0uC3utWsre7l8m2lnRJZNwXYhY
Bjk8DAycmvTc1xk/g26E7/Z7iEw5+QyEhse+BXNjac525T3cjxVGipxqO1zbk0Jta8ZLoD6TFp2n
RX0kEd3BalH2LGWCFzwxZVDZbJ+bI4OKZY+D9HvdJi1jdfJbSaZd3n2bzkLh4JFXG/ZjDBv7vGO9
ZzaB4gk+zb9U3fZMfZ91xIfJxjGzj5eg6egp8ui+JJ5nml1hpJHiMDu9zIS0Z5KEkcr7dK4fYVOx
6jxNNWUaqReuvB+j2OjXeryvfSwrYWV7FbrMisPPZlKs+wg4K5BCj0x3q3P8PtG02e8N9qNw0C6n
HYwqgIch4lk6LG5d8MABhQSp5GQKw30HxBJAbeTVA8JjSMxtcSFSiHKrjGMAk4HapU0rxRDcTTx6
3Ik023zZFu5Q0mBgbjjJwOmaPq9TsL61H/n8h1l4T06bSNXv5P7VddIlkjmWOEJ9pGSFK7hmIr1c
EMQOfarmoeFdOh0RdWuHnkjt9HsrgwQ+XCzvM7L94IeBjuCxzy3FZcWga/B9n8nVBH9n3eRsuJB5
W7723A+XPfHWnxaN4kgmSaLWGjlSIQI6XMgKxjogIHC+3Sj2FTsEsVBu/tUbV34B0fTbgw3E97OX
1qLTYzHKke1JIkkDHKNkjdjtnHauPjsv7N8YrYeZ5n2bUBDvxjdtkxnHbpWp/YPiD/oKD/X/AGn/
AI+JP9b/AM9On3v9rrUmn+GbxdWS9v7pJCsnnMysWd3znkkevJP/AOunDD1OZaFfXaUacueopXR6
z4J/5Dcv/Xu3/oS16BXnfgWTfrko/wCndv8A0Ja9EqMYrVWfPYd3gFFFFcpuFFFFABRRRQAUUUUA
FFFFABRRRQAUUUUAFFFFABRRRQAV4jZ/8f2tf9he+/8ASmSvbq8Rs/8Aj+1r/sL33/pTJVREzpfC
v/IyWn/A/wD0Bq9Jrzbwr/yMlp/wP/0Bq9JoluEQoooqRhRRRQAUUUUAZNcU9v4aaa5MK+JiDcze
Z9ibU/J83zG8zb5fyff3Z28ZzXa1xvl67P4TQaFeQW8i63cNKHhZmZF1FicMJEwoUPuXneuVGM5q
2Qi94aj0KLUL9dMXU1vPKhNwNR+1+Z5eZPLx9o525837vGc1px6FYRSyOqTYlLl4muZDGxbO7MZb
bzk9qzNJkml8aaobh0kmGlWAkdEKKzeZdZIUkkDPbJ+pqTSrpLLQdRupH2LFc3TltpbGJG7Dk/Sq
he2hE7J6l+PRLKKB4U+0qHxlxdy78DoA+7cAOeAccmrdtawWdqltBGEhQYC5J/Mnkn3PWs3QNTu9
Qju0vYhHPbyhCAoXIKqwyod8Hn+8fw6Vm/8ACRamst1ObVXtbeO4d41t3UqYzhQJSdj5wc7Rx+FW
4ybsZqUEr2Nu20Wws5EkhicMgZUDTOwRWxkKCSAOBwOB2pjaBprRwR+Q6pDGIlCTOu5B/C2D849m
yOT61lwap4gltrhfsMJuFWOSMlU+6zYPyCZs4AJB3Lnp2pst7e3upaW9lqEBiltJmfdbuEdlKg/J
vBB7YPI59afLK+4uePY2zpNi1wZzB+8MomzuP3wmzOM/3eMVXbw5pbJGht2CxxrGoWZwMKcrnB5I
PIJ5HasSz1m7g0OE2iWcEdppqXciSK5Dg7vlU7sr908nd1HFXJ9b1BLm5kQWwtbe6hgaNo28xhIE
53bsAjf6HOO1HLK+4c0GtUas2jWFxcvPJE5eQqzgSuqsykFSVBwSNo5xnjHSoJ9AtpNStr6J5IpI
pzM6CRyjkqVPybtoPOc4z+dTatez2q2sVt5YmupxCryqWVOCxJAIJ4UjGRya5uy1LU7S2jsrOBZ7
qa5u3eRYgV+WXBwrSp13f3jjHfqCKk1uObit0dDB4e0y3l8xLdidjRhZJndFRvvKFYkAHA4Ap0ei
WUUDwp9pUPjLi7l34HQB924Ac8A45NUYdW1Brqxe6SC2s7mNACF83fK2fkDq+F7YOCD65xVq/vb1
NXs7C0MCieKR2klQtt2legBGfvH/ACMFNSva4JwtexftbWGyto7e3TZFGMKuSfzJ5J9z1qauWg1P
ULzW1n/s9Ps6zS2sTOUUqRnJB8zJJKdNgOO/HM1rrd8JLS3vPIF29ysVxEIWTyQY2YYO9g2SvDA4
7YBpODeo1US0OjorlYL2fUNbtpj5auiX0SMqkj5ZFUE8+3PNVI9d1PT/AAvYTecl3ctbNcMDAT+6
UDJZmlGDk9eSc8LxT9m7CdVHa0Vzc1zqza9emxlidVsI5I7aRTgsS+OdwAORyccjA461raTeNeWZ
aWVXnjcxyhYTFsYdVKlm5HHOSD1HFS4WRUaibsXqKKKk0CiiigAooooAKvWf+pP+9VGr1n/qT/vV
LHHcsUUUVJYUU13WNGd2CqoyWJwAKz9J17T9bWQ2MkxMe0sk1vJC2GGVYLIqkqcHDAYODg8GgDSr
En8JaJcTyTy2e6SRi7HzXGSTk9626xNR8W6JpN49reXbpJGFMzJbyPHAGOFMrqpWMH1cjjnpVRnK
L912JcVLdDP+EM0D/nx/8jP/APFUf8IZoP8Az4/+Rn/+KrdBBGR0qjea3ptjp91fT3kYtrRts7p8
/ltxkELk55HHvVe2qfzP7yfZQ7FD/hDNB/58f/Iz/wDxVH/CG6D/AM+J/wC/z/8AxVbwORmij21T
+Z/eHsodjB/4Q3Qf+fE/9/n/APiqUeDtCH/Ll/5Ff/GtS/vrbTNPuL+8k8u2t42llfaW2qoyTgcn
j0qaKVJokljOUdQyn1Bo9tU/mf3j9lDsY3/CIaH/AM+X/kV/8aX/AIRHRP8Any/8iv8A41q3d3b2
FnNd3cyQ28KF5JHOFVQMkk1n2/iTTbhbYhrqE3M5t4VubKaBncIXwFkQHG0E56cYzmj2tT+Zh7KH
Yi/4RLRP+fM/9/X/AMaP+ES0T/nz/wDIr/41t0Ue1qfzMPZw7GJ/wiWif8+f/kV/8aD4R0Q/8uX/
AJFf/Gtuij2tT+Zh7OHYw/8AhEND/wCfL/yK/wDjSf8ACH6F/wA+X/kV/wDGt2ij21T+Z/eHsodj
C/4Q7Qv+fL/yK/8AjR/wh2hf8+R/7/P/AI1ppqNrJqcunLLm7hiSZ49p4RiwU5xjkq35VZZgqlmO
ABk0e2qfzP7w9lDsYf8Awh2hf8+P/kV/8aP+EO0L/ny/8iv/AI1fsdY0/UYLSa1u43W8h8+3Una0
kfHzBTg4G4Z44yKvUe2qfzP7xeyh2ML/AIQ7Qv8Any/8iv8A40f8IfoX/Pl/5Ff/ABrdqhbazp95
fXVnBcq89r/rVwQB64JGGweDgnB4ODxR7ap/M/vH7OHYo/8ACH6F/wA+X/kV/wDGj/hDtCP/AC5f
+RX/AMa2be4hu7eO4tpo5oJFDJJGwZWB6EEcEVJR7ap/Mw9nDsYX/CHaF/z5f+RX/wAaP+EO0L/n
y/8AIr/41u0Ue2qfzP7w9nDsYX/CHaF/z5f+RX/xo/4Q7Qv+fL/yK/8AjW7RR7ap/M/vD2cOxm6f
oGmaXO09nbeXIV2E72bjIPc+wrSoqOe4htbeS4uJY4YY1LySSMFVVHUkngCocnJ3bKUUtESUVXub
23tIFmmfEbMqKVUsWLEAAAZJ5IqxSGFFFRNcwJcx2zTxrPIpdIiwDMoxkgdSBkZ+ooAlooooAKKj
nuIbW3kuLiVIYY1LvJIwVVUdSSeAKgj1K0m1GXT45g1zFEk7oFPCOWCnPQ5Kt37UAW6KKKACiiig
AooqJbmBrp7ZZozcIodogw3KpyASOoBwefY0AS0VVTUbWTU5tOWXN3DEkzx7TwjFgpzjHJVvyq1Q
AUUUUAFeI2f/AB/a1/2F77/0pkr26vEbP/j+1r/sL33/AKUyVURM6Xwr/wAjJaf8D/8AQGr0mvNv
Cv8AyMlp/wAD/wDQGr0miW4RCiiipGFFFFABRRRQBk1xh07Q9TnubqP4drfZuZke5+y2X710kZHb
55AxyytyRk9a7OvNbzU9KuvD39nnxjZ6TeW2uTzS273VupITUTJlhIrMGCruXGASRuyKtkI6jw4u
l2uo39hZeGRodzHFDNMght081HMgQ5hZgcFH69M+9aMOl6NLPJdQ2Ng8rM6vKkSFieQwJA69Qfxr
B8Manaar4s1aWz1OHUkj02xie4jlR9zB7nO4phQ3IJAA69BUmnavDbaVqcFrPby6mk908VoZBvYh
2I+XOTVQTa0M6jSep0ltY2lkpW0tYIAQARFGF4GcdPqfzrOtfDlna6u+pB2aZixx5USD5uuSiBm/
4ET69eaxLfVNSk027kOuWGxfLIuPtKEIS3zLv8lUUkdAQxB69RW4t81z4WN5b3RgdoCyXF5sXaez
Ngbcd8gY7jIq7SXUzUoy0sWho2lravarptmLd23PEIF2M3qRjBNSPp1jLFDFJZ27xwEGFGiUiMjp
tGOMe1cpc3ovNP0m7bU54ooL5llu3MJX7jDcHCbCueAcDryM9LFlrVzeeIJ7QXR+zSrMiRs6NJG6
EAcBBtyNxAYsSBninyS7h7SPY3pbHS3ktoJbWzaSIFreN41JQDGSg7Y46e1WGtLZ9+63iPmMHfKA
7mGME+pGBz7CuG0u4lgs7CODV4vNTT5lZrgRYtJF2cFguVxnkHPbINW7m9F7p+k3banPFFDfMst4
xhK/cYbg4TYVzwDgdeRno3B9xKoux1kkdnqVs8UiQXUBYq6MA6kg8gjpkEVE2j6Y1oto2nWhtkbc
sJgXYp9QuMZ5Nc1BqUsFnFHNqS2du1zdB70LCm5lc7VOV2Zbk5xk4qMeJbq30lprq/jSWXSUnty4
QGSb5slRjk/d4/Sl7OXRj9pF7o606dZG7S7Nnbm5QbUmMS71HTAbGR1NTGKNpVlMaGRQVVyoyAeo
B98D8q5ObVtVOuCBbq2hAeIR28koDTqQpZggjLN1YZVgBt56HOjomovPql9aTX4vJIyXBhaNoo13
EBflUMr+oYnpwTzhOD3GqkW7WNKS002C4e9lt7WOaQCN52RQzZwApbqc8DH0pF0bS1tHtF02zFs7
b2hEC7C3qVxjPArmvEN80l7Laz3/ANn8u6thBafIPtCl0JfkbjySPlIHy/Wp7HVNUuPERhkurZVE
8iNZmUF1jGcNsEe4ZAU7i+059wKfK7XuJzjzWsdFHp9lCkSRWduiwsWiCxABCepHHB5PT1qBtL0d
ZURrCxEju0qqYUyW/iYcdemTVfUZbt9dsbKC7a3ilhleQoiljtKYxuBx1P5/Ssi11HUp/EUgkurO
NlkliNs8gLxxDOG2CPcAcK24vtOfcAJJvW45SitLHST6Vp1yIxPYWsoiTZGJIVbYuMYGRwMdqfBH
Z2Ijs7dILcYLRwRgJxnkhR7nn61y1nr8sdvbvPqizJHdrHd3W6JoMGNiArqoAG7b15BOOhBK2d8+
oalZ3MlwCsn22CGVdoz867AvGCdq5HXOM80+R9WL2kd0jsKK89j1ifTvDFhBZakzXSQuzB5IgEZA
P3JHlklsnheG65atK8uSmu3N2mrxWTXGnI1uZmjETn5z1KkkDIbj15yOKPZB7ZdjsKKzNAvRf6YJ
RPLOVdkMshQhyDyVZAFZfQgD3wc1p1k1Z2NYvmVwooooKCr1n/qT/vVRq9Z/6k/71Sxx3LFFFFSW
NdgiM5zgDJwCT+Q61xWg61uTV9eudN1dr6ZkH2T+zZo3jhVisaL5iqHPzM7YJwWPYDPb0UAFeaan
BeWUfjXSDpd7cXOtuXsZYLZ5I5BJCsQDyAbY9rKSd5HBBFel1Q1bVYNGs1urhJGRpooAIwCd0jqi
9SOMsM+1K1wR5Uj6smr6xY2N3rdxrdlf2cFp5b3DWioI4fM8wD9yFILkhueeOcVcOl3lhovjK2s4
dfi1Rr57i3aOS62yIWQq0bA7WJycgHJxgjAr1GG0treWeWC3iikuGDzOiBTIwAALEdTgAZPYCp6Y
rHmerDXjrt+E/tv+1Pt9v/ZnkGb7H9l+Tfv2/uc/67PmfN0x/DTbS08Q2t1b6hA2sPeTa3eRSR3E
8zwi2xL5eY2JREyI8MAOo55r06qtjqFrqULzWkvmRpK8LHaRh0Yqw5HYgilYo8jttN8UX/h7V2u7
3VZbxtIuY7ywlsLlUknZcBUaSVkY7gceQgUj0yor0uUlvBUjFNQQmwJKWqlbpf3fRAeRJ6D1xW3R
TEYghtLjwakN/Ffy2j2aiVLhHa5ZdozuCfMZPXbznpXNW8+s3mq6PIh1eWxt9RMa3M8Mlu88Jt3L
GaLCggSBQGZF7Y7lvQKKAWiOX8QWerNqkQ0+e7FvqMYs7gxyHFrglvOXn5Ds8xcjncY/SsaxXVv+
EliTOs/b/t1wLsymb7H9jxJ5Wwn91n/U/c+fO7d/FXa6tqUOj6ReancK7Q2kLzOsYBYqoJOMkDPH
rVmKQSxLIuQGAIzQB5ja3Ws3tjp1jPL4gtJLfRbiG/uTZ3LFbj90FYYAMrcOQUJJGcEZzXXeFpZp
fDDCW3vrXY0iI9w88ksignEgE2ZRnqFbJHQZGCdmS98vUoLL7NcN5sbyeeqZiTaVG1m7Md3A74Pp
Vqh6geYWTaguiRW8ieIJNPhv0W9vV+2rc3UflH5kjkJnjAk8sERkg8kHG4C5Z3msac+kXd6msyWB
jvolUQTTShTKptjKigtu8sH5nGR/EQSa9Dqrf3v2C3E32a4uMyJHst03sNzBd2P7ozknsATQB5ZF
pOt3Gk3OozLrceqw+GrVoXSWaOR7pfOJVgD+8YErlWz15HNad82u3HjWM+XqUNoXFvcJEt2VkieA
/vd4cRIfMKjCLvUruLAZr0C/vfsFss32a4uMyJHst03sNzBd2PQZyT2AJottRtby4u7eCXfLaSCK
ddpGxioYDkc/KwPHrRuNu557Z2F6LjwXqepxau1xHpjQSuDcsy3DeUVEypzg4bcXG3gbjwKh8Pxa
xFFd3Gt3muXO2zc39rBZXkTmbK4ETmYgtndj7Oqrjrgba9SooYjlfBQI0OYq+pm6dy7pqIu8RMRw
iG4G5lAwMjqcnjOBz3g3T9bku5P7TvtQeRrSRL2GSzuYUWZiPuSSTMnXdgwKFxycfLXpdFIDy/wp
pN1s8OaWf7etrW2sZl1BHkuol+0L5O1Q7EfL97Gw7SAwHBYG1pEHiFvGrSXmoX6uLuYywfYrjyDb
/N5eJGm+z4x5f3E8zPX+M129jq0GoXmo2sSSK9hMIJS4ABYor/Lz0w4645zV+nfqBy3ioyi+077S
dS/sYrL9o/swT+d5vy+XnyP3m3G/OOM4z2rF8S/2l5zeT/b+7+zU/sj7L53/AB95bPn7Plz/AKrP
nfJ97/ar0OsO08TRX+qyWlpp1/PbxztbvfoieQsqjLLy284IxuClc8Z60h3OYvbTW/7Q1PUFfVvt
EGr2a2yRzTeSYCIBLiMHYycyZJBxyeCKLC01uG+0+/D6s1xLq95DOk80zRC2/fmMmMnaq5EeGAB6
DODivQ6KYXPLvD0Hi1Yb2UahfSap9gl82C5sp44hdcbMPNM0Z+bdjyVCEdcDaK057CPVfAev2WnJ
r0txPZMpTUGuUZ5tp4TzsHk4yF+Tt6131FAkzyjU4NWnksl0281y0sEs1Fjusb6aU3G5g+/MsZB+
5jz8x49t1dv4qe9h8KzC3imnnby0dofNDICwDSBYSJDtGW2oQTjGa1TfY1ZbD7LcndCZvtAj/cjB
A2lv73OcegNW6NwPNNHvtc00aVLqY1ma3iW+tpClpcOzEyIYGZPnfGzOGYtjkFs5osbC8+1eCtU1
aHWDPHpjQzODcMy3DGIqJlTnBw+4uNvA3HgV6XRRcDyuFvEC6TeNaf2//aQ0e4OofaBMV+2/L5fk
B/lPPm48n5cYz/DV2ytdbsvEULp/bEsMep+UFnuJnjaBrTexO4lSPO6Mfun5QQOK73UdRtNJsJb2
+mEVtFje+0nGSAOBz1Iq1TuO55LZ2uv6r4f8UWNxBqRW+0vzLe3lW6Xyrj5w8SvO5LYzGMjajdlx
mrscepRR6m2kDXhYtY2fF2bsyDEri48sS/OH8scbefukckV6bRSC55ZpuoXMN5PcWMmvTaXZa6ol
imW7mnWFrQcGOTMpXzGBxg9c4xzTLs+IrzT7J5rjVrSxe7vmc/Y7yWbmb9wGSCSOZV2bsc7Rxkfd
r0OO+02G61VLSIPeW4WW7jgi+d2KfL2G5iqgDnsBVyzuftllBc+TLB50av5Uy7XTIzhh2I6EUXE2
ec31p4leaES3GsyvDa6cN8W+EO7zMs5ZY2K7vLxnltvUHoagvYfEX9nWFvLdapbWEVzexvILe8uZ
mxMRBu8iVJivl7sMSVPGf4TXqlFA7nmWoaf4hltNReW61p7u00KCW1eF5Id92PNJ+SNirP8AcymW
B468Vsw2Rh+Jbajcw6iDdafAkLx+e0HmKZN4cLlFwCuN+BknHOa7SigG7nBeJINTh8Q6pcWkN7su
bG0Qy2kbF/LS4czhWUcP5b8AHcc/LkjirDbardvZ29tJrsekSawRG07zpP8AZvszbt7PiVVMu4Au
QRxjHy16PRQgucZpaTWnjy4gT+1ryCRD+9nN0kNoqqgCjzD5Mu4jO5fnBzndkkdnRRQIK8Rs/wDj
+1r/ALC99/6UyV7dXiNn/wAf2tf9he+/9KZKqImdL4V/5GS0/wCB/wDoDV6TXm3hX/kZLT/gf/oD
V6TRLcIhRRRUjCiiigAooooAya5+LV9ZuYJbqDT9JS0F3Jaxvdam8TMyzGEZAhIBZgMDJ6gda6Cv
O7xbG90U6Zfp4ht7m21e4uAbWyv9jL9uaYcxAK+5QNrZO3duGCKtkI63TdTv59ZvdM1Gytbea2t4
bgNbXTTK6yNKuDujQggxH16irR1azF/9i8x2mBCttiZkViMgM4G1T04JzyPUVg+GpftXiTU7iK31
BLVdPs7eOS9t5o2co9wSMzAM5AZcnnryc1f0+dtOmuLKa2uWmlunkSRIGZHV2yCXA2jAOCCQfl6d
M1BXIm7G5RXFr/af2Kfyf7U+1/YJvtXmeZjz+NvlZ467seXxjHtVi5tbuE3cIutSjt3hgkD4nnPm
bm3qNp3gEAAhSMe1XyeZn7TyOsqsNQtC86GdFMEixyb/AJQrMAQMnrncPzrl7i81GOyuGFrqcRuN
NC28SCWYpKC/VsZViCpy2D68jFF/YXE1tqkckF0S1zbXAMYcFkAQNgr1I2twOeBx0pqHdidTsjsa
K4949Sl1pTFdXsUIaL7Kptp2Biwud5LhAfvZ8wFvTPFbGh29wBc3F3JdGVriZUWV2wI9524UnHTo
cdPak42W5UZ36GwQCCD0NRWttDZ2sVtbpshiUKi5JwB7mub1C4v4rq+tkW/Z5by3eBoo5GQRfJv+
YDao4bIyP1pbWDUI7y1uWa/LvqE8cqvJIUEP7zb8pO0D7uDj05oUdL3Bz12OoJABJ6CorW5hvLWK
5t33wyqGRsEZB9jWTr3mGe1EgvPsBWTzfsYk378DZny/mx972zjNYUcV/Bo1pE0epxyJpyC0S3Eg
xcc5EgHH9z/WfL196IxuglOztY7iisD99/bbfbjf790f2X7MJfK24G7ft+T727O/tjFVEuNQF3b2
hW/MqahM0j+XJsMJDlfnxtI5XjPH4UuTzDn62Oqorh7aDV0iglY6mZRHaSsHklI3mTEgIzjG3GV6
DrjvVy0i1Zted57q5VxNJuiFvL5Zi524cv5fTb91d2evc1Xs7dRe0fY6wnAyTTIpY54llikWSNxl
XQ5BHqDXMaTa3yNp3nNft9psXF0JpZCBJ8m3qfkblumO9X/CkItdBgtilyk0QCyrcCThwBnbv/h/
3fl9KTjZbjUru1jbooorO5pYKKKKACiiigYVes/9Sf8AeqjV6z/1J/3qljjuWKKKKksKKKKACvOP
Efhq/vvEFxO2g/2hNJf2c1nqOYP9DgjaMumXYOvKyHCAg7/XIHo9MaWNZViaRRI4JVCRlgOuB3xk
fnQt7hc890jwjf23jVtSuor8zi7mma+DWixSxNu2JuCfaGwGUbGIUbcg/KoO74g8Oz6hqkU1qFEN
7GLPUxv27oAS4Pufvpj0lJ7V0cFzBdRl7eaOZFZkLRsGAZThhx3BBBHYipCQASTgDuaAOB07w5fW
/ii3uP7IENxFf3E9xrAkj/0m2YP5cPDeYcboxtZQo8vg8DNC08Eul1bWTeHYo7ePWpru6uEEIjuY
HWfYCA25gA6qVZR1IGRmvSre4hu7eO4tpo5oZFDJJGwZWB6EEcEVJQO55ve+DbuXxq159nvTEJ4H
s7i2NokVrCiqDHudDOn3X+WP5W3YJXcxGn8QoYZ5fDcVxpX9qxNqfzWW2NvN/cS9pCE468ntXa0U
AnY890rwhcy32iHVNMj+wW8N6TayOkiW4kmR4YiMkHaowAMqpQYPANPsfDuoReKIbj+yvJu0v7ie
41nzIz9pt3Enlw8N5hxujG1lCjy+DwM9/Ucs0UO3zZETewRdzAbmPQD3ouK557H4bu/+ES1jTh4d
ZNam06W3m1MvCDqEpGAdwcscnnMgXGfrRfeEryyGrw6Po1sljd2dmj28cUBWRxI/nMI3IjMmwrhn
GCQM5xivRqKB3PJF8E60ukyQLph85dL1Oyjd3gDlZZFeBMphQACwwAFUg4wMZ1NS8G3yJrNvo9mt
nZ3drZl47UxJ9okSVzMuGBXcyYBLja2QGOM49Hop3C5y/grQm0bSrqF7e7t4Zpi6W10bcFBtAPyW
6iJASCcLnPUnJIGBe+CLyS3jiNpFcLpd5bJpO51JitxOkjsM/dIX936kRf7WK9HqKC5gukZ7eaOZ
FZkLRsGAZThhx3BBBHYil1uI80k8I3jzXsdp4cSOE6jbXiXN2lsLmSQXO9yHjY7kCFsb8OMkfNnA
n1XwjePd+JxZaSUl1KaK4W+t/s6mWEeV5luS+TuYo5wylDn5jya9JqKS5ginihkmjSWbPlozAM+B
k4HfA54ouFzjvDlpceFdLSKLT7oC9v0RLS6lt0eJCAGZY7dBEuMMxVScgFiQSRWr4t0641GysxHa
G/torkSXdgCn+lR7WGzDkIcMVbDEA7a6Gih6gcJquhefBpDHwl9q0uCKdG0TdB+5kYqY32s4i4Ac
cMdu/wCXIzUI8O6hCdKGtaQfEIh06G3UeZE4tbhSd8uZWU/NlfnUFvk6dM+g0UDuee6h4PubjVNW
1RNMibUG1e0ntLrKCVYFEAk2tnKjCyAjjPoc1Bp/hC9h8Wz6he2l/cS/aJ5XuQ1mIriFg2yLOzz2
4ZV8tyEG3O7CqD6TRQFzjPA2kLp0t9O/hT+xLm5YM/lx2yxBRwsa+S7E4HJLAZJJ44AboNnrehQX
OgjSZHhe7uJIdTjmiESxys0gLKW37wW24CkcA59O1ooEeQJ4K1k6PJb22hfYr1NFurO+uPOi/wCJ
rcOoCvlWJb5gzbpdpG/3OLmpeArpYryw0zRoItMubfTvMt4jGkckkc+ZiVyATsxk/wAWAOa9Too6
jvpY8q1bwVqwa9tNPsTHoI1VJxp1n9nHmwmBVOyOUGLAlyxVwAcEjnBpl94E1g6DpunaJDdWV2hn
mN9c3UatbRvn/RR5G3Ac7chQUTkgkha9YooEea3PhPU7kvLo+kpoUsvh57FAJUUwTbwVQtGSSMA4
YZ69jxVG58FXt9a38dj4ZXSdOuFsY30xnhAleOcPLIVjYpjZxknc2OnTPqcFzBdIXt5o5kV2QtGw
YBlOGHHcEEEdiKloEtDmvC2iS6Hf69BHZx2mmS3ayWMMW0RhfKQNtVfujeG4wOcnvXBy+DvE93qu
rXL6cIZdQsNQtZ3QW0UTu5BhYbP3jAgdZMsDngA17DRSHc8n1XwzrniODWWuPDbw7tLtLe3hu5rd
zLLFIztja7BeGwCSOvarGu+FrzUHumi8KF4rjTUttLiZ7dP7ImBfL4D4TOY23Rbj8nTgV6hRTA8x
uvBGo3Wqz3V3YR3cp1S0YTyOjbrYQok+ATwrYYMv8Q6g8Vj614I8SXOgvo9vpS/ZY3v3shGLZmgd
pSYRulyY49nTy8MDjJXFezUUAebx+FZzrHiCa58NRTPq2nxql2RAdknlESRvlt2WYLyAVPBJ4rB8
T+G76z8Mz3GraGdTgg8NpbQfNC402dEPmPtdx1+X5k3N8mPTPs1FJoFoeTNomvSWVzbWuizXMGo3
em3aXSTwrHGkaw79wZw2R5Z4CnOetWtE8E6nH4vXUNUjv/tkN7LcHUYntFimjO7Ym4IbhhtYKUYh
RtODgKK9Poph0sVNNnu7nT4pr6y+xXLZ32/miTZyQPmHByMH8at1HDcQ3CsYZUkCMUYowO1gcEHH
cHtSQXMF1Gz280cyKzIWjYMAynDDjuCCCOxFAEtFFFABRRUVvcwXcCzW00c0TZAeNgynBweR7gig
CWvEbP8A4/ta/wCwvff+lMle3V4jZ/8AH9rX/YXvv/SmSqiJnS+Ff+RktP8Agf8A6A1ek15t4V/5
GS0/4H/6A1ek0S3CIUUUVIwooooAKKKKAMmqep339nWgn8vzMyxx7d2PvOFz+Gc1crO1uynv9NMN
t5fnCWORRIxVTtcNgkA46elaq11cyd7Oxau720sIhLeXUNvGTtDzSBAT6ZNNOoWS3Mds15bi4lXd
HEZV3OPUDOSODWPqGl6jqM1tdywwpNCHj8iLUJo1KttO7zEQHOVxjBHPWnQaPd2V5ZfYlggijjSO
eQTuTIi5+Xy2BHU8NuyPccG+WNjLmlfY17vULLT0V727t7ZWOFM0gQE+2TSLqFk8ywreW7St91BK
pY8BuBn0IP0Nc94tgnaeCWBJm3wSwyiFJCWRtvy5WKQAHHoD6HrVy30R5LTVlcLbnUY1VQDuaIeU
Fw3rg56GhRVrsOd83KjTh1TT7iFpoL62liVwhdJVKhj0BIPXkce9LcanYWiu1zfW0KowRjJKqhWI
yAcnrjnFYs2iahdx3E0q2cNwUgSKOKRmQ+U5cFm2gjOcYAOPeq1xp+rxX0V39lt5J5tREwjjmcoi
iAp8z7MjkddvcU1GL6ic5LodHLqdhBaR3U19bR28mNkzyqEbPTBJwaU6hZLcx2zXluLiVd0cRlXc
49QM5I4Nc+/hy82Ws2Y3nRp2khju5bdB5r7ztdBnjGORznPFWoNHu7K8svsSwQRRxpHPIJ3JkRc/
L5bAjqeG3ZHuOCuWPcOafY17y+tbCDzru4hgjzgNLIEBPpk96qWmu2U2nWN1c3FvaNeIGjjkmAJJ
xwM4z1FJqdldy3tre2awySQJIhimkKKQ+PmDBW5GPTueaxB4Vult7ZGMcx+xpazL9smiVdueQEx5
gO4/KcdOozRFRtqOUpX0Om1C+h03T5724JEUCF2xjJx2Ge9Rw6xps6QtHf2p87HlgTLlicgAc8nI
I/A0uoWP2vR7iwRgnmwNErHnGRiqVhpt4mpvfXSW8cjWiW6iKQybSrMSclV4ORSSVim5XReg1TT7
lgsF/aytv8vEcysd2CccHrgE49jStqenrcJbtfWwmclUjMq7mIOCAM5JBBFc7beG9SUzy3E8TXTR
RmOVriSX99GxZXIIG1TuOVXAAyBnNSX3h2+dreO2nRreFYmVXneMCRX3sxVRhy3HLdOoBquWN9yO
edtjRs9cF3e28CxRlZxMVkjnWQYjYKDxxznOM8dK16wbLRbq0v7e5LQtsluS43EfJK+4EcckYAxx
168c71TO3QuF+oUUUVBYUUUUDCiiigAooooAKvWf+pP+9VGr1n/qT/vVLHHcsUUUVJYUUUUAFeZa
/qN0/ixtfg06+ks9EmSD7XG8YhWM/wDH1uVnDNgFeiHBi69a9Nrm7LXL+41vVYGgiNjp9yYneNGa
Tb5Ecg4BJJ3ORwOgAxnml1A5XR7zVrie10uDWZrRHfVHknt7a3DyNFcqqsQYyuSGOSF5yT15pbLx
TfX0+hm717y31PTottlYm3MqzNG5aV4nRn8vgEMpwCOVIya65/GeiJaJcNLd4e4+yiEWE5m83bv2
mLZvB2/NyvTmibxnoUMNpJ59zKLtJHiW3sp5nxGQr7lRCyFSQCGAIPB5pjZW8E6tBP4a0G0ldVvZ
tMjuPLSDy0K4UErtAQYJHyjpkcYpL281qHxKdKinYxXbpdQTeUp8qFAPOjzjHJCAE8/vjj7vGfqH
ipIPELvaPZtDLBYfZ7p45ZVZZ5nUjKZCgqowcAbiu4kYrpotf06fVG06KSZ51YqzLbyGIMBkr5u3
ZuH93dn2ofcVrHAW3inWp9Mu5LPWGv8AUDo9xdXVqsEZOmXS7dkQVVyOS42SbmPl+xzZvfGUmoza
j/ZXijToLOCzspPtTXEKxq7SSCRRIysocqoADAgHsM5rpdQ8Zafa6JrF/bxXMsumQGaS2mtpYHIw
dvDpnaSpG4Ajg+hqG08Z2k15fSTTfZ7G2tIJik1ncRThnZh0dBvBwoUKCS2R6UxvYS712Zvhhc65
YT3ImXTZJ4ZrqOPzCwQkMwUbDyM/KNp7cGotKlu38Q3unaleT6lFb2ttqEDSIivG7GUFR5aqCvyD
AOT1yTWkfGOiC0juDcT4ec2wi+xzecJQpfYYtm8NtGQCvIIx1GdPTdStNWsEvbKUyQOWAJRkIKkq
wKsAVIIIIIBBFJi6WPL9P8cavJZ6hOdSV7dPsd1HI8kMrwQtPtnWQpEiqVTG4fMUzy3TGofFOoat
rBt9K1qM2U2tizjuLdY5AIfsfmHYxBBO/JBOeeORxXXaDra6otxbyv8A6bbOfMQ2s1v8hZtjBJQD
ghTyMjIODTX8WaNHq76Y9xMtxHKkDsbWXylkYAqhl2+WGO5cDdySB1OKaA5K813xDF41bTU1WyhS
GeCKG0uZ1WW8iKrvk8pbdmfJL/Mjoq7eQArZ0fDetw6j4sv7eHxh9vgg3RpZSSWpd3B+dgscauEX
7oJJycnpgnen8U6RazXsVzNPA1nC88vm2kqAxpjcyEqBIBkZ2Z6j1qlqPjWxsf7LeK2vLiC/u2th
IlpNkYRm3KoQlwcDBHBBJBIBpBY5278TXkXi3ULWPxATdQ6nbW1touyE+dC6RGRsbPN4DyNu3YG3
ngEVDo/iFdB1Bba91G3srJrvVBOJ3RQJ/PDxKSeQxR2YDPzA55rb0PxHo0AmuZZB9s1S6ncJbWty
XlETiLmNl3BlUIGGAMhj0BNdNqeqWekWouLyR1QsEVY4mkd2PRVRAWY+wB6E9qeyHfocFoXim+nv
vDbahrvmtqFlAfsFs0HmtKyMzSSxFN/l8D5kYYI5XGTVz4la5eaVHZrYSrDeJHNdQmV4lSRo1HyA
NFIzyHdwqbSRu+YVr+GvFsOs26/aWEVzNNd+TF5EiExQy7MsGGVbBTIODk9PTWGu6afD/wDbouP+
Jb9n+0+dsb/V43btuN3TtjNJ9xdSjrWpXNvolrrVnNm2gK3FzHGocTW5Hz44J4B3jbyduOc1yese
INb01ZBe639gvFsPtllbeTF/ptw7ufs2GUl9gESbUIc78k8jHXw+LdFmsrq6+0yxJahWlS4tZYZA
G4QiN1DtuPC4B3EYGTxTT4x0UWqTiW6YvMYBAljO04kC7irQhPMX5fm5UcEHoRQC0Oa1Txhd2F7q
dhNqUNvf/wBp2SWlq2zzDbyeSH2qRlly0g3c455GK0/Cmty3mu6rp9xrH9pzQsZM2zwyW8CF2Cpl
EDpJgcq5bpkE84vt4ttIvFF3o1xDNCltZpdtdPFJ5YU7ydzbdqABM5LckkdQav6Xrun6w0iWjTiS
MBmjuLaSB9pzhgsiqSpwcMBjg88UwZhPrMjeMZ7K910aY0U0SWen/us3yMqkvhlLt8xZfkIA2c55
rNtPEeoSeJI4Dq/mXb31zBcaP5cf+i26CTy5uF8wZ2xnczFT5mAORjr5ddsINWTTJmnjuZAdhe2l
EbkKWIWQrsZsAnAOeDxxTIfEmkXEdnJHersu7VryF2VlDQrt3OSQNoG9euDz9aQzz5fEviG08OW9
++sy3E194duNQAkghAgmjWMqU2oODvOQ27tjHSr+pa54g0hNYtodRa8eO1s7lLi6SOP7MssrpK2U
jxsVV3AsrbcEncBiung8aaFcGUCe5iMRhDLcWM8J/evsjIDoMgtxkZFWrnxLpNr9pElw7PbTrbyR
xQSSSGQoHCqiqWc7SG+UHAz6HDYHHWviLWF8PpNd67ZGyk1AQSazbzxzLBD5e4sZTDHEx8zCbghU
bsHLA1J4lmiksvCmof8ACTSfYYdQYvqo8hVKmKUB2Yp5fJwuQAp3cDJGOhh8Sre+IdMtLIpJZXdr
cyuzxssiPE8a7SDgqQXYFWGQR2rQk17TIpLiN7nD29xHbSJ5bbhJJt2ADGSDuHIyOvPBwgOI0vxH
4gvPF0sEmp6eqC5njfTftAaWOFQ2x/KEG5cgI29pSh3cD5lA6bwRPqN/4VsNT1PUJLu4vbaOVlMa
IkZK/wAIVQeepyTz0wOKkj8aaBLFdSreuI7aB7hne3lVXiX7zxkriVRxym4cj1GbF74n0jT3kjuL
iTzI0ikMccEkjkSsVTaqqSxJUjAyeKOgjg7XWG02M2M+uroVr/aGpNcXn7rcsvnbooiZVZV3I5cA
jLBRg4znX0bVte1fVIlvL5tPWPR7S9mgECKPOcy7g29Syr8oyMgjA5HOetm1eyttNi1C4eSG2kMa
hpYHVlLsFXcpG5eSM7gMd8VUvPFejWEskUtxM8scpiaO3tZZn3BVZsKikkAMuSOASASDxR5Dvc4y
x8V3TaEiS+IzIEvkt9Q1pJLWS3gUxlsxSCMJgsFU+YuVL4P8Jp2jeM54v7Nn1LX4ZNMmOoxC9nMK
JO8cyrD86qF3FN2AMbueDiu0fxPoyQXM325Git7Nb6SRFZlEDbtrggfMDtbpk8fSotFvtFjvLnSt
KS43JK80x+zzGISOd7fvWXZuJfO0NkZ6cUBsjz6Xxd4mmsNGkXVrKyefSoLlHuplhN7O2dyhPs8h
kxhf3cexvn46jHoOv3l9p2lQanFIQlo6zXsKJv8AMhwQ4HG7Kg7xjk7cd8U3UfE8Gm+J9P0WW2uG
N5BJKJo4ZHCbWQAHapGDuOSSAuBnqKI/GWhzaauoRXE8lrIyLEyWcxMzMMgRqEzIcA5CgkYOcYNG
+ojktY8Q63pqyC91v7BeLYC8srbyYv8ATZ3dz9mwykvsAiTahDnfknkYsap4wu7C91Owm1KG3v8A
+07JLS1fZ5ht5PJD7VIyy5aQbucc8jFdfa+ItKvWtUt7re11FJLEvlsDtjYK+QR8rKzAFTgg5GOD
UFn4t0O/s/tdtel4fMiiBMLqxaUKY8KVyQQ45Ax19Dh7DMrwprct5ruq6fcax/ac0LGTNs8MlvAh
dgqZRA6SYHKuW6ZBPOM688VX8PxGhsIboCyFyLWe0mmi3ZaEusioI94UttUO0mCxIC9DXSw+LtHu
fN8mW6k8tDIu2ynPnICAWh+T98ORzHu6g9xVvSdbstbimksvtO2GTypBcWssDBsZxiRVPcUhHKaR
4hvbjRr69i1cahriWUk0uhgRH7JMOkeEUSLz8uHYk9sVHP4huIvCF/e6N4li1q4UwiWd2h2WQZgH
JaKMhQqkt8yuVxlsjiuvvdcsdPv7axmNw1zc5MccFrLNgAgFmKKQi5YctgVXn8U6RbTXsVzNPA1n
C88vnWkqAxpjcyEqBIBkZ2Z6j1pAcXZ67qVr4bh87W7GOwk1IQNrFpLHMsEJQuWMphjhJMnybtmB
uwcsDWRZ67qNhoFjHp+t2lvY3F9qLvq1zdxQLMwuDsAkMEkeWDM2Agzt4IAIPeeJ/GVpodjOIGeW
+Ag2ILWWUKJnKI7BBkjIY4BBOAOCwzq3GqxaRpEN3qs5ZjsRmt7WTMjsQAFiG5+Sfu8kUx9Dm9I1
HXtQ15Le6v8Ay1g0u1u5IbaIKssrtKGGZE3qpCjIwrDA6c5xPD/ijV7uO7uNZ8R2VtbrZvNeC3nS
SbTnBX5dhtgIiMsuyVpGOOM7ST22m66NR8QXdnGwEENrBMscttNDMC5fk71A24AAA5BDA4rcoDqc
r4K1U6joc122vDWHLl9qyW8jwLj5Y2MKqu7HJ9zgEgZOP8PPENzqep39vLcRS20kKXluokieRC7v
5iuY4o1Dj5Ny/MVLcsc16FRR1J6BXiNn/wAf2tf9he+/9KZK9urxGz/4/ta/7C99/wClMlVEGdL4
V/5GS0/4H/6A1ek15t4V/wCRktP+B/8AoDV6TRLcIhRRRUjCiiigAooooAya4K4udNsNG/tLUv7e
uZ7jV57cC1vL7Yq/bTD/AMsiVXapG1cDdt2jk13tcwug65DbzWcGq6S1m13Ldxx3OlPKyM8zTDJE
4BKs3BwOgPWrZCDQRDD4o1KC0mv2s206yuEjvLieRkZ3uATiYlkJCpkcdORmpbXWNQaeOSY2r281
7JaLEkbK67SwDbixDfd5GB19uZtF0W/sdVvtR1HULa6muYYYALe1aFUWNpGyd0jkkmU+nSrGnaDZ
6e883kwvczSSO04iCuVdidpbrgdOvaqhZLUzqJt6Dl1/TSsr+e4SKNpS7QuFZF6shIw4H+znqPWl
XXLBpIo1admmJ2BbaU5AwN3C/d5HzdPesq38Hw29pc2yNZor2728csVkqSAMMZds5c49Nuec+2hq
Ojy3gtFhuIoPIwPNEJMqjjOxww25AwQQQe4PSrtAi9S2xYXWbB702gmPmhiuTGwQsBkqHxtLDB4B
zwfQ1BF4j0uaN5FuHCLCZ9zwSKGjGMspK/NjIzjPWo00ORbpCbxTZxzvcxwiLDh33Zy+eVy7HGAe
nPHMD+GN+n21p9sx5NjJabvK67wo3Yz229PfrRaAXmaEOtWU6TtE07GABnT7NJvwc4IXblgcHkA9
KztQ8RiFY5bRo/Ie2nl3ywyEo6FVwygbgAScjGRjtUt94eN407C6C+bBDFtaPcp8ti3zDI3K2cEc
cd6q/wDCJFbL7NHdxR/LcR/JbYUJLgkBQ3GGHHtx700oCbqbWNeDVrWaWSBDK8sK5kKQSFAcA4Db
cE4I4zn2qteeIrW301r2KOaUJOkLxmGRHUsQOVK7hwc9OePWoZ/D089xO4vlt0kgaI/ZoTG7kqFD
O28hsduAR69cx2/hb7Pp91bJPbx+fLHMogtfLSN0xj5d3IO0ZGc9eeeFaAXqbWLUGvW5+1yzSYij
nWKNFt5RLkqDgoV3FuSflHT8alfX9NSKGTzpHEysyLHBI7HaQGyqqSCCcEEZH4VWOhXHmSXP22MX
jXC3Cv5B2BhH5ZBXdkgjP8QxnrxzJaaEbe5t7hrrzJEWfzP3eA7SsGJHPABHA5+tDUBpzNJLu3ks
lvFmQ2zR+aJc4XbjOfpis+48Q2kemXl5Cs0jWsRlMTwvGzDnBAZc4OPvYI6+lPi0aNfDi6NNIZI/
s/kM4G0kYxnHOKqWvhqKGwvbZ/saG6i8lms7NYMLgjJ5JJ59ccdBzlJRG3PQ001K3OlnUZPMigWM
yP5kbKVA6/KQD+nNV18QaabeSdp3jSMoHE0LxsNxwp2sAcE98Y4PpTL6yvJfDN3ZM8dxdPbvGpjT
ywxIIAwWOPzqr/wj9xdRO19extO4gX93BtRVjffjBYkknOTn049WlHqJueli1ea5bwwxmN3R3wx8
y2lPlpnBZwFyo4OC2B74FRQ66smpagGkEdnZbUbdbybnYgHKt0PUAKASeCOopNV8Nw6lqH2zFoWa
MRP9ptFnIAJIKZPynk9QR044p1z4dhubfUIXkUpdSxyqrRAqhQKACucMMryOODj3prkE/aXJIdet
RbCW6m2M8xiWMQSK4OCyqVI3bioz0Ge3bM7azYpOkLSSBm25JgfahboHbGEJyOGIPI9apW3hxIBa
kG1jaG5+0MttaCJG+QqAFBJHXOST+XRs3hmCXWXv9tmwlkWV/Ns1klDKAPkcn5Qdo7HvgjPCtC47
1LbF2HXNPnvFtY5nMrO0akwuFLrncoYjaSMHjPanw6xYztLslbbEpdpGjZYyo6kORtYD2JqrHoIQ
W4NxkQ3sl19z72/f8vXjG/r7UkOhyjTJdLnu0k09oWgjRIdrqp4G5ixDED2FK0B3mTf2/p3kvKZJ
lCFQUe2kVzuOFwhXc2TxkA1oQyrNCkqBwrjIDoVP4ggEfjWFb+Ghb2c8SppQklCr8umhYyAc/Mob
JPvuAGBgeuvp9rJZWENvLcPcPGuGlfOWP4kn8yT7nrSko20CLm37yLNXrP8A1J/3qo1es/8AUn/e
rNm0dyxRRRUlhRRRQAVz0/hl5B4hSK/aGPWFByiESQyeWIywYNyMKpxgEHPPIx0NedeJPE17Za9N
B/bv9nTxX9nBa6d+4/0yGR4w8mHUufvOuUIA2euaN3YaE/4QPU9IlsDo0umo39prdyeVp/lQW+LZ
4iREJQSD8vAbOSSSe01z4b1fSL7Tru01W0gS3tr6S+1K8tw0avNIkjERiRdoyGIySAF5z1plt4wu
n1LT9LOpQvqR1q6guLP5BL5CrM0YK4yoIWMhuM8cnNYUWs+Ite8Oa5Dd6hZXbS6RcNPYwTebLazb
cBNiwIYjksNsjuxxwTtYlj62OrbwBH5dpHZ6kUt4razgbzIfMaQW8okRgwYAZywPB6gjGMHVsdEu
9IuLkR6nAmkSSzXBhNuRMrSEs370vjaGYkfICOBnjnkNS8WTx3cf2fxFHZkXNjFZWUbQMt9BIY98
o3KXYfM65QgDZ9atQ+Kpbu/sNFuNShe9l1m7tbu0+QSi2CzGMFQMqMLGQ3GeOTmh3aF01LGj/DuC
107Uof7Qt5ItU08WcstraCNpB82Jmbe29yHO5jnccHjob0ng28u2uLi81aFrySC2jjkgsyiI8ErS
oxVpGJGSARkZwcEZ4ytT8VzaRealpI1KG3uo9TsobG2bZ5jWz+SH2qRll5kG7nHPIxT9N1nWTqOm
3U+qyzQXesXmnvaNDEI1jQzlCCED7h5ajliCM8Z5oDWxof2BFa6la3mqa7a/2h9ubUpcRiFJAsPk
YRC5KqAyZJLcntkAbejaL/ZGnXFp9pMnnXM8+9V2FfNkZ8Dk9N2M+1ZGuQQTeO9DW7C+RNZ3cK7m
2hpN0LhQfXCMcein0NZVn4vuJNV03SpNUhOoNrd1b3VrhPNFuomMeVxlRhYyG4zxyc0tw6F/wz4T
t/B+oGeXUbEyXkKW2FthA1w6b2Dsxdi8hBcsTknGeACKpWmj3Os+INX26tYrpNzfWuorFCqyzXEa
JHscOJMKheIjlMnacHnIw9GZ7bUrCy/tlrm4Gv3iT2E0duzQhhcMj4EYdCwGQcjIY44OKq6DqN1Z
6My2+uWenmHSdODT3LQReQRJIkkXmtG2G+Rhhw2GJ4GeGu4Wtc6ef4aeddalONRt1kvYLu3ab7Fm
Zknwf3km/LlCAF6AKMY710er6DNfQaYbO8itrrTphNC8sBljJ2MhDIGUkYc9GGDjr0rhtT8X61Kd
PbTtVisbaXT457Z9TmjhlvpSWBG1YJBL0T5IShO8YJDKR1/jTVLrSvCn2uO+FhL59tHLcqExEryo
rkeYCo+UnkjikCG6T4Q/s3VbW/a+EzQG9bb5O3JuJVk67jjbtx757Vo67o0uqrZTWt0lteWNwLiC
SSIypu2shDIGUkbXbow5wfY8ePE12dObHiInSRqotv8AhINkPEHk7y27Z5P+t/db9u3t97mpLPxf
c2r6RPquqwxabcR30a3k4SJLpklUQPuwBudNzALgNkkDGMNoNdy/beCtRsltJ7fWbUahC92ZJXsW
aJ1uJBIwCeaCpBAwdx75Bq1e+HLm1+GFx4ctH+13KaW1pE2BH5reWVHU4GT71k+EdY1vXr6w+06r
IsI0ezvZVjhjBllcyBs5XhSFGQMHgYI5zoeLtal0jWdKY6yLa1dtr2VvJD9puWLoF2JIjF1GSCEK
tzxk4FD7BezBfB99d29zPqWqxNqMqWywyW9p5cUHkP5iZQuxb5yd3zDI4G3rSXfg2/u7C7Emp2Da
jeXP2iW6ewfETCMRqYAswaJgqj5t7HOfXAy9H8QeILzxq1rPqNgiC7mik0s3AaWOFd2x/KEG9cgI
29pSh3cD5lA3fFWrSWF9p9vPq40TTZ1lM2olol2yLt2RhpVZBuBc8jJ2cUri8huo+Dnv7m43ajm2
vdOXT71ZYd8kiqH2urhgFbLknKsDxwKn8L+FY/DpuJPL0lZZVVD/AGbpiWakLnlgCxZjn+9jgYA5
J5/xL4kvbCVxHr32Qx6bHcaevkx/8TW4JbMeGUlvux/JHtb9516YL3W9bj1DU7xdTljhstXs7RbI
RRGNo5RAHDEpvyDIxBDDn1HFNajsadx4FFx4uXXjd25dLlZ08y03TKvlGNohLv4jwSwUAYY5OelV
7X4fzCGGzv8AVo7iwt9Nn02GKK0MUnlSbBlnLsCwCDkKAc9Kq2Gt639u0+7k1OW4iutXvLBrNool
jCR+eUIYIG3Dy1GSxGM8Z5qh4e8UeKLqG+uWu7DULlLCWd9Nin8yS3uBjbGUWBDFzuXbI7sccE7W
NLYLNM0j4Q1u+1TUxqN9bEPa2S2t7BalFEkEzyANGZWLc7c8qCGwMYzU9z8P5NQiuZdRvdPvL2a/
W+XztN32wYQiIq0LSEsNoJ++CDg54wat/crrPw88RpY+Jn1uVrByxhWBzE5RiYx5aAc9Npyw9eRW
VqPifVYXsrfSPE1g9oLJZLa7ubuJft025gyAJbuJduFXZHsf5upJBBfoHmdlp3hJNMudJuLaW0he
ySeOWO3slhidZSrMERSAmGVcE7jjOck7qu3Ph+3ufEMGrNIwMcRR4Qo2yNyEYnrlQ8gH+/7Cs/Qr
nVNQ8Sa19q1BhbWFykMdrHGgQ7oI2O5iu4gMxIwR1OcjAGN4y8UX+leJ7S2s737PHH5DzxSyxKs0
ckuxmRDEzttXJY70VflJzyKHukIvReA5HsTYX2qia0h06XTbNYrby3jikCgmRixDuAiAEBR1454U
eDtTle9nvtT0q8uLm2gtgs2lMYFWJnYEp52S2X67hggGsy/13xPbaPelZ1E+lBLS6nkjCJI7yLmc
nYwULDhzhSoMhyCFxTbXxFrC+H0mu9csjZSagIJNZt545lgh8vcWMphjiY+ZhNwQqN2DlgaLj1Z2
NpogTwymi6hdSagDAYZppid0uRyeST34ySemSTzWZ/wil5axadLp2rJHqVrFLFLc3Vr5qz+aVaRi
iumGLICMHA5GD22NKnFxosUtvqX9pKVby7zCfvRk4PyAKfqAAeorzlvHl/NoVsbbV4ZNRh8P3dzf
Iixs0V1GI8b1x8jAl/lIH04o3YRRv3nw/n/s97HTNYS2gm0pNLnNxa+c7Igba6kOgVvnbOQR04Fa
1p4bubbxN/av223jg8so0FtatE852qoMzeYRIVAODtBGcZxkGDQLzUU8S3+mXmoy30S2dvdxvNHG
rRmRpAyjYqgr8gxkE9eTWNe+KdQi+IsWnwXYWz+0C1mtZpYt2WhLrIqCPeFLbVDNJgtlQvQ0X1E9
dzp9V0S4vdZsNTs7yK3mto5IHWaAyq8UhQsBhlKt8gweQOeDVKPwlLa+HtDsLPUI47zR9hguJLff
G7CNozujDA4Ku3AYEHBz2OFoHiu512bRdOGrRy3UukTvqMcIjMkVwvlAbhj5GBZ/lIA9jiqHgy8v
ZLTwxodl4jlMf9nyteqiwNLbyR+SBD9z5Su4ghgWwxzzgh26DOlXwbeW32K5stWhTUITdefLPZmS
OX7Q4kk2oJFK4YDb8xwODu61LpXgm304aTvummNhZLayARhROyqVSQjJwVDSAAH+P2FYmkeIPEF5
41a1n1GwVBdzRSaWbgNLHCu7Y/lCDeuQEbe0pQ7uB8ygbnirVpLC+0+3n1caJps6ymbUS0S7ZF27
IwZVZBuBc8jJ2cUr6B1KWjeADoEU39mz6RbXC27W9rdQ6PGsyg4w0zBsysAB02AkkkHjFvTrDVPD
66dBd6tYjT4XYSulv5Cyb+FVjJI7NI0jBsgjPOckisfxL4kvbCVxHr32Qx6bHcaevkx/8TW4JbMe
GUlvuxjZHtb9516YoeLtYludUksr7V/sMkOpaetrpeYh9rQyRM0nzKXbDFh8hAHl896a3E0dn4g8
P3OtXNnLb3lvZm3YEzi2ZrlRuUkRSiRdgIXBBVgR1BHFYR+Gscmoahcy30J+2w3cEki2mJ3jnIPz
ylyXKEALwAFGMd6raP4g8QXnjVrWfUbBEF3NFJpZuA0scK7tj+UIN65ARt7SlDu4HzKB6LSDqcWf
BOoXc01xqOtW8s0gs1BgsTEoW3mMo4MjEls4znjrjtXR65psmq6XJaR/YsuVP+m2puI+DnlA688c
HPB5rRooA53QfDM2j3pu7jU5b6ZrGG1d5VO5jG0jbtxYk58zGDkgDkk810VFFABRRRQAV4jZ/wDH
9rX/AGF77/0pkr26vEbP/j+1r/sL33/pTJVREzpfCv8AyMlp/wAD/wDQGr0mvNvCv/IyWn/A/wD0
Bq9JoluEQoooqRhRRRQAUUUUAZNY3iiVoNDd1kmj/fQqzQswfaZFBA288jI45rZqG5tYbyERTpvT
cr4yRypBB49wK1i7NMxkrqxhWl9cWaulvDcTRXFwIrJL13RvuFnLM4LhflbGQT6cYq3aa6bi5t7d
rXy5HWfzP3mQjRMFIHHIJPB4+laF5ZW9/CIrhGZQwZSjsjKR3DKQQfoe9Vn0LTnggh8qRFhLFGjn
dH+b72WUgnPU5JyetXzRe5nyyWxU07X59TuLeKGxUCS2juXZ5uEViRgfLyRj2z7d7Oo6lc2t9BZ2
tpHPLNFJIDJMY1AUr6K396p7PS7OwKm1h8srEsI+YnCLnA5PuamktIJbqO5dMzRoyK2TwrYyMfgK
Tcb6IpKVtWYp8SySWi3NrYiSNLRbycPNsKIc8LwdzfK3UgcDnmp5dfEaXbrb7hb3MMA+fG7zNnPT
jG/p7VM/h/TJIoYjbsI4oxEqrK6hkH8LYPzr7Nkcn1p1xoWnXV0biWFy5ZGYLM6ozLjaSoIUkYHJ
HaneBNqncbpuqS31zdQzW8du0LELGZSZSuSAxUqMA44ILA+vFU7nVJLLWb4PE7lYYBCguPkcu5UZ
Xb8h3dTk8AfStS20y1tbqS6jErTSDaXlmeQgZzgbidoz2GB09KrnRknvL2e9dZluESJY1QoERSSO
cklsnO4Y6DAFJONx2nYz5dXuJL6zgntzDLFeGKUQ3JKk+UXX+Ab1IPQ7cEDrS23id2hjuLyyWCCW
ze7jaObzG2pjII2jB+bjk/hWnFo1hCsYWFiUlMwZ5XZi+3bksSS3BxyTxj0pU0iwSOCMW6lIIWgj
ViSAjYypyec4HWnzQ7C5Z9zBOuX9pqN1cXVqMfZ7by7aK5Lj55GXPKgBufTsOat33iO5sblbX+zG
muFiEsywebIFBJAClYjknafvbR7+l2Pw9psW/EUrl9mTLcSOfkbcoG5jgA84FT3mk2d9Mss8blwu
wlJWTevXawUgMPY5HJ9ablDsLlqdy4jb0VsEZAOGGCPrS0AYGAKKyZsgooooGFFFFABRRRQAUUUU
AFFFFABV6z/1J/3qo1es/wDUn/eqWOO5YoooqSwooooAKwtU1DQby3uINQl3xWl7bxSrtcbJy0bR
Dgc/M0Z445571u1yOpeDbu81G7kt9Vhgsry8t72eF7QvJ5kJj4V/MACkRLwVJ689qFuBFd+O41vt
QsIoXt57TUYLMTXFpcPDIHMecsqYVjvIXJxnac4NR2HjgtduNSltoIIRfPKBbzFikM/lqUIBUnGd
y53ZK4GDVy/8H3F3fX7x6lFHaXt3b3skTWxaQSxNH0feBtKxAY2kgnOe1Qr4HkivJpkvrWSIrerH
Bc2ZkTFy6OwkG8bwGVuPlyGA7ZL0HpYvatrGhXOjQXGqQ34sXlWUF7C5Ty2jcMGkGwGNQVBy+AQO
4pz+LbSHxReaLcRSxJbWiXTXbRv5QU7ydzbdqgBM5LYOSOoNYF/8NpNU0uGyvtWhuFRbhCstmZIo
hLjBgRpD5bIBhSS+ASBgYA1r/wAHyahPOZL+MQXunLp99H9mJLqofDRnfhDlySGDg4A+qEXovFuj
SwvKZ54QjxIUuLSaF8yNsQhHUMVLcBgMcHng0+78VaNZSyQz3TCSO4+ylEgkdjKY/MCAKpLEpyMZ
yeOvFYVv8Pkh0m7tkfSbW6laB45tO0lLZFaJxIpdQxZ8sOfmAx0CnJM9r4MuhqSajfapDPcf2mNQ
cRWhjQkW/khAC7Ef3s5PpT0GdZFIs0KSqGCuoYB1KnB9QeQfY81mXHiTSrTU/wCz5p5BMGVGZbeR
oo2bG1XlC7EY5GAzAncvqMz2kd+NVv5J5SbJhGtvEyrlSAd5BHODkfe5yD2xXPXPgK0n8US6vs0t
lnnjuJTcaYk1wroFGI5mPyKdi8FWIy2CCRhdRI1bXxZo15qSWEFxKZ3kkhQtbSrG8kZYOgkKhCw2
twDnAJ6Vnab4/wBKu7R57qO6tCL2WzjRrWZvNdC+NvyDcSIydoyQfl64BmtvCP2f+z/9O3fZNUuN
R/1WN/m+b8nXjHm9e+3oM8Q2/g6eG+tnOpRPZ2upS6jDD9lIk3SCXcrPvwRmXIIUYAxz1oG7GnJ4
o0iK9S0eadZG2AsbWXZGz42rI+3bGxyvysQfmHHIqr411Cx03Qo59QsZbyH7ZbARRCTIbzl2t8gJ
ODg4xyQF71SufAVpP4ol1fZpbLPPHcSm40xJrhXQKMRzMfkU7F4KsRlsEEjG54g0c63pLWaziCUS
xzRyFN4V43V1yuRkZUZGRx3FAiJvFOkR3kdq806yPsBZrSUJGz42rI+3bGxyvyuQfmHHIqrP468P
W7zLJeTfuS/mMtpMyjY21zkIQQp4YjhcjOMis4+AY5dfOq3J0eeWaWKe4kk0hHm8xFUfupHdvLQ7
BwQ5GWwwJBDbj4fefbXEP9p7fOg1CHPkZx9qkD5+9/DjHv7UDVjbfxZo0erPpj3Ey3CSpA7m1l8l
ZGAKoZdvlhiGXA3ckgdTVrTdcsdXknSyNw4gco0j2sscbEEqdjsoV8EEZUmuWg8J6tcazqq3F3Db
6RNqFvdCMQbpbjyo4sYffhF3xgEFM4BwRkGtCDwvqltdancWus29m93jyks7HZGjbyzSOjSMryMD
tLDbnqQeMPQTOqooopAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRR
QAUUUUAFFFFABRRRQAV4jZ/8f2tf9he+/wDSmSvbq8YttDv5Z9TuotYtbeOfVb9lik09pSuLqVeW
Ey56Z6DrVREze8K/8jJaf8D/APQGr0mvN/C+l31r4ks5ZtXtbiMFwY49OaIn5G/iMzY/I/1r0iiQ
IKKKKkYUUUUAFFFFAGTRXhX/AAsLxT/0FP8AyXi/+Jo/4WF4p/6Cn/kvF/8AE16H1Gp3PK/tKl2Z
7rRXhX/CwvFP/QU/8l4v/iaP+FheKf8AoKf+S8X/AMTR9Rqdw/tKl2Z7rRXhX/CwvFP/AEFP/JeL
/wCJo/4WF4p/6Cn/AJLxf/E0fUancP7Spdme60V4V/wsLxT/ANBT/wAl4v8A4mj/AIWF4p/6Cn/k
vF/8TR9Rqdw/tKl2Z7rRXhX/AAsLxT/0FP8AyXi/+Jo/4WF4p/6Cn/kvF/8AE0fUancP7Spdme60
V4V/wsLxT/0FP/JeL/4mj/hYXin/AKCn/kvF/wDE0fUancP7Spdme60V4V/wsLxT/wBBT/yXi/8A
iaP+FheKf+gp/wCS8X/xNH1Gp3D+0qXZnutFeFf8LC8U/wDQU/8AJeL/AOJo/wCFheKf+gp/5Lxf
/E0fUancP7Spdme60V4V/wALC8U/9BT/AMl4v/iaP+FheKf+gp/5Lxf/ABNH1Gp3D+0qXZnutFeF
f8LC8U/9BT/yXi/+Jo/4WF4p/wCgp/5Lxf8AxNH1Gp3D+0qXZnutFeFf8LC8U/8AQU/8l4v/AImj
/hYXin/oKf8AkvF/8TR9Rqdw/tKl2Z7rRXhX/CwvFP8A0FP/ACXi/wDiaP8AhYXin/oKf+S8X/xN
H1Gp3D+0qXZnutFeFf8ACwvFP/QU/wDJeL/4mj/hYXin/oKf+S8X/wATR9Rqdw/tKl2Z7rV6z/1R
/wB6vnz/AIWF4p/6Cn/kvF/8TT1+I/ixBhdWwP8Ar3i/+JpPA1O6GsypdmfRFFfPH/CyvF3/AEFz
/wCA8X/xNH/CyvF3/QXP/gPF/wDE0vqFXyK/tSl2Z9D0V88H4leLiMf2uf8AwHi/+JrP0zxdrejN
OdOvFtvPIaURwR4dh/ERtwWPdup4yTij6hV7oP7UpdmfS9FfPH/CyvF3/QXP/gPF/wDE1mXvijV9
S1BL++uI7m6iAEMktvGxhwcgx5X5Gz/EuCcDJ4GD6hV8g/tSl2Z9NUV8zWvivW7K7jure92TRmYq
3lIcec4eTgjuwB9u2K0v+FleLv8AoLn/AMB4v/iaPqFTug/tSl2Z9D0V88f8LK8Xf9Bc/wDgPF/8
TR/wsrxd/wBBc/8AgPF/8TR9Qq+Qf2pS7M+h6K+eP+FleLv+guf/AAHi/wDiaP8AhZXi7/oLn/wH
i/8AiaPqFXyD+1KXZn0PRXzx/wALK8Xf9Bc/+A8X/wATVa28d+JLS4u7iDUtkt3IJZ28iM72ChQe
V4+VQOPSj6hV8g/tSl2Z9IUV87n4k+LWUqdXJBGD/o8X/wATUFh488S6ZYW9jZ6l5VtbxiOJPIjO
1QMAZK5P40fUKvkH9qUuzPo+ivnj/hZXi7/oLn/wHi/+JqOf4h+K7iMI+sSgBlbMcaIcggjlVBxx
yOhHByKPqFXyD+1KXZn0XRXzx/wsrxd/0Fz/AOA8X/xNH/CyvF3/AEFz/wCA8X/xNH1Cr5B/alLs
z6Hor5p1TxfrmtpDHqd2l3DE5dYZreNoycYyybdrYzxuBweRzVq1+IHiiytIrW21Py4IUCRoLeLC
qBgD7tH1Cr5B/alLsz6Mor54/wCFleLv+guf/AeL/wCJo/4WV4u/6C5/8B4v/iaPqFXyD+1KXZn0
PRXzx/wsrxd/0Fz/AOA8X/xNVdR8c+JNW0+axvtSMttMNsieTGuRnPUKD2o+oVfIP7UpdmfSNFfP
H/CyvFw6auf/AAHi/wDiaP8AhZXi7/oLn/wHi/8AiaPqFXyD+1KXZn0PRXzx/wALK8Xf9Bc/+A8X
/wATR/wsrxd/0Fz/AOA8X/xNH1Cr5B/alLsz6Hor54/4WV4u/wCguf8AwHi/+Jo/4WV4u/6C5/8A
AeL/AOJo+oVfIP7UpdmfQ9FfPH/CyvF3/QXP/gPF/wDE0f8ACyvF3/QXP/gPF/8AE0fUKvkH9qUu
zPoeivnj/hZXi7/oLn/wHi/+Jo/4WV4u/wCguf8AwHi/+Jo+oVfIP7UpdmfQ9FfPH/CyvF3/AEFz
/wCA8X/xNH/CyvF3/QXP/gPF/wDE0fUKvkH9qUuzPoeivnj/AIWV4u/6C5/8B4v/AImj/hZXi7/o
Ln/wHi/+Jo+oVfIP7UpdmfQ9FfPH/CyvF3/QXP8A4Dxf/E0f8LK8Xf8AQXP/AIDxf/E0vqFXyD+0
6XZn0PRXzx/wsrxd/wBBc/8AgPF/8TR/wsrxd/0Fz/4Dxf8AxNH1Cp3Q/wC06XZn0PRXzx/wsrxd
/wBBc/8AgPF/8TR/wsrxd/0Fz/4Dxf8AxNH1Cp3Qf2nS7M+h6K+eP+FleLv+guf/AAHi/wDiaP8A
hZXi7/oLn/wHi/8AiaPqFTuhf2nS7M+h6K+eP+FleLv+guf/AAHi/wDiaP8AhZXi7/oLn/wHi/8A
iaPqFXug/tOl2Z9D0V88r8S/FwYE6tnHY28XP/jtb2nfGPU4cLf2FvcAdWjJjb+o/lSlgqq8yo5j
Rb10PaK8V17wtp/irw/PaXmI5k1LUmt7gD5om+2zdPUHjI7+xAIb4i+K2o3ktu2hyS2KBD5qyRo5
Zs8dQeMfTrXn895eXFxLPJf3oeWR5WCXMiLudi7EKpAGWZjgADJNOGCqNXYp5jRTtqelfCvwVZ+E
721Ysk+pzBvPuB0A2k7E9FH5k8nsB7FXz38NJJ2+IOlh7y8kX97lZLmR1P7p+oLEGvoSsK9J0pcr
OrD141ouUQooorE3CiiigAooooA+TaKKK+mPjgooooAKKKKACiiigAooooAKKKKACiiigAooooAK
KKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAoo
ooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigCxYWj3+o21nGQHu
JUiUnoCxAH867XXdUg8Ja7Do+lQxC1tNn2pmjV3uCcFgxPbHGBXGabeHTtUtL4IHNtMkwUnG7awO
P0rpp/EWgt4jute+x3VzPL80drcIgiVyMEsQSWA7DArnqqTntdHTScVDezOjZLOLwde6vothBBJq
F5/owuvLzGoADY3HHUPge/tVPTZ5LfwVreu6hDayXokW1t28mMhSO4wMH7559qydV8S6RrGh6Xp0
y30C2gLSeVGhV5G5YgZGBknH1pkniHR5/CVjoEiX8cVvMZpHjVCZCd3qePve9YKnO1muv4HS6kOa
6fT8TotL0iHxL4e0bUby1hW9bUVh3xxhBLEDkggcHgHn2rTvLOE3+unULC3TSWZLWxjES7nmPAIK
8jnJ5PcVzOn+PrOy1Ox26fLHpenwuttAjgsXYY3uT3xn86y9N8WrZaRqMLxSNeXN5Hdo4xtyrbiD
3qHSqtspVqKSRp+Ipx4NvbbRNFWNZ0RHurh4w7yuecc5wvTgetdV/Y2l6b4yiuZLGH/TI4YXhK5R
Jn3EkD6IPzrib7xDoOoeJ/7fuLa+eT5HNnhNhdQBjfnO3j+7Ud141lvr+yvbhJPOivxdyhT8u0bQ
qr9AD+dW6U2kl21JVWnFtvvobPhjw7bp44uPtcCSRLeTQwQtyG25LMR6KMfiRWfYHSdT+Id8139n
ht90n2VJBtiLjhA2O3f3qWDx7CvibUtYmtpMyQNDZxoABFk5yeep6n3Nc3ZXunf2Xe2l9A/nzOjx
XUaKzJgnIwSODn1qowqO7l2IlOnoo9zq3W/s5xb+INNikuLUyX0Vxhdjxqh+T5R8ylyn0qDU9Nsx
4jttatoEGm3dm18sZHyqyr8yY9mx+dZt/wCKIZtATSLaOfyoYBDFJKRuOWDOTjoPlUADsKNM8Uw2
/hoaPeQPKFuVdJFAJWIkF1GTxnH6mhQmveDnpt8rE8aQQ2F3p2mxRIj2tlGJ2UYLSMNxJ/MVzFaW
v6p/bWvXmohWVZpCUVuoXoB+QFZtdVJNQSZyVWnNtHWfDP8A5KFpf/bX/wBFPX0NXzz8M/8AkoWl
/wDbX/0U9fQ1eVmH8Ven+Z7eV/wX6/ogooorhPSCiiigAooooA+TaKKK+mPjgooooAKKKKACiiig
AooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKAC
iiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKK
KKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooA6z4Z/8lC0v/tr/AOinr6Goorx8w/ir
0/zPfyv+C/X9EFFFFcJ6QUUUUAFFFFAH/9mgRh3wmOsAAApbciOiNlEZXK4hgIEMMvX//9j/4AAQ
SkZJRgABAQEAYABgAAD/2wBDAAgGBgcGBQgHBwcJCQgKDBQNDAsLDBkSEw8UHRofHh0aHBwgJC4n
ICIsIxwcKDcpLDAxNDQ0Hyc5PTgyPC4zNDL/2wBDAQkJCQwLDBgNDRgyIRwhMjIyMjIyMjIyMjIy
MjIyMjIyMjIyMjIyMjIyMjIyMjIyMjIyMjIyMjIyMjIyMjIyMjL/wAARCAHuAuQDASIAAhEBAxEB
/8QAHwAAAQUBAQEBAQEAAAAAAAAAAAECAwQFBgcICQoL/8QAtRAAAgEDAwIEAwUFBAQAAAF9AQID
AAQRBRIhMUEGE1FhByJxFDKBkaEII0KxwRVS0fAkM2JyggkKFhcYGRolJicoKSo0NTY3ODk6Q0RF
RkdISUpTVFVWV1hZWmNkZWZnaGlqc3R1dnd4eXqDhIWGh4iJipKTlJWWl5iZmqKjpKWmp6ipqrKz
tLW2t7i5usLDxMXGx8jJytLT1NXW19jZ2uHi4+Tl5ufo6erx8vP09fb3+Pn6/8QAHwEAAwEBAQEB
AQEBAQAAAAAAAAECAwQFBgcICQoL/8QAtREAAgECBAQDBAcFBAQAAQJ3AAECAxEEBSExBhJBUQdh
cRMiMoEIFEKRobHBCSMzUvAVYnLRChYkNOEl8RcYGRomJygpKjU2Nzg5OkNERUZHSElKU1RVVldY
WVpjZGVmZ2hpanN0dXZ3eHl6goOEhYaHiImKkpOUlZaXmJmaoqOkpaanqKmqsrO0tba3uLm6wsPE
xcbHyMnK0tPU1dbX2Nna4uPk5ebn6Onq8vP09fb3+Pn6/9oADAMBAAIRAxEAPwD1+91nWP8AhIZ9
J0nS7G5+z2kNzJLd37wf6x5VCgLC+ceUTkkdRR9s8Yf9ALQ//BzN/wDItFn/AMlD1n/sFWH/AKNu
6r3F3ff26YtXmurDTxJi3NtF+6mHbzZwSy/w8ERckrmQVrSpOo3Z7f1ohN2JJdU8UwvGsukeH42l
YrGG1uUFyASQP9F5OAT9AaWHUvFdxBHPBo+gSxSKGSRNblZWU8ggi15FYQvLq+1TQdRm1QuZNRuk
Wy8tAsJjinX5cDdkYG7cTyeAOlRaJqFwJb/XL3VpEdvD1lcSM8KMisVlJbYqhjggnAIzuI9MYKV1
c6nh3bf+r2Ol+2eMP+gFof8A4OZv/kWj7Z4w/wCgFof/AIOZv/kWsPTdWu3utWsNY1DVIY7e3t5o
5Jxbi5SR2cAKLfKtkquEYEknBBBwei8P3GqzpN9vRzbKR9mnnhEM0q46vGCcHockRnJI8tcc7xpN
03Uv/Xl/kYVI8kuV/wBXIftnjD/oBaH/AODmb/5Fo+2eMP8AoBaH/wCDmb/5FroKKyJOf+2eMP8A
oBaH/wCDmb/5Fo+2eMP+gFof/g5m/wDkWugooA5/7Z4w/wCgFof/AIOZv/kWj7Z4w/6AWh/+Dmb/
AORa6CigDn/tnjD/AKAWh/8Ag5m/+RaPtnjD/oBaH/4OZv8A5FroKKAOf+2eMP8AoBaH/wCDmb/5
Fo+2eMP+gFof/g5m/wDkWugooA5/7Z4w/wCgFof/AIOZv/kWj7Z4w/6AWh/+Dmb/AORa6CigDn/t
njD/AKAWh/8Ag5m/+RaPtnjD/oBaH/4OZv8A5FroKKAOf+2eMP8AoBaH/wCDmb/5Fo+2eMP+gFof
/g5m/wDkWugooA5/7Z4w/wCgFof/AIOZv/kWj7Z4w/6AWh/+Dmb/AORa6CigDn/tnjD/AKAWh/8A
g5m/+RaPtnjD/oBaH/4OZv8A5FroKKAOf+2eMP8AoBaH/wCDmb/5Fo+2eMP+gFof/g5m/wDkWugo
oA5/7Z4w/wCgFof/AIOZv/kWj7Z4w/6AWh/+Dmb/AORa6CigDn/tnjD/AKAWh/8Ag5m/+RaPtnjD
/oBaH/4OZv8A5FroKKAOf+2eMP8AoBaH/wCDmb/5Fo+2eMP+gFof/g5m/wDkWugooA5/7Z4w/wCg
Fof/AIOZv/kWj7Z4w/6AWh/+Dmb/AORa6CigDn/tnjD/AKAWh/8Ag5m/+RaPtnjD/oBaH/4OZv8A
5FroKKAOf+2eMP8AoBaH/wCDmb/5Fo+2eMP+gFof/g5m/wDkWugooA5/7Z4w/wCgFof/AIOZv/kW
j7Z4w/6AWh/+Dmb/AORa6CigDn/tnjD/AKAWh/8Ag5m/+RaPtnjD/oBaH/4OZv8A5FroKKAOf+2e
MP8AoBaH/wCDmb/5Fo+2eMP+gFof/g5m/wDkWugooA5/7Z4w/wCgFof/AIOZv/kWj7Z4w/6AWh/+
Dmb/AORa6CigDn/tnjD/AKAWh/8Ag5m/+RaPtnjD/oBaH/4OZv8A5FroKKAOf+2eMP8AoBaH/wCD
mb/5Fo+2eMP+gFof/g5m/wDkWugooA5/7Z4w/wCgFof/AIOZv/kWj7Z4w/6AWh/+Dmb/AORa6Cig
Dn/tnjD/AKAWh/8Ag5m/+RaPtnjD/oBaH/4OZv8A5FroKKAOf+2eMP8AoBaH/wCDmb/5Fo+2eMP+
gFof/g5m/wDkWugooA5/7Z4w/wCgFof/AIOZv/kWj7Z4w/6AWh/+Dmb/AORa6CigDl7vXPEmmLbz
3+iaUtrJd29s7QarJI6+bKkQYKbdQcFwcZHSuorn/GX/ACA7b/sK6b/6Ww10FABRRRQAUUUUAFFF
FABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQBz9n/
AMlD1n/sFWH/AKNu66Cufs/+Sh6z/wBgqw/9G3ddBQBSGjaWL9r8abZi8Y5a4EC+YTgrktjPQkfQ
0f2RpmUP9nWmUg+zKfIX5Yv+eY44X/Z6VdrN1ybVINOL6RbpPc7gCrAMQvchS6Bj04Lrxk5ONpqE
OdqOi9diuaXcmsdJ07TF22Gn2toMbcQQrHxknHA9ST+NXK4OYLd6l4aki1rU5JhqLif7TEsUmfIk
IDRtGNgwMDCjIYnk4alXX9R/4SiyEN9dTWN3fT2482G3S2IRHyEwfO3KyAFj8p5xgFaVSPs5cj6G
ipSmua/S/wCf+R2808VtBJPPKkUMalnkkYKqgdSSegqSvNL7UtTk8N6vBqd5cyvcaNPOgZLdoJdo
GXgkiO4J84wJBkhl54Oev0G8u7y7v/tsrRTROqiwwuIEIyrbgMuWB5OdoIKgfKSZTuFSi4Rvf+tP
8zZSaKVpFjkR2jbY4VgdrYBwfQ4IP4iiKaKdN8MiSJkruRgRkHBHHcEEfhXNPqV7carNp4vmtkfU
WgSZEQsqrbpIEXcCMkljkg8Z9sZ1n/aZ0G0+wS6zL/pF3vk0sWQV/wB++C32j15xt989qqivazUL
peb0W1zWthXSo+0b7aeTT8vI7Ke9tbZwk9zDExXcFkkCkjIGee2WUfUj1qCfWtKttSh02fU7OK/m
GYrWSdVlkHP3UJyeh6DtVHT9LS/sYpdWt72S5UMmdQMPmhd6tg+R8mMop454571iWP8AYo8La8fE
BiCjUJzqJYkOG8391935t2zytmOfuY5xWlSMYvlTu1v236f12ONanb0VwGp65rVudfure7uXjt9Q
t9PtraKOEFFlEBLgyAZceY23c23J5BqtJr/iWG2TT3j1Mzy6l9mWQGwN8sfkGXBAfyA2RxkDKH7u
eaytpf8Arp/mOx6QSACScAd6x7LxZ4c1K8SzsfEGlXV0+dkMF5G7tgZOFByeAT+Fcxp2qa9qN7pl
jd3stsBDevcbRbvJMIZY0QSFN6KxDEOEI5zjb0GZpNxqVx4a8GadqljZ2mmyi0kg1CK5aZt8YV0j
ZDGojZ8EZ3MByOSRlpX/AA/G/wDltuxtWTPUqK8907xD4hudbjuDDefY5b+4tGhma0S22xmQL5eH
88yfuwSCCD8/ygYIoS+JNdt9Ei1Aa6Jp73QrrUTb+RFi2lRUICYXOxSzDD7jkck80lr/AF8wUby5
T1GiuE1/xNqVne6pDYytKqW+nCNYRGXjaeaRGZS+F3FQuN525x2znNWXWb7W9Ch1G9vrdrTWmSPz
zZmd1No74lEW5AfvAY2kq+cZw1NK7t/X9ai/yv8Ahc9NrOh8QaLcao+lw6vYSaghIa0S5QyqR1yg
ORj6Vx+meINfutehnkjvVsZdQuLR45TaLbhEMgHlYbzzJ+7BIIOfnwoGCIbcNYaFo8kcun634b+1
xG1YI9tdwuZhsbOSJXBYhhiMnBzkkiktWv6/r+tQelz0OC4huYzJBNHKgZkLRsGAZSQwyO4III7E
VJXn1tqmuavfWtmmszWauNTaSSGGIviG5VIwN6MOFODxyM9+apN4k1+28OrqUmqGSe+8OT6kq+RG
I7aVFjI8sbckHzDkOW5HGBxTt/X3/wCTK5XzWPSpriG2QPPNHEhZUDSMFBZiAo57kkADuTTyQoJJ
AA5JNecare3oaGwuNW/tSKWXTL1ZTHGvllrtBtXYB8hAyu7J4PzN2n0zXdfvtehkljvBYT6hcWUk
U5tFtgiGRR5eH88yfuwSCCD8/AGCBL82vut+pOlr/wBd/wAju7e8tbtS1tcwzABWJicNwwyDx6gg
j2qauf1Gx0vR9PUQ3F3prEokTWKtLKxVNoVY9r+ZhAeCrYA3cEZF3Q5tVnsS+r26Qz7yFAUIWXsW
UO4U/R2z14ztG06S5PaQennv/kxJvqadFFFYDCiiigAooooAKKKKACiiigAooooAKKKKACiiigAo
oooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKAOf8Zf8AIDtv+wrpv/pbDXQVz/jL/kB23/YV
03/0throKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACi
iigAooooAKKKKACiiigDn7P/AJKHrP8A2CrD/wBG3ddBXP2f/JQ9Z/7BVh/6Nu66CgAooooAgurK
1vURLu2huFjcSIJYw4Vx0YZ6EetQR6LpUN495Fplkl1I/mPOsCh2bn5i2Mk8nn3NXqKVluPmdrXM
+HQdHtxciHSbGL7WCLjZbovnA5yHwPm6nr61O62UF6kzrbx3c48lHIUPIBltgPU4+Y4+prn7i7vz
rhi1ea6sNPEmLc2sX7qb08ycEsv8PBEXJK5kFY2kyXtnpNjaRancMLzVtQhldkiLKB9oPHyYzuQN
yDz7cVpVpeySe+l9NvS/52NYRdRNt/1Zv9Dtbi00u4Z7K5t7OVrjMzQSIrebt2guVPXHyjPbj2qz
Bbw2sQit4Y4owSQkahQCTk8D1JJrzWxvLjR9C0K+hka5mg8MXEyGULwR5BA+XaMDp64HJ71tWN/f
bL+31m71G3gSKGaGed7YXSuzMAFS3JDKSo2gqdxyuG6VMYpzUVu/82v0LqU5qHxaL/htvuOsvr+z
0y0e7v7uC0tkxvmnkEaLk4GWPA5rGtH8HeJNVGoWTaFquo2oUi5hMM80IydvzDJXnOPxrB1qfW7n
w0Vn+VRqViLK6u7bZI/+kR4aSJX+hP8AqiSSNiY52tUudX0rw7dSahq9t9qkkjit5bDTyjBnYKFV
JJXUuxOAWIUEgkEA1U6bhJpu9n0+X+Zzbo2J7fTFElvcQ2gGoMVkikVf9JbZyCD987F9+F9BUY8P
6KuknSV0iwGmk5NmLZPJJzn7mNvXnp1riNG8Sa0+oJZXF1dER6y9o4vEtjNsFm0u1zDmPIcZyuDg
YPcVHDrPiSfTPD0S3eq3Vxqlg1/LLYx2SyIQIgEUTBU2DeSfvNkjkCpt+n5X/Qdn1/rWx6FBptha
rAtvZW0KwRGGERxKojjOMquBwpwOBxwPSh9NsJdPXT5LK2eyUKq27RKYwFwVAXGMDAx6YFYF1rOp
D4Y3GslootTXTHuN8JSRFkCE7lwWUjIz1Ye5rO13xBqcep3trp9+kYVdLEZEaPsM9w6OeRzlQP6Y
p2d7Alpf+un+Z1qaNpcWqPqkem2aajIu17tYFErDgYL4yRwO/YVQ/wCEW06PxFHq9tbWtuxinS5S
O3VTctKUJZ2HUjYeoOd1ctda3r1mZtJju7++lGsfYluoI7Vbny/swnwN4WHduJGSPu54J5rp/DV9
qF34daXUci7ikmiLM0TOQjEAv5TMgfAG4A4yDwOgl6K/l+DX/BDVMuW3h/RbK0mtLXR9Pgtpk8uW
GK2RUdeflZQMEfM3B9T60sfh/RYrGKxj0iwSzhkE0VutsgjRwchguMBs85HNcJDrPiSfTPD0S3eq
3Vxqlg1/LLYx2SyIQIgEUTBU2DeSfvNkjkCr9nrGsazg3OtxaKbTS4LyR4lgkilZy+5nLbh5Q2D7
jDqfn6ENp31/rf8AyEdXb6doraxc6jbWennU1PlT3McSecDtB2swG77u04PbFLH4f0WLVW1WPSLB
NRYktdrbIJSSMHL4zyPeuLa51Gx1rW9RtNRKQDXrSBrZYkZJhLHbIxYkFuAwK7SuD13Dinaf4h8Q
3OtR3DJeJZy39zaNHMbRbZVjMgXy/n88yfuwSGBB+f5QMELZJ/1sn+o2v6/r0O6j0+yhkEkVnbo6
hwGWJQRvbc/OP4mAJ9TyazNV0XTdU0q80S3NpbXH2BrVDHGpa2ikG0YUYIU7OnAOz2rmtIvtc1S1
8P21x4hubeTUtOfUZbmOG33bgIgIkDRlQo3ljkFunzAVU1W71KG+1zV9P1uMvZ6Da3RmtoUaO7ZT
OR97diM4OQpB5GGGOas0/wCvP/gjje91v/wV/md5baFpNnC8VvpllEkkonkWO3RQ8oIIcgDlsgHP
XIp6aNpcWqPqkem2aajIu17tYFErDgYL4yRwO/YVxV74g8QN4ivGtY7xbWyvoLYpm0S0ZHWMsZDI
4m3nzDt28Z2DDc56PxVPqUVpaJpk8kcstxtdbdoRcyLtY7YfP/dlsgEhv4Q2OcVPRMldkbZuIVuE
t2mjE7qXWIsNzKCASB1IBIyfcetSV5rdeKtWh0RpINQmaaLSNSlZ57aNJBPBIiLuC7lLLlgdp2Mc
kDGAJtUvvEOmnXceIJ5F0zTo9STNvBl3bzcxH5P9V+7/AN/n79Plf9erHyv+vl/meiVHBcQ3MZkg
mjlQMyFo2DAMpIYZHcEEEdiK4O61zVl1HXrtNa2x6Zf20MWnCKPbIkiRZVyV38l224I5zncOKz7f
U9WiitdL0xdRAnutUnd9OFsZcpdkAf6QQm35yTjLdOgzlf1+Fw6X/rqeoUx5o43jR5EVpG2oGYAs
cE4HqcAn8DXIHVtfudF0q5lV7e3ntle8utMhS7kRz/cUMwAJxyqzZBP3cbjS8VrHqGg6mLS6la1s
dHkdbjf5hkeTPG5s5O2Nge+JOCK6Pq9oc7emu36/O2m4QXNNR2vb8Tu1nhad4FlQzIoZ4ww3KDnB
I6gHBx9DRHPDM8qRSo7RNskCsCUbAOD6HBBx6EVwfiSS9mmbTTqtwIbd9KkWUJFuLPcMrMfkx/Cp
6Yyo4wSCtxf39lqOp21iLoyXetCJntRD5oAs43+XzSI8nb3zxnAzjHNff+u3+ZuqF1v/AFZP9Tv6
K4yLUryXSLaS5vb2HWElmiiitkjnacK+AJo4y0Y5Ch2DIFJI3x5rp9Kkv5dNhfUoUhuyPnROntkA
sAfUBmA6bm61s6TVNVL7mElyycexcooorIQUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFF
ABRRRQAUUUUAFFFFAHP+Mv8AkB23/YV03/0throK5/xl/wAgO2/7Cum/+lsNdBQAUUUUAFFFFABR
RRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAc/Z
/wDJQ9Z/7BVh/wCjbuugrn7P/koes/8AYKsP/Rt3XQUAFFFFABRRRQAVUj0vT4ZjNHY2yStKZi6w
qGMhBUvnH3iCRnrg1g3F3fnXDFq811YaeJMW5tYv3U3p5s4JZf4eCIuSVzIKzrHWdUPk3smr+eJd
VubE2flRhVRWk2kELu3gKD1I29RnmrrU/ZWb1v2/z9d7aI0hCUk7P+tf8jr7bS9PswotbC1g2BlX
yoVXAYgsBgdyAT6kVHp1lpOmNLZ6Za2Vo3EssNtGkZ5yAzKvrtIBPofSuU0291jULTQoZ9ent5NQ
099QluEhh3BgIsRqChUIN5Y5BbpziqVvrl7N52pLJHb3V7p+lI8yplY/NmkVnUHP94kZyM4znms9
tLeX9fM19jNp3f597f5noc1vDcoEnhjlQMrhZFDAMpBU89wQCD2Ipl5Z2uoWklre20NzbSDDwzIH
Rh7g8GuRXUtTbUjoR1eUY1A2w1ARRecVFuJtmNnl7skjO37o6Z5plnqtzc6PFPLq92+qrd3UMAs4
BILhUmZQHixtCcIC5KYz/rF3Em6UPay5F1M50nCPM3/Wv+R1VvomlWaxrbaZZQLEd0Yit1UIdpXI
wOPlJX6HFNu9C0e/sIbC80qxuLOHHlW81ujxx4GBtUjAwOOKk0qS/l02F9ShSG7I+dE6e2QCwB9Q
GYDpubrVyiUbNpmSYzyo/K8ry18vbt2Y4x0xj0qha+HtFsYfJs9H0+3iyrbIbZEXKtuU4A7MSR6E
5rSoqfMCnc6Rpt7b3FvdadaTw3LB545YVZZWAABYEYYgKvJ9B6VNb2ltZ2sdrbW8UFvGuxIYkCoq
+gA4AqaigDPu9C0e/sIbC80qxuLOHHlW81ujxx4GBtUjAwOOKW80TSdQe2e90uyuXtTm3aa3RzCe
OUyPl6Dp6Cr9FAFdtPsn8zdaQN5kqzPmMHdIuNrnjlhtXB6jaPSoV0bSk1STU00yzXUJF2SXQgUS
uuAMF8ZIwB37VeooAz7vQtHv7CGwvNKsbizhx5VvNbo8ceBgbVIwMDjip306xkWZZLK3ZZohDKGi
UiSMZwjccqNzcHjk+tWaKAKMujaXPqUOpTabZyX8I2xXTwKZYxzwrkZA5PQ9zUt/p1jqto1rqNlb
3lsxBMNxEsiEjocMCKs0UAUho2li2S3Gm2Ygjha3SLyF2rE2NyAYwFOBkdDgVLLp9lP5/m2kEnnx
iGbfGD5iDOFbjlfmbg8cn1qxRRcDDtPC+nwa1earPbWtzdzXP2iCWS3XfbfukjKqxyRnZnIx1xVy
70HR7+0FpeaTY3NsJDKIZrZHQOSSW2kY3EsST15PrWhRR0sAiqqIERQqqMAAYAFRta27rMrQRMJx
iYFAfMGMfN68cc9qlooBaFE6LpRtWtTplmbd41iaLyF2MiklVIxjAJOB0GadNpOm3FtNbT6faSwT
sGlieFWWQgAAsCMEgKvX0HpVyiixXNLuR29vDaW8dvbQxwwxqFSONQqqB2AHAFSUUUEhRRRQAUUU
UAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFAHP+Mv+QHbf9hXTf8A0thr
oK5/xl/yA7b/ALCum/8ApbDXQUAFFFFABRRRQBTe7kWRlAXAJHSm/bJP7q/lVHVf+PO9/wCucn8j
XMeE/A2h6n4N0O/vBqUl1dafbzTP/a10NztGpY4EmBkk9KTk07JCSurtna/bJP7q/lR9sk/ur+VY
X/CuPDX/ADy1L/wcXf8A8dqpYeCvCGpxSS2Y1OWOOVoi/wDat6FLKcHaTJ8wB4yMjIPPFLml2X3/
APAHZdzqPtkn91fyo+2Sf3V/KsL/AIVx4a/55al/4OLv/wCO1l+GvBWgaz4V0jVLiC/We9sobiRY
9XvAoZ0DEDMpOMn1NHNLsvv/AOAFl3Ox+2Sf3V/Kj7ZJ/dX8qwv+FceGv+eWpf8Ag4u//jtH/CuP
DX/PLUv/AAcXf/x2jml2X3/8ALLubv2yT+6v5UfbJP7q/lWF/wAK48Nf88tS/wDBxd//AB2j/hXH
hr/nlqX/AIOLv/47RzS7L7/+AFl3N37ZJ/dX8qPtkn91fyrC/wCFceGv+eWpf+Di7/8AjtH/AArj
w1/zy1L/AMHF3/8AHaOaXZff/wAALLubv2yT+6v5UfbJP7q/lWF/wrjw1/zy1L/wcXf/AMdo/wCF
ceGv+eWpf+Di7/8AjtHNLsvv/wCAFl3N37ZJ/dX8qPtkn91fyrC/4Vx4a/55al/4OLv/AOO0f8K4
8Nf88tS/8HF3/wDHaOaXZff/AMALLubv2yT+6v5UfbJP7q/lWF/wrjw1/wA8tS/8HF3/APHaP+Fc
eGv+eWpf+Di7/wDjtHNLsvv/AOAFl3N37ZJ/dX8qPtkn91fyrKs/DWmeH5i2nx3CmZSHM93NP0Ix
jzGbb17YzxnoKu1UHfdEy0LH2yT+6v5UfbJP7q/lVeirsibssfbJP7q/lR9sk/ur+VV6KLILssfb
JP7q/lTku5GkVSFwSB0qrT4v9cn+8KLDuzToooqCzn7P/koes/8AYKsP/Rt3XQVz9n/yUPWf+wVY
f+jbuugoAKKKKACiiigArH0jw3Y6UXmMFvLePJMxuvIVZNkkjSbN3JwN2OvOK2KKClJpWRRudG0u
8sobO602zntYceVBLArJHgYG1SMDA44qaSws5hMJbSBxPGIpQ0YPmIM4VvUfMeDxyfWquuTapBpx
fSLdJ7ncAVYBiF7kKXQMenBdeMnJxtPOte3D/wBk21hrd/595etFdy3UCpMgEMjAeUyBY/ugj5Oc
AndnJ09k/Zup+H+fb5ji5N2v3/z/AENjUvDkFxpEWm6dFp1raxybzazWCTW7jngx5Xud2QRyO/Sr
miaUmjaVHZq4kYM8kjhNoZ3YsxC9hknAycDAya5jTdW1hH024udQkuluL26sWgMUaqwiE21/lXO8
+UM4O3k4UVhX2q65qXhK+a7lvI7e+0ea5JmNoAGAU4hCMXMZDFTvBIBX5geuKduh0qjOT9m5K1/1
a+fU9UqOaeG3QPNKkallQF2ABZjgDnuSQAPU1w/ivWdR0q2n+wapfySafp6zy+VDbbdx3bXmaTGQ
20gLEAeD6qKj1a9utSLTS6n5UdtrVlbiwCJtb95EwJJG/cdxI5xgdO9NO8rf1vYyjQbSbej/AOB/
megUV5/ca3qUuuwRQalfNZXt1cWqv5NskICRyf6sHMpZGQAswKkg8YIFR2N5d2ng3w1aWmp6gZm0
0XDLaxWxk8tUXkvNiNUQsBjG45HPDEzz6N9ivqzVlda/8H/I9Eorh7fWL280XSb60vLuTW7ixile
0gtxNDJlc5kUsqx/xkHzI9xGMtgLXZ2zTvaxNdRpHOVBkSNtyq3cA4GR+FdNSi4RUm9/v/4bzOZ6
OzJaKKKxAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKK
KACiiigAooooAKKKKACiiigAooooAKKKKACiiigDn/GX/IDtv+wrpv8A6Ww10Fc/4y/5Adt/2FdN
/wDS2GugoAKKKKACiiigDD1X/jzvf+ucn8jXCaVd2keieGotZ1m90uyXw5ZvYtbXLw+bOV+fAX/W
uAI8RkNncflOTXfX8TTxXMSkBnV1BPTJyKj0KJ9E8PaZpPyzfYbSK283O3fsQLuxg4zjOMmpek7/
ANdQi/dt/XQ5jVrjUoU8XX1nc3cs9tcW8MaPcyIkULRwNKwUAhTgsdwUleSB1Bo2+saqvhvXpdJv
LO6toRb7Da6vcX4iy/74/aXjyP3eDgbimM4GRn0X7c//ADxX/vv/AOtR9uf/AJ4r/wB9/wD1qObT
/gDvsecQaleTaHqaWmqwtZC5sI4pNP1ie/MbPcKsg+0ui9VK/IGO3uAGGe48FytceBPD0zhA8mmW
zsI0CKCYlJwqgBR7AADtV/7c/wDzxX/vv/61U9JjTRtGsdLt0LQWVvHbxtJJliqKFBOFAzgegpuS
7CNmiqX25/8Aniv/AH3/APWo+3P/AM8V/wC+/wD61Lm/qzAu0VS+3P8A88V/77/+tR9uf/niv/ff
/wBajm/qzAu0VS+3P/zxX/vv/wCtR9uf/niv/ff/ANajm/qzAu0VS+3P/wA8V/77/wDrUfbn/wCe
K/8Aff8A9ajm/qzAu0VS+3P/AM8V/wC+/wD61H25/wDniv8A33/9ajm/qzAu0VS+3P8A88V/77/+
tR9uf/niv/ff/wBajm/qzAL7/Wxf7rf0qtT5pmndSUC7QRw2c5x7e1MqodSZBRRRWhIUUUUAFPi/
1yf7wplPi/1yf7wpAadFFFQaHP2f/JQ9Z/7BVh/6Nu66Cufs/wDkoes/9gqw/wDRt3XQUAFFFFAB
RRRQAUUUUAFRyQQyvE8kSO8Tbo2ZQShwRkehwSPoTUlFAEC2Nonl7bWBfKkaWPEYGx2zuYehO5sn
vk+tQQ6LpVu908GmWcT3eftLJAqmbOc78D5up6+pq9XLXF3fnXDFq811YaeJMW5tYv3U3p5s4JZf
4eCIuSVzIK1pUfat+X9aL+vMbk0tzUTRvD94kMiaZpk626tBEywRsIlBKsinHAByCB7ip5dF0qa8
S7l0yzkuYwqpM8Cl1CnKgNjIweR6GuR8OX96k4tmZ7a1F1fvCqhWN663EhKkkHaADkAYZiCeAp3R
6TqvibUreNkluY5L7T3uYWuvsmxZRtK+SqMXMfzYO8EgFeQevPdLWx0ypTUmubbTfz/q/wDmdlHo
ulQ3j3kemWSXUj+Y8ywKHZueS2Mk8nn3NRt4f0VooYm0fTzHA5kiQ2yYjYnJZRjgk85FYMniK8uk
Or2kxj0y2Ft50WxSWLkGXdkZGxHQ8HqDWefFGsxWN25cGe1tZ9QbzI1A8sxo0SsAM4BkIyME+UfX
kutrf1/wd16CVKpJ7/1/Tt8zvYYYreFIYIkiiQYVEUKqj0AHSkmnht0DzSpGpZUBdgAWY4A57kkA
D1NcTfanq+nSXGnRay905NgyXUkUW+Pz5zGwwqhSMDIyCRk5J4qHVZ7u5LCfWZCllrVlaC1eOMeb
iSJt7EKDvOS3GFwPu96pPVLzt+KX6kqg29X/AFuegUVx1pqepJ4hiW+vrg2tzczwx+Wtu9o4UOQq
MpEyOoQ7i+RlWHoRa0e7v31NIrCa6v8ARsHNzexbNnoI5CQ0q424JRg2SfNJG2tadN1IuS0t3/rc
yqQdN2Z09FFFZkhRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFF
FABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQBz/jL/kB23/YV03/0throK5/xl/yA7b/sK6b/
AOlsNdBQAUUUUAFFFFAHO+INS/sfRtU1TyvO+x28tx5e7bv2KWxnBxnGM4Nc8niDxTIgdPDVgyno
V1OUj/0nrT8d/wDIkeJf+wbdf+i2q5o//ILh/wCBf+hGrIML+3fFf/QsWP8A4Mpf/kej+3fFf/Qs
WP8A4Mpf/keurqGC48+WdBDKixPsDuAA/AJK85IGcZ9QaBHNf274r/6Fix/8GUv/AMj0f274r/6F
ix/8GUv/AMj11dFAXRyn9u+K/wDoWLH/AMGUv/yPR/bviv8A6Fix/wDBlL/8j11dFAXRyn9u+K/+
hYsf/BlL/wDI9H9u+K/+hYsf/BlL/wDI9dXRQF0cp/bviv8A6Fix/wDBlL/8j0f274r/AOhYsf8A
wZS//I9dXRQF0cp/bviv/oWLH/wZS/8AyPR/bviv/oWLH/wZS/8AyPXV0UBdHKf274r/AOhYsf8A
wZS//I9H9u+K/wDoWLH/AMGUv/yPXV0UBdHKf274r/6Fix/8GUv/AMj0f274r/6Fix/8GUv/AMj1
1dFAXRyn9u+K/wDoWLH/AMGUv/yPR/bviv8A6Fix/wDBlL/8j11dFAXRyn9u+K/+hYsf/BlL/wDI
9H9u+K/+hYsf/BlL/wDI9dXRQF0cp/bviv8A6Fix/wDBlL/8j1hf8LT/AOxX/wDCh/8AtFekV5TP
40g8HfDvQLmeZzI+lWwt7ZGw0reSnT0A4ye3uSAQehe/4Wn/ANiv/wCFD/8AaK77Rbq4vbK2uLu3
igndjujilMqrhiBhiqk8AHoP614z488S2/ij4VXN/Z3TzQM0eUY/NG4kTKsOzDP65GQQa9l0L/jw
tv8AeP8A6EaAOhoooqCzn7P/AJKHrP8A2CrD/wBG3ddBXP2f/JQ9Z/7BVh/6Nu66CgAooooAKKKK
ACiiigAooooAKKKKAK/9n2W2NfslviKUzRjyx8khzlxxwx3Nz15PrUEekWdkbufTLOxs725BLzrb
D525IL7dpbk56j61frN1ybVINOL6RbpPc7gCrAMQvchS6Bj04Lrxk5ONpqEOeSjtcrmfcisNLsdL
0mPSrpreb7U8nmLIgC3EjlnkAQk5Byx284A74rRS0to5nmS3iWV0WNnVAGZRnCk9wMnA9zXKxao8
L6Sttqd7cSXN28d39ti8uXiCV1UxlV8sZVSMKMgZyc5OVB4h1ux0e0v7jUjdPd6G98yywoEhkXyh
uGxVOMSEkEnpxgUVI8knF9P8n/kaxpzqK99/83/kdnaaZoloJNPs7HT4QrJcPbwwouGz8jlQOuU4
P+z7VLNo+mXN8t7Pp1pLdoFCzyQK0gAORhiM8Hke9cRdXd9o2q600GozajcvBp0In2QiVBJLKvAw
se7DZXcAOVznvdXWNbtdOmlmlna4tL5IorW4+zme8V1U+U/kkqr/ADEgjbwAWGMms+ZL5FOlO91L
8e6TOri0jTIdRk1GLTrSO+kGHuUgUSMPdsZPQflVyuEsZLq58TaLqL6rNcvJpd3KYkSNUz5kWYwN
m4YJA5+bKDP8QNGLxL4hTQ59RdrhRPpM15Gbr7LtSRVVlMKxsXKfNg7wSPlyQc5L2W39a/5B9XlJ
7npNFcHq17rlgdY8rW5z/ZemRXq7oIT5shMxKt8g+TCAYGDgDnOSdAXc0F1qthqmr3Rjigt7mO4R
VWSN5GcBECL84ygwpDFs4O7OKuCcpKJnKk1Hmuv6t/mjrKK4i91XxDDoLuJJIQ95a29reT26RzPH
JMiFmjywB2tnJVDkkeWuOaVxrfiKHXbmKB9Qlg068t7NnkNklvMrLGWaUsyyCQ+YceWAudoCnkG5
03Gbjf8ArT/NGXS56ISACScAd6jgnhuYI57eVJYZFDpJGwZWU8ggjgiuT0q9vr9m1K614QpLd3Nq
NLeOIJ+7LqFU4EnmYTccsw+98oGCOa0jWNZ8O+E9NlW8N4j+GZL2O2eJAkLxLEECkAMQQ53bmOSO
Co4qEr/15N/oOx6rRXmza14mtre5tpLi9hZ5bEQzah9iadPOnEb4WAsuwj7pZc53cntsWlzqE2qX
zT+JHtYdMvIbPyZ4oNtwCkZ3SHaDvcuQuwqAdvynkESv/Xp/mI62C4huYzJBNHKgZkLRsGAZSQwy
O4III7EVJXnGhXWp6bLYyx3zSWt5rOo25svKTYFD3EgYNjfv3Jj723BxtzzVKDxV4nXQZ9UkN2gu
NGnvozefY9kcqqrKYFjcyMg3EESAn7uSDkEsVyvm5fP9bHqlQXN5a2UfmXdzDAnPzSuFHAJPJ9AC
foDXOahJrtjb2kJu72S0KbrnULe0jnuVYnOBGAAAOACscpIzkLjcaus3xjsr290y4Z00rSZJoLhm
83dLIDtOWzkqIznP9+uj6vaHO3prt+vztoTD3pKK62/E7So5J4YniSSVEeVtsaswBc4JwPU4BP0B
rjbjVNXTUL65XUnW3tdXtbNLURR7GjkEIbcdu7P7wkEEc9cjiqovbq91TQdSm1EzF9RulWwCIBEY
4p1wpA3ZGBu3E8twB0rk5rK7/rb/ADN1QbV79P0bPQKK4HRdX1y/iikury5s4L7T3uftFz9jCwMN
pDQqjFjGNxz5gOBtyQc5q3uoahr+jLPc381i8eoWCC2ijQYBlQib94hPzFtwHQbQCMhhTvrb+t7f
1/w9n9Xd7XX9f1/Wl/SKK4e71rXBr139nW6+zWd7DbFSbVbZlYR5Ll2Eu8+YcbePujB5y2G/1u7N
gRrE0X27Vrm1ISGL91FF5+NuUPzfIpyc9Bx1BE77C9g0r3X9Jv8AJHdUVxOlanqvnaXLeam88Vzf
XVg8ZjjRdsXm4kyqghz5QzgheThRV/R7u/fU0isJrq/0bBzc3sWzZ6COQkNKuNuCUYNknzSRtran
Sc4uW1v6+8zqQdN2f9a2/Q6eiiisiAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiii
gDn/ABl/yA7b/sK6b/6Ww10Fc/4y/wCQHbf9hXTf/S2GugoAKKKKACiiigDj/Hf/ACJHiX/sG3X/
AKLasGXSpLi8trq60Q61Zm3EdvHmLFpKJGLSfvGGMgr8yZYbOnTO947/AORI8S/9g26/9FtVzR/+
QXD/AMC/9CNV1TIvozm5PDF1NP4qukjSDULxiNOu2YFowbdEJVhkplgQTjPA64FY1t4Ov4/D2pwW
VtqNl9oEAa2layQzBH3SBVhTyssvy7nzu6MAoyfS6Kdv0/AOY88s/Bsv2bTIGsLkWK6oZ5rW7a2G
yLyHQ5jhURhWY8qu7OcnqQPQY444YkiiRUjRQqoowFA6ADsKdRTuJ6hRRRQAUVWS9jfUpbEK/mxx
LKTgbcMSB+PymrNFhXCiiq11ex2k1rHIrlrmXyk2gcHaW59sKaErg3Ys0UUUDCioXuNl3Fb+TKfM
Vm8wL8i4xwT2Jzx9DU1AgoqC9u47Gxnu5QxjhjaRgo5IAzxUqOJI1cZwwBGaLdQv0HUUUUDCiiig
Arw+wvLPU9A0Vrjwa1+0GnW9us80dq5YLGBxufIXOSAcdegr3CvG/Cn/ACKmlf8AXrH/AOgigDnf
GjwxeCtSitPCzaWkhiMksaW6KcSLjdsck9cDg9a970L/AI8Lb/eP/oRrxj4hf8iJqf0i/wDRqV7P
oX/Hhbf7x/8AQjSe4+h0NFFFQWc/Z/8AJQ9Z/wCwVYf+jbuugrn7P/koes/9gqw/9G3ddBQAUUUU
AFFFFABRRRQAUUUUAFFFFABRRWbrk2qQacX0i3Se53AFWAYhe5Cl0DHpwXXjJycbTUI80lG9r9wL
VwLMzWwuRAZS5+ziXG7ftOdme+3d07Z7UJY2cQiEdpAgiiMMe2MDZGcZQei/KOOnA9K5eLVHhfSV
ttTvbiS5u3ju/tsXly8QSuqmMqvljKqRhRkDOTnJyoPEOt2Oj2l/cakbp7vQ3vmWWFAkMi+UNw2K
pxiQkgk9OMCipHkk4vp/k+/ozeFKUkmn/V2dja6ToVsLnT7TT9OiDxAXFtFCi7oyWxuUDlSd+M8f
e96sW2kabZJAlrp9pAkBYwrFCqiMt94rgcZ7461w91d32jarrTQajNqNy8GnQifZCJUEksq8DCx7
sNldwA5XOe91dY1u106aWaWdri0vkiitbj7OZ7xXVT5T+SSqv8xII28AFhjJrPmSKlSm9pduvdL/
ADsdWNJ01ZkmXT7QSxytMjiFdyyN95wccMe56mmR6HpMJujFpdkhvARclbdB5+c538fN1PX1rk7G
S6ufE2i6i+qzXLyaXdymJEjVM+ZFmMDZuGCQOfmygz/EDRi8S+IU0OfUXa4UT6TNeRm6+y7UkVVZ
TCsbFynzYO8Ej5ckHOS9un9a/wCQ1Rm9FL+r/wBM9ClsbSbzvNtYJPPjEUu6MHzEGcK3qPmPB9T6
09YIUnedYkEzqEaQKAzKM4BPcDJx9TXD6te65YHWPK1uc/2XpkV6u6CE+bITMSrfIPkwgGBg4A5z
knQF3NBdarYapq90Y4oLe5juEVVkjeRnARAi/OMoMKQxbODuzirgnKSiZyptR5r/ANaf5o6ia3hu
UCTwxyoGVwsihgGUgqee4IBB7EVWm0bS7jU4tTm02zlv4RtiungVpUHPCuRkdT0Pc1yt7qviGHQX
cSSQh7y1t7W8nt0jmeOSZELNHlgDtbOSqHJI8tcc0rjW/EUOu3MUD6hLBp15b2bPIbJLeZWWMs0p
ZlkEh8w48sBc7QFPINzpuE+W+3/A/wA0Y9Dtl0bSotTl1RdNskv5F2yXYgUSsuAMF8ZIwB37U60t
tNeC1nsobRoVg2W0kKqVETYOEI42nC8DjgVzelXt9fs2pXWvCFJbu5tRpbxxBP3ZdQqnAk8zCbjl
mH3vlAwRzWkaxrPh3wnpsq3hvEfwzJex2zxIEheJYggUgBiCHO7cxyRwVHFQldf12b/Qdv6/A9Et
PD+jafbtb2WkWFtA0izNHDbIimRSCrEAY3AgEHqMCpJtG0u41OLU5tNs5b+EbYrp4FaVBzwrkZHU
9D3NcG2teJra3ubaS4vYWeWxEM2ofYmnTzpxG+FgLLsI+6WXOd3J7bFpc6hNql80/iR7WHTLyGz8
meKDbcApGd0h2g73LkLsKgHb8p5BEr/16f5oXT+vU6S2t9MmjjktYbR0hnkdGiVSElywkII6NkuC
euS2e9RxeH9Fhe8eLSLCNr0EXZS2QG4Bznfx82cnrnqa4nQrrU9NlsZY75pLW81nUbc2XlJsCh7i
QMGxv37kx97bg4255qbwrr3iS/mtJ54riSPULB7lY76S0jjEg2lRD5LNJ5fzEHerEfLyDkFpXY5a
O39bnezTQ2sDzTyJFDGpZ3dgqqo6kk8AUySztZo50kt4XS4GJlZARKMY+b14457Vxlzq2o22i6ve
Xt7e2+s29nLJDbSWywwxkKTujALrKcbScySY9EzipLjVNXTUL65XUnW3tdXtbNLURR7GjkEIbcdu
7P7wkEEc9cjirq03TnyXv+W/4ounTclzLT+l/mdXLBpyOsc0Vqr3MwcK6qDLKoBBwfvMAgOeoC+1
NXR9MTUG1BdOtBesdxuRAvmE4K53Yz0JH0NcYL26vdU0HUptRMxfUbpVsAiARGOKdcKQN2RgbtxP
LcAdKdour65fxRSXV5c2cF9p73P2i5+xhYGG0hoVRixjG458wHA25IOc8/Mt/wCtjV0ZJfF/V2v0
OuTQtHjNyU0qxU3RzcFbdB5xzn5+Pm555qW50rTr1pGu7C1nMsYikMsKtvQHIU5HIzzjpmuCvdQ1
DX9GWe5v5rF49QsEFtFGgwDKhE37xCfmLbgOg2gEZDCtC71rXBr139nW6+zWd7DbFSbVbZlYR5Ll
2Eu8+YcbePujB5y1ba39af5h7Ke/Nr/wx1j6Rpkl9DfPp1o15Cu2K4aBTIg54VsZA5PT1qVbG0Ty
9trAvlSNLHiMDY7Z3MPQnc2T3yfWuMhv9buzYEaxNF9u1a5tSEhi/dRRefjblD83yKcnPQcdQZNK
1PVfO0uW81N54rm+urB4zHGi7YvNxJlVBDnyhnBC8nCimvQUqM1u9vXpf/JnXrY2ieXttYF8qRpY
8RgbHbO5h6E7mye+T60+eeG1t5Li4lSGGNS7ySMFVVHUkngCub0q8v21AR6fPcX2j7Wzc30WzYcf
KI5MhpVxtwSjBsk+aSNtc1/wkOvWOk6lNdaldm7bR57y3Z4rWS2d0C/vLd4ufLG4YEqkkMvPBztU
pOE+W/8AXn2ehgryPTQcjI6UV59qGqa/9q1S5t9YaKO11a1sYbbyI2jKSrAGLEruJBlJGGHPXI4p
s+r6xDew6P8A29KhGufYGvpYYfNeNrXzQMBAm7cwAIXsMg85zSb/AK9P80Lpf+uv+R35uIVuEt2m
jE7qXWIsNzKCASB1IBIyfcetSV5fca9qFpeS35kW+utM03VY4pmQDzvKlgwzBcLnjBxgZB+70Gzo
2peJg2pW7Q3VxKltFPbDU3sxNuYsGwtu+0phcru2ZIIL45Vwjzctuv8AwRtWO3JwMnpUNteWt4jP
a3MM6qQCYnDAEgMOnsQfoRXJ/bJpdHvY5by+fWLnbatBcQ+QIDIwTMaDgopJO8M+dpG9sVHJqGpn
VhpVpfNawDV/sSmOKMlIRZCTau5SM7uQSD+XFa1aPs99X/w3f1HTjz3t0V/6/E7YkAEk4A70yGaK
4gjngkSWKRQySIwZWU8ggjqK4e01bU9RSCxn1k2jJHeu9yIo90/kzmMbsrtA24LbQDzwVrLtNY1q
HQdPg04XSpZaHa3IMP2YRMWRuZjMwIT5MfJgj5uemObmVm/66/5G6wzd1dXR6fRXH3Or6gniJNMF
/st7iSJ3uAiH7ISpPkZ2lSX28E8gE9ymcqwutS03w/a2tpc39zJeaxeRNJCtv5yBZJmwm8LHklMn
dnq2B0wcxKoNq9+35N/oei0VxGn6prd5fabaXF49vthu5Jtogd5fJlRVDld6qcMQwUjnONvQQaXd
6/fR6OkuvzqdR0k3srpbw5idfLwEymMHzOdwbpxto5tL2/rX/Jh9XfdHfUVxg1e7vNL0u/sbq8Os
XNlFM1lBAJ4X3LnMgYqsfV8HzI9xGMtgLXXWzTvaxNdRpHOVBkSNtyq3cA4GR+FdFSi4RUm9/v8A
+G8zB6OzJaKKKxAKKKKACiiigDn/ABl/yA7b/sK6b/6Ww10Fc/4y/wCQHbf9hXTf/S2GugoAKKKK
ACiiqmpapY6RZtd6hdRW0C5+aRsZOCcAdScA8Dk4pNpK7KjGU2oxV2zmvHf/ACJHiX/sG3X/AKLa
vItd1fW7PVblYNXvltfNKxmKZkjBABKDBxldwB79z1rvPFlxrOteFtc1FGudH0+CyuJEt5YgLi4Z
UZsvnOxdwAxyWG7PBFa9vpWiP4e0yyv4bcW0c4+zxSvtVpcttGM/MTk8HOec5rnrwlXj7rt5nt5Z
iKOW1r1o87ejiknb59/JaW3d1ZJpen6lN8P1sr6V5NQntZNzTMxYF9xUMW5yAQD6Yqrc6bqOpSTO
+myQq0dpHslkjJbZKWf7rEYwfxrqrm4itLaW4nbZFEpd2wTgDknAqtcaxYWpcTT7SiI5ARjw7bV6
DueK76V4RUVrax89ipKvUlUlpdt6eZz154fuRFdW9tbFLD7asy2tuIv3kflAEKrgp9/nDAdM9cVu
aNZPY6OtuVlU/MVSVkLICTgfIAo+g4HQE05dcsGtmnEku1ZPKKGCQSb8Z2+Xt3Zxz06c9Kt213Dd
24nhctHyDlSpBHBBB5BHoeaqcpONpIxhGCleL/q5yreHJk8M6fbrbMJlKNexRCIvMApABLgo2CQQ
G4wOO1TDRpYbOwSawmvrSIyl7GVoWILHKHHyx/KMjA4GeM4zWxHr2nS2guo5ZXhJUIy28h8wnkBB
tyx4OQM4wc4p7a1YrbRz+ZIwkYqqJC7SEjqNgG4Ed+OO9U51Oq6k8lPo+hh6loD3zXsn9nRlv7NS
K1DMpMco38KSeCMr8360ybQrybXftM63UjF4minjaALEqhdylmUyDkNwvB3c4yTWlN4jgtdUkiuC
VtBaxzrKsDsRuLZLEA7VwBycVel1exhuhbvK2/KgssTMilugZwNqk5GASOo9RTUqi6A4U5X1MZNC
nTSb7bAq3s1zI2cjdJCZd2wN2DL2yBk84p8ujx3cVhEmiJa2iXhkltnEe3b5bDJVSV5JHAz61qLr
enuJ2WdtkG4SOY2CqQdpXdjG7Pbqaq3uvxwLZSwpKYpbnyZVe2kEgGxm4TAbPA7HrUqU+w3Gnrr3
MWfw9eNa28MltNJaQzXGLWEQPgM+Y2Cy5TAXIxwRnjvXQNp5/wCEZNhMtxMTb+WypIrSNxjAY7VJ
9zgU/wDt3TzbRTrLJIspZVWOCR3ypw2UClhg8HI4q4lzFLai5jfzImTerIC2R14A5NKU521Q4Qhe
8Wce2h38ltmPTIbdxZ3VugjWONsMV8vcFO0MTuPBx34zip4NAntdSS4iso41jugwddoIiMGG98F+
o7nn3ret9asLmURJM6yHd8ksTxkbQCchgMHDA4Pbmli1mxllgjV5QZ13xM0Eio427uGK4zjJxnNU
5zs9CVTp9zktH0ia80NPsmnCyWXTJIpJSUX7TIwG04UknGDy2D83uatnQ7y41hLqeC7DFomikVrc
CBVC5QsQzjkNwhIO7qMk1v2mvabetiGdv9UZg0kTxqyDGWBYAEDIzjpT49ZsZLaW4DyrFGASZIHT
IPTaCAWz0GM57U3UnzN2EqVNpK5forLt9atzZtcXEhBEpjES28gkBPKrsI3ltvPT36c1etbqG8gE
0DFkJI5UqQQcEEHkEHseaxcWtzdST2ZNRRRSKCvG/Cn/ACKmlf8AXrH/AOgivZK8b8Kf8ippX/Xr
H/6CKAKPxC/5ETU/pF/6NSvZ9C/48Lb/AHj/AOhGvGPiF/yImp/SL/0alez6F/x4W3+8f/QjSe4+
h0NFFFQWc/Z/8lD1n/sFWH/o27roK5+z/wCSh6z/ANgqw/8ARt3XQUAFFFFABRRRQAUUUUAFFFFA
BRRRQAUUVm65NqkGnF9It0nudwBVgGIXuQpdAx6cF14ycnG01CPNJRva/cC3dJaBBcXaw7bfMgkl
AxHwQWyenBIz6E1FbQabJFE9pFatHCjW8bRKpCKDhoxjoMqAR6r7VzyyxXtja2Md7fXk95dotyb2
MxSRon7xg0W1QgKptGFGdwPzZyaVtqes6peW1qurS2quuou8kUMRb9zcqkYG5SOFOOnI9+auvT9k
rPfX7l/TNKcXPZ2/p/5HTrpGhaXp9yq6fp1pZPGRcAQpHGUGSQ/AG3luvHJqe10nTbOOBLTT7SBI
CzQiKFVEZb7xXA4z3x1rz7VNXv8AXPB+oSXGqC08vQobl4UjTbcNLG24tuBIGRtG0jB6k9K1LrW9
b/ty6Nst0La0vYbbYTarbMjCMneXYS7z5h27ePujDc5xdk7f1ubOjO2su/6fjqdaNJ01ZkmXT7QS
xytMjiFdyyN95wccMe56mmR6HpMJujFpdkhvARclbdB5+c538fN1PX1rm11LULnWbjRm1V0gjaYp
epEm6c7QfJGUKbo92SQMnaPR8ZmnXuqweHfC2m2E2pS+dpf2hpbRbXzflEYC/vsJsG/sC3C89SZU
la9v61/y/rQFSn/N/W/9f8Od/LY2k3nebawSefGIpd0YPmIM4VvUfMeD6n1p6wQpO86xIJnUI0gU
BmUZwCe4GTj6muBn17XZtN1G9+3rbvZ6HFeCKBYpI2mdZcndhsr8gIAbHuRU+pXuuac2t41uaRdN
sY9QXMEILs3mZjPyf6v932+bn71Vcn6vPa/9af5o7ea3huUCTwxyoGVwsihgGUgqee4IBB7EVWm0
bS7jU4tTm02zlv4RtiungVpUHPCuRkdT0Pc1iaheXkWrMNDnuru6JX7RZvF5lsnTJMhK+W2Nvyqz
EA7vKbOa6cZ2jcADjkA5rapScEnff7/68+pzJ3KS6NpSapJqaaZZrqEi7JLoQKJXXAGC+MkYA79q
mi0+yh8nyrSCPyIjDFtjA8uM4yi8cL8q8DjgelWKKyGZ1p4f0bT7drey0iwtoGkWZo4bZEUyKQVY
gDG4EAg9RgVJNo2l3GpxanNptnLfwjbFdPArSoOeFcjI6noe5q7RQBXXT7JPL2WkC+VI00eIwNjt
ncw44Y7myep3H1qKz0bS9Puri6stNs7a4uTunlhgVHlOc5YgZbkk8+tXaKAI5oIrmCSCeJJYZFKv
HIoZWB6gg9RUZsbRt+bWA75FmfMY+Z1xtY+rDauD1GB6VYooHdlJdH0xNQbUF060F6x3G5EC+YTg
rndjPQkfQ0xNC0eM3JTSrFTdHNwVt0HnHOfn4+bnnmtCilZD55dypc6Vp160jXdhazmWMRSGWFW3
oDkKcjkZ5x0zSPpGmSX0N8+nWjXkK7YrhoFMiDnhWxkDk9PWrlFFkLmfcgWxtE8vbawL5UjSx4jA
2O2dzD0J3Nk98n1oWxtE8vbawL5UjSx4jA2O2dzD0J3Nk98n1qeimF2FZsHh3Q7X7X9n0bT4vtgI
uvLtUXzwc5D4HzdT19TWlRQIrHT7JhIGs7ciSVZnzEvzSLja545YbVweo2j0rO1bwzY6tcWjzQW3
lRXLXFxC8CutyTC0WHz14YcnPCgfTaooC5Vg02wtVgW3sraFYIjDCI4lURxnGVXA4U4HA44HpTNN
0fTNHieLS9OtLGORt7pawLEGb1IUDJq7RQAx4o5ShkjRzG25Cyg7WwRkehwT+dR/YbTzvO+yweb5
nm7/ACxu37dm7Prt+XPXHFT0UXC5Sn0bS7qFIbjTbOaKOQzIkkCsqyEklgCOGJJOevJps2iaTcC1
E2l2UgtABbb7dD5OMY2ZHy9B09BV+iixXNLuVX02wkhlhksrZoppPNlRolKu+QdzDHJyAcn0FRya
LpU0FxBLplm8Ny/mTxtApWV/7zDHzHgcn0q9RSsgUpLqVodPsrcRCG0t4hDGYogkYXYhxlVwOBwO
BxwKdHY2kPleXawJ5MZhi2xgbIzj5V9F+UcDjgelT0UxXYyGGK3gjggjSKKNQqRooVVUcAADoKfR
RQIKKKKACiiigAooooA5/wAZf8gO2/7Cum/+lsNdBXP+Mv8AkB23/YV03/0throKACimSyxwQvNN
IscUalndzhVA5JJPQVyv9o6v4s/d6SsumaO3yy386FJ5lPObdewK4+dv7+QMrUSmo6dTejh5Vbyv
aK3b2X+b8lqXtW8UR2d8dK021bU9Z2h/scT7AidSzyH5UGPXkll45zTNN8Mf6Yuqa5P/AGjqZwyh
+YLVsg4gQ/d6KNx+Y7c8ZNamk6Pp+hWIstNtVt7cMW2qSSSepJOST9T0AHar1JQb1n/wDWWIjTTh
h1ZdW/if+S8l829DkfG7Ivg3xGzpvQafcllzjcPLbjPavEtXn1tL8m+uZ3ks5FCSIx2RMRlSuOFJ
C54wePUV7X47/wCRI8S/9g26/wDRbVj+BY/OvNe1HOPMu1tvL9PKXG7Pvu6dsd6zxVL2rjFOx6GR
5h9RjVrOCkkl63bStezaTV/LQ6q+tEvrC4tHJVJ42jJHUAjGaxj4cup3kku9QieRlgQeVbFABE+/
oXPJ6Vsajd/2fpl1ebPM8iJpNmcbsDOM9qzb3xA1pLJGtp5jLHA4zJjJlcpjp2xmu+HP9k+aqKH2
hl94ZjvZLiV5IXeS5W4RZ7cSRgiMIQykjcMZPUYOPStLT7BLDTxaoIV6k+TCIkyTnhR0H5n1J61l
TeJZbaKSOWwzepci3EMTvKpOzfuyqFsbf9jr7c1qadfPfaeLmS2kt3ywMcisvQ9RuAOD2JA+lOXP
y67Ci6bnpuZ8vhqKXRLDT2eCRrIqUae3EkbkAqdyZ5BBPfrjmnpoT2sdq9lLawXMAcZFqBEQ5BYC
NWXHIGOSeOc9ar/8JNONJtb5tOwbwqtvErvIT8pYlgsZIAAOMBs+1Tx67cXEdrHDp5W9n8w+VcM8
ShUIBbJTdg5GPlGc9qp+06kr2XTsPutEe6+2tJd/Pd2S2rN5fQjd82M/7XT261XbwtAdTN3izcOy
O5ls1klDKAPkcn5Qdo4we+CO0F7qt/YateTrbiWGGwjmmha4KhOX3bflILce2cdasSeJW/tM21vp
888SOiSSJHISCwB42oVwAwzlh39siVT7ISdL7RYGhL/Zc9mZ+ZLhrlZAn3WMm9cjPIBx9fapG026
uGs5Lu8ieW2uPO/dQFFI2FduCxI65zk1WXxBKbS5unsgsEUzW6fvctJIJNg424Ck45zxzwetR6nd
6ojaX+4iiuGvNhiS6by5F8tzy2wHH/Ae1JKZTcNf+CMn8KRyiNy9rNKkszj7XaCaPbI24jbuHIwM
HPrxzWq+mqdEbTYpTCDCYlkiUIV4xkBcAfhismTxVIIYFj09nu5HlV4lMjqvlttY5SNmIyRj5R74
rVbVEi0RtUngmiRITM8ToQ64GSMHvRL2llfYI+z5nbcyoPCUcVrNCZoYxJKso+zW4iVMLscAZPDL
kevJOTxiWbwz5mtjURcRArKsi7rfc6gJsKB93CYyQAByc89KSDxHcvaXM82lSRi3USOW8xFKc7sG
SNMsAM46e9OGvXVwbIWVjBL9sjkmiMtyUHlrtwThG5O7p29ab9rfX9P66EJUbJL9f66ir4ajNrZ2
0twXjgs5LRtqbS4cKMjnj7vv1qSfRri/0uSx1C6gmX5DHttsKCpyNylm3ZIGRwMelVJvFnEBtNOn
uC9ulw6hJCVDZwo2IwLcHqVHv6XoNVubu8vIILNVS2IVpJZSpJKBgAu09zg88e/Sk/aLV+v4/wCZ
S9m9F6fh/kU38KQSWCQlNPEqT+eAlgogJ27cGPPIwT1bOe+OK19NsU06yS3RYRglj5MIiTJOeFHQ
fmfUnrVXw5d3l9oNpc3wj86SMNuRs7hjqflGD7DP1rVpTlK7jJlU4wspRQUUUVmahXjfhT/kVNK/
69Y//QRXsleVaB4a0r/hFdEkFleyvLp1vK5TVp4huaNSfl85QOSeAMCgDC+IX/Iian9Iv/RqV7Po
X/Hhbf7x/wDQjXjHxK0axs/A17NBb3kEoaPiTUppwR5ijlTKyn8RnivZ9C/48Lb/AHj/AOhGk9x9
DoaKKKgs5+z/AOSh6z/2CrD/ANG3ddBXP2f/ACUPWf8AsFWH/o27roKACiiigAooooAKKKKACiii
gAooooAKKKzdcm1SDTi+kW6T3O4AqwDEL3IUugY9OC68ZOTjaahHmko3tfuBbla1S5gaYwrOxaOE
vgMSRkqueei5IHYe1JHYWcTh47SBHAcBljAIDtuf/vo8n1PJrl4tUeF9JW21O9uJLm7eO7+2xeXL
xBK6qYyq+WMqpGFGQM5OcnKg8Q63Y6PaX9xqRunu9De+ZZYUCQyL5Q3DYqnGJCSCT04wKKkXCTi+
n+TfX5m0KUpJNPf/ADa/Q7GbSNCvJI7WfT9Nne0iCxxPCjGGNsgAAj5VO0j0OD6VYk0nTptQi1CX
T7V72IbY7loVMiDngNjI6n8zXD3V3faNqutNBqM2o3LwadCJ9kIlQSSyrwMLHuw2V3ADlc573V1j
W7XTppZpZ2uLS+SKK1uPs5nvFdVPlP5JKq/zEgjbwAWGMms3JFulPpL8e6T+7+mdaNNsBFDELK2E
cEnmwp5S4jfn5lGODyeR6moJPD+izWS2UukWD2iOZFga2QxqxzlguMZ5PPvXK2Ml1c+JtF1F9Vmu
Xk0u7lMSJGqZ8yLMYGzcMEgc/NlBn+IGjF4l8Qpoc+ou1won0ma8jN19l2pIqqymFY2LlPmwd4JH
y5IOcmltv6/pDVGba5Zf1qegvYWciyq9pAwmjEUoaMHegzhW45AyeDxyfWllsbSbzvNtYJPPjEUu
6MHzEGcK3qPmPB9T61xWrXuuWB1jytbnP9l6ZFerughPmyEzEq3yD5MIBgYOAOc5J0BdzQXWq2Gq
avdGOKC3uY7hFVZI3kZwEQIvzjKDCkMWzg7s4q4Jylymcqcox5r/AJ+X+aOsori7nWNettCleRnh
jkure2tr+4gWKYRySKhkePJGQGyCwT5jgxgDBW+m1S2n0zSbfxNJPLPqTW81yIYPPiT7O8mxgE2b
sqCDsHBHB6m503GTje9v+B/mYo65rq3S6jtXniW4lVmjiLgO6rjJA6kDIz9RUtec6dreuT+IY79r
W68mW9uLF1m+xrAY4zIFEZDeeZMoCQQQcvhQMEUYPFXiddBn1SQ3aC40ae+jN59j2RyqqspgWNzI
yDcQRICfu5IOQc1qh21seqVGs8LTvAsqGZFDPGGG5Qc4JHUA4OPoa5nUJNdsbe0hN3eyWhTdc6hb
2kc9yrE5wIwAABwAVjlJGchcbjR1DWbyGee20rUSbdV00QStiU/vrh0clmyTkADnpjjFazpOMFK9
79v1/wAh048+39ar/M7io4Z4bhC8EqSoGZdyMGGQSCOO4IIPuK42PUtU+3tosmsTLnU2tVvjFF5x
UW6zBfueXuJJGdvQdM81l6dqGqJYWOnafLezedLqEzXGnrbb5CtyQD+/ITb8+Tjnp0Gc4c39fK5t
9Xdt1/V/8j0qiuEuPEGqx22nSNexI2oWcZuDGEdLAlgDOGXcCp3YAJIyAc7QxEX2i+0dPFE1teXV
zNJq8EAG2Hcm9IVLLkKu7DYG47flXIPORS1/rvb+v+Hslh33/r+v62PQKK4WHUtelntNNlu7m1aT
UjbmaUWrXPlfZ2lwwj3Rq2RxwMrjjuUt77XbmWwY61Ki32pXdkUWCLEUcZmKsuUzvAjAycrjquea
d/IHh2tW1/V/8md3RXGxanNPo9tK+pXw1ZJ7iCJbaESm5EcrIDJEBtCkqm5/kC5xvQGrEer6tHrO
l2+pGK1M2nXU00QC4Lo0W09W2kKzEqGYDPVsA1rKny01Uvv+l3+n3mTi1Jx7HVUV5b/wkPiG60Cf
UY9akhaz8O2mp7UgiImmZZS27KH5TsGQuD6Ec50L3xB4gbxFeNax3i2tlfQWxTNoloyOsZYyGRxN
vPmHbt4zsGG5zLi1Llf9dCXp/Xlc9Corn/E1xfpd6JZWN9JZ/br1oZZY0RnCCGR/l3qwByg7Gubs
PEXiKbWY7lob1rSS+ubRoZWs1tysfmBfKw/nmT92CQQQfn+UDBE+o7f19/8AkegTzw2tvJcXEqQw
xqXeSRgqqo6kk8AVIDkZHSvNr+6vbv4c6hf3niFbp9S0Oa5Fi8cSiMlAT5W0Btq7tp3FzyvI7z6j
rWu6J/aln9tmv5Alg0brDCrwm4meNxHnamBtG3zCcE/MzCnyvb+uwdL/ANdP8z0KgkAEk4A7155B
qniOWaz0ua9u7N5dVNsZ5xaPdCL7M0uHEW+NW3Dg7RlccdzpaTe318W1K617yklu7m1GmSRxBP3Z
dQqnAfzMJuOWI+98oGCFLRXC39ff/kdbBPDcwRz28qSwyKHSSNgysp5BBHBFSV5VpGsaz4d8J6bK
t4bxH8MyXsds8SBIXiWIIFIAYghzu3MckcFRxXU+FL7WZNTvLPU/trQrBFNE2oNaeeCxYH5bZiNh
2jBIBzu5PapRs7f11/yE9P6/rudZUcFxDcxmSCaOVAzIWjYMAykhhkdwQQR2IrjNT1XV7TxM0jX9
0umpewW4+yx201ugfYNk6kidZCz8FCVAZDg/MKq22qa5q99a2aazNZq41NpJIYYi+IblUjA3ow4U
4PHIz35qel/62uVynoNRzXENsgeeaOJCyoGkYKCzEBRz3JIAHcmvNW8Sa/beHV1KTVDJPfeHJ9SV
fIjEdtKixkeWNuSD5hyHLcjjA4qbVb29DQ2Fxq39qRSy6ZerKY418stdoNq7APkIGV3ZPB+Zu1cv
vKL6u34tfoxW0u/62/zPSKK8/wBL1/xBd+IIJnjvFsptQuLN452tFtgqGQL5eG88yfuwSCCD8/yg
YI1rO+vTqx/4SC4ubJ0JMFtHFstXA6HzgWMjfe+VihIGfKGM1dKi6kXJPb7/ALv6Qno7HRreWr3R
tVuYWuFyTEJAXGNueOvG5f8AvoeoqevPrzVtT0zSnuLeU28t1pN9qhVo1JWXdGY85B5VX246cVau
9U1XTr280+XVncObLbdSQxg2/nyOjbQFCkDYNu4HBPO7pUVEoS5V6fjY2jRcoqaej/4H+aOzjnhm
eVIpUdom2SBWBKNgHB9Dgg49CKkrzlL3UdPuNRs7S6u7ya51vyHubZYBOQtojYHmbYt3y4PHZsDP
S3L4g1qy0i0vHk866D3Fu9mwjdpFQnEzeVuAZAo3qpxyQAGKis+ZWv6fp/mU8O9LPf8Ar9Du6K8/
a4u9J1LxBqkWqy6jJBolvMhdYtkp/fEN8qrxwTwQPmOT0wr6v4gt4J7d57uJmlshFNe/ZDOolm8t
8LCSu3H3Sy9c8ns762D6u+jXT8bf5nf0Vwlzfa5DLfvHrUpW01S2sI0kgiIdZFhDM+EBzmQsNpAz
2I4q4t6y2uo2uoazqCzWN/5Fvc28avcS5iR8eUkZWQgO3HlnAG7AIyLpRdSSiv62/wAyJ0nGN7l/
xl/yA7b/ALCum/8ApbDVrWdft9J2W8a/a9TmwLawiYeZKTnB/wBlOCS54AB+lcp4kfxRe+HLJboW
liranapJKY/3yn7VD5LrGHdBh+oLnKjsTtHV6N4csdF3yRebc3kmfNvbpvMnkHHBfGcAKowOOB35
qKqlGbgunXp8jWlCjGCqVXftFfq+i9NX5bmXF4butdmS98VOs0YYS2+lJ/qbZv8AbYf61sADn5eX
ABBrqqKKUYKOxFbETrW5tlslsvRfm93u22FFFFUYHH+O/wDkSPEv/YNuv/RbVQ+HqKfCEF0R++u5
ZZp2/vvvK5x0HCjp6Vp+MbiK18L6zJM+1TbyRg4J+ZgVUcepIFJ4Wie38L6dDKu2SOEIwznBHBqd
6q8l+f8Awx1x9zAyf80l/wCSp3/9KV+1kaksSTwvDKoeN1Ksp6EHgis6Lw7pkQbEMrltgJluJHOE
bcoyzE4B7VY1aW4h0e9ltci4SB2jwMncAccd65y58RS3Ek39najHJGsdp88QRwrvKVfnB5xjjtXV
CMn8LPLqSgviR0M2kWM/nF4m3TSCVnSRlYOAFDAggqcDHGP1qxb2sNrbiCJSIxnqxYknkkk8kk9S
eTXLXmqapZxXVst6GEN6sLXlwyReXGYg/wAzCMqPmOMlMc/jW9oc9zcaVHJdTRTOS2JYjuV1ycHO
1QeO4AB6jiiUJKN29P8AgBGcXK1tf+CLLp2mrY22nyARwoQtuomZHDAHG1gQ2cZ6HOM0TaVp4s0S
QPFHBucSrO8brnliZAwbnqcnnqa5K3jYzW1oNUlFyNXlLJ+73wgiUhtu3+Ic/MCPSp7vVdReyggm
vII4jNcRS3VxIkIfY+1VJMbrkjJxtGccY6Vfs5dGZupFXvE6g6VYTRyfugyT24t2IdvmjGcDOf8A
aPPXmhtHsWuluTE3mDbkCVwjFfullB2sRxgkE8D0Fc7c6rqyvGGvBEywWrOsUY2s0khRj867hxyB
gc/lUF/r2oW+losd24u0kuQsshjQTCNyApHlnc54+VQueeRQqc76MbqQS1R1T2NhBp9xDIiJasXl
l3uQASdxbJPHPOe3bFJFpVkiQlVkk8qTzo3kneRt23bncxJPBxzxXLa1Pi+1C6GomHz9KV4IyImS
fG8lQHU7h3OPX6VY1DWbiC52f2kLSVJbdILUCP8A0hGK7mwylj1YfKRjbSVOTtZ7g6sNW0b8miWE
kap5UibZHkDRTPG4ZzlvmUg4J7Zx+VWxbQC1+yiJPI2eX5ePl24xjHpiuaj16Y3ltZG7ja8OozRS
wfLv8oByuR1A4Xnv60eHNT1O+vh9qu7aQNGWmt0l3PA+RhSojXZ3GGZiccdDSdObWrK9pBSslqbM
eh2EcfliOV13Kx8yeRydpyoyzE7QedvT2qtc+GrO4vYpt80cSCXdFFNIm5pCpJBVhgcH5RwSc1tU
VHPK97l8kbWsZ8uiafMIgYCixRiJVikaMFB0RgpAZfY5HJ9atQ2kEEs8kUe1p2DSHJO4gBfw4Aqa
ik5N9RqKWyK1lYW+nxGK2V1jJyEaRmC+ygk7R7DAqzRRSbb3GklogooooGFee6Im/wAJeHv9HeXG
lWv3Z/Lx+5X/AG1z+tehV4f4et9Ru/DelyHX9RjAtIlVESDaihAABmMnAHqSaFuBa+KC7Ph/fjyW
i+aP5Wl8z/lonOdzfzr1vQv+PC2/3j/6Ea8K8d2N3F4L1CSXWb65RfLPlSrDtb94o52xg988Gvdd
C/48Lb/eP/oRpN3Y0tDoaKKKgs5+z/5KHrP/AGCrD/0bd10Fc/Z/8lD1n/sFWH/o27roKACiiigA
ooooAKKKKACiiigAooooAKKKzdcm1SDTi+kW6T3O4AqwDEL3IUugY9OC68ZOTjaahHmko3tfuBbu
ktAguLtYdtvmQSSgYj4ILZPTgkZ9CaitoNNkiie0itWjhRreNolUhFBw0Yx0GVAI9V9q55ZYr2xt
bGO9vrye8u0W5N7GYpI0T94waLaoQFU2jCjO4H5s5NK21PWdUvLa1XVpbVXXUXeSKGIt+5uVSMDc
pHCnHTke/NXXp+yVnvr9y/pmlOLns7f0/wDI6ddI0LS9PuVXT9OtLJ4yLgCFI4ygySH4A28t145N
T2uk6bZxwJaafaQJAWaERQqojLfeK4HGe+Otefapq9/rng/UJLjVBaeXoUNy8KRptuGljbcW3AkD
I2jaRg9Selal1ret/wBuXRtluhbWl7DbbCbVbZkYRk7y7CXefMO3bx90YbnOLsnb+tzZ0Z21l3/T
8dTrRpOmrMky6faCWOVpkcQruWRvvODjhj3PU0yPQ9JhN0YtLskN4CLkrboPPznO/j5up6+tc2up
ahc6zcaM2qukEbTFL1Ik3TnaD5IyhTdHuySBk7R6PjM0691WDw74W02wm1KXztL+0NLaLa+b8ojA
X99hNg39gW4XnqTKkrXt/Wv+X9aAqU/5v63/AK/4c7+WxtJvO821gk8+MRS7owfMQZwreo+Y8H1P
rT1ghSd51iQTOoRpAoDMozgE9wMnH1NcDPr2uzabqN79vW3ez0OK8EUCxSRtM6y5O7DZX5AQA2Pc
ip9Svdc05tbxrc0i6bYx6guYIQXZvMzGfk/1f7vt83P3qq5P1ee1/wCtP80dvPbw3VvJb3EMc0Eq
lJI5FDK6nggg8EVWtNG0uwgggs9Ns7eG3cyQxwwKixsQQWUAcEgkZHqfWsTULy8i1Zhoc91d3RK/
aLN4vMtk6ZJkJXy2xt+VWYgHd5TZzXTjO0bgAccgHNbVKTppSvv9/wDXY5k7lNNG0uLVH1SPTbNN
RkXa92sCiVhwMF8ZI4HfsKji8P6LC948WkWEbXoIuylsgNwDnO/j5s5PXPU1o0VkMAMDA6VBJY2k
0rSy2sDyNsyzRgk7DuTn/ZJJHoTxU9FAJ22KlxpWnXkE0FzYWs8U7iSaOWFWWRgAAzAjk4A5PoPS
optC0e5sksp9KsZbRHLpBJboyKxzkhSMA8nn3NaFFKyKU5LqVjp9kyzq1nbkXCCOYGJf3igYCtxy
MEjBqP8AsjTB5/8AxLrT9/GIZv3C/vEAwFbjlQOMHirtFFkLma6lS20rTrOGGG1sLWCKBy8KRQqq
xsQQSoA4JBIyPU1ItjaJ5e21gXypGljxGBsds7mHoTubJ75PrU9FMHJsjhght0KQRJEhZm2ooUZJ
JJ47kkk+5qC/0rTtUEQ1CwtbsQuJIhcQrJsb+8uQcH3FW6KBFMaTpwheEafaiKSFbd0EK7WiGcIR
jlRk4HTk+tNl0bS59Sh1KbTbOS/hG2K6eBTLGOeFcjIHJ6HuavUUARyW8M0kUksMbvC2+JmUEo2C
Mg9jgkZHYmqyaNpcWqPqkem2aajIu17tYFErDgYL4yRwO/YVdooAzovD+iwvePFpFhG16CLspbID
cA5zv4+bOT1z1NWJdPsp/P8AOs7eT7RGIZt8QPmRjOFbI5X5m4PHJ9as0UeQFK00bS7CCCCz02zt
4bdzJDHDAqLGxBBZQBwSCRkep9aRdG0pNUk1NNMs11CRdkl0IFErrgDBfGSMAd+1XqKAK8Wn2UPk
+VaQR+REYYtsYHlxnGUXjhflXgccD0qLTdH0zR4ni0vTrSxjkbe6WsCxBm9SFAyau0UAUJdE0mbV
I9Ul0uyk1GMYS7e3QyqOej4yOp796mj0+yhkEkVnbo6hwGWJQRvbc/OP4mAJ9Tyas0UAY+r+HbPU
tCudMhigtTJZyWcMqQg+RG4AwoGPl4X5QQPlHpVi20LSbOF4rfTLKJJJRPIsduih5QQQ5AHLZAOe
uRWhRTuBSTRtLi1R9Uj02zTUZF2vdrAolYcDBfGSOB37CrckaTRvHIivG4KsrDIYHqCPSnUUtgK8
1hZ3IxPaQSjy2h+eMN+7bG5ef4TgZHQ4FE1hZ3AmE1pBIJ4xFMHjB8xBnCtkcjk8H1PrViigabRn
jQtHFg9gNKsRZSEM9v8AZ08tiMYJXGDjaPyHpU8Gn2VqYzb2dvCYovJjMcSrsj67RgcL7dKs0UWD
mb0uU4NI0y2kikt9OtInijMUbRwKpRCclQQOFzzjpTLXRNJsrcwWml2VvCZFlMcVuiKXUghsAYyC
Bg+wq/RRYfNLuQNY2jb91rAfMkWZ8xj5pFxtY+rDauD1GB6U+OCGF5XiiRGlbfIVUAu2AMn1OABn
0AqSigV2c/4y/wCQHbf9hXTf/S2Gugrn/GX/ACA7b/sK6b/6Ww10FAgooooAKKKKAPNvi3qX9neC
b0+V5nnShPvYxtzJ6f7GPxrotOnittESeeVIoY1ZnkkYKqgE5JJ6CuO+Lv8ApFmllL81u9pqFwyd
MyR27FDnrwSeOh75rP8AF+qvHod/p9zq/wDZdr/ZUkkC5iX7dKzOGjzIpzgBeEw3z9elRB/vJP5f
hf8AU7a0bYajDveX3y5f/bfT8T1EEMAQQQeQRS15+PEt7H44srCO622Xmpaz200sefmhLLIqCPeF
LbVDNJgnIC9DWTBql9oujXVtaa3Gk51idbtruaGH7DG0krK5Pkts8whfmdWB3cYyMbv+v6+Z5yV1
/Xn/AJHq1Fedt4i1G1ttEuNQ1+3McruhhsZYmmvAZQsbIJIl81cfeMYTOcrnIFeiUC62CiiigYUU
UUAFQ3NrDeQiKdN6BlfGSOVII6e4FTUUbC3CiiigYUUUUAFFFFABRRRQAUUUUAFeN+FP+RU0r/r1
j/8AQRXsleN+FP8AkVNK/wCvWP8A9BFAFH4hf8iJqf0i/wDRqV7PoX/Hhbf7x/8AQjXjHxC/5ETU
/pF/6NSvZ9C/48Lb/eP/AKEaT3H0OhoooqCzn7P/AJKHrP8A2CrD/wBG3ddBXP2f/JQ9Z/7BVh/6
Nu66CgAooooAKKKKACiiigAooooAKKK5a4u7864YtXmurDTxJi3NrF+6m9PNnBLL/DwRFySuZBWt
Kk6jdnt/WiB6I6J7y1S5W2e5hW4fG2IyAM2QSMDr0Vj/AMBPpU9cFqMt2dQ0/VbS0+0XNxq8y28T
OEysdtLGuSeikqz/AEbpmnz6vqs0WkW1jeajdtdW0tzJcWkNrHLuVlGzbMQqqpYgry4wAT1JiqlC
Tj2/O2v6m0aLkk09/wDN/wCR27RRtKkrRoZEBCuVGVBxkA9s4H5VFHYWcTh47SBHAcBljAIDtuf/
AL6PJ9Tya5NfEGrQ2Mctw8LXGoadG9mqFWjW5yEIDLkFSZI2HLcbsEgU2513U9N1BrO4u3dbK4E1
xK0SDzLZvLXnAwMGRjkYP7o9azc11/r+t/TUFRnsv6/rb1Omn0HR7pIEuNKsZlt0McKyW6MIkIwV
XI4GOMCpJNJ06bUItQl0+1e9iG2O5aFTIg54DYyOp/M1xk2ta01hd3T6mbOWx0pNSEPlRkSs5kbZ
JlSdgCKnybTyeTxVi41fVTNqcp1J7aFdQgsI18qMrAsiREvyuSwLkDJ288g0X1tb+r2/Mv2U/wCb
8/L/ADOpitNLkVYIbezZbObcsaIpEEuM5AH3Ww+fX5vemSeH9FmslspdIsHtEcyLA1shjVjnLBcY
zyefeuQt31K2bV4LLUpLiZtZ8uSSI263Myi2jO2MSARFwQN3A4VsYNX01NrjRbKddU1L+1Q8sSRx
Wqs8zI5UrLEuUwGCq0gKDPR0DVpSp+1korqv0uTUhKmuZS/r+r/1c6l7CzkWVXtIGE0YilDRg70G
cK3HIGTweOT60stjaTed5trBJ58Yil3Rg+YgzhW9R8x4PqfWotKkv5dNhfUoUhuyPnROntkAsAfU
BmA6bm61cokuWTRipMKKKKkQUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUU
AFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQBz/jL/kB23/YV03/0throK5/xl/yA7b/s
K6b/AOlsNdBQAUUUUAFFFFAHk/jT/SdV8YTQ/Mlp4ant5z02SOHdRz1yvORxXaaP/wAguH/gX/oR
ri9T/wBL0X4l6n9zzIrm08vrjyYGXdn33dMceprtNH/5BcP/AAL/ANCNRR1V+7f5nXmOlSNP+WMV
8+VN/i2XqYJozM0IkQyqoYpuG4A9Dj04P5VDqE01tp1zPbxebNHEzpHjO5gMgcVxq6lNHcajd2Op
pqEwtLYPOzR4hzIwb7i4AUEnkHHfNdUIOR5k6igd3RWP4durq6tJmubuC7USYjmhkEgIwM/MERW5
z90ex5BrKsNYuZtUWJdU+0TteTwyWW2M+VEu7a3yqGHRRliQc+4o9m7tdhe1Vk+51ckkcMTSyuqR
oCzMxwFHqTTZJ4ooxJJKiISAGZgASTgc+5IriLrXpL7RRbG8jlmbSrhryNdu5ZFCj5gPunluOKlm
vTPpk0cWo/2hZwG1la5JTEZ80bl3IAuAoBPcZ561fsX1/rWxLrrodnHNHMpaKRHUMVJVgcEHBH1B
p9cfbajLFawxzaitlavc3IkvgsSZKudq5K7Mtyc4ycU/V9duLO+s0gvPkVIZJDIyIs6M+CyrsLHA
ySQyheDzS9k27IbrRSbfQ6qWaOBN8siRrkLudgBknAH4mn1w967W2qaqDqBErX1u62sixESITGN2
Cu7A6Ag8EetaEWrXTausX27dO1zLFLYbF/dRKG2ydNwzhTknB3YA6UvZO1/62Qe1V7Nf1r/kdRRX
MaHf38lxpZub17hb6yeZ0dEUIy7Pu7VB/iOc5/CunqZwcXZlwmpK6CiiipLCiiigAooooAKKKKAC
vG/Cn/IqaV/16x/+givZK8b8Kf8AIqaV/wBesf8A6CKAKPxC/wCRE1P6Rf8Ao1K9n0L/AI8Lb/eP
/oRrxj4hf8iJqf0i/wDRqV7PoX/Hhbf7x/8AQjSe4+h0NFFFQWc/Z/8AJQ9Z/wCwVYf+jbuugrn7
P/koes/9gqw/9G3ddBQAUUUUAFFFFABRRRQAUyWWOCF5ppEjiQFndzgKB1JJ6CqGuTapBpxfSLdJ
7ncAVYBiF7kKXQMenBdeMnJxtOIssV7Y2tjHe315PeXaLcm9jMUkaJ+8YNFtUICqbRhRncD82cno
pYfnjzt6fl5vt+om7HW0Vwlvfa5cy2D/ANtSot9qd3ZFFgixFHGZirLlM7wIwMnK46qTzUZ1zW7q
OwsoHv5JT9sDz2SWwlkMM3lKSJsJjBy20ZyRjArl5vI6fq8k7XX9X/yZ3As7VVgVbaEC3OYQEH7s
4IyvpwSOOxNV7nQ9IvLc291pVjPCZTMY5bdGUyHOXwRjccnnrzXG6ZqFymoatrV9qQt3/sO1mkCr
HNDG3775gEyWAIJADnO4jJ4xHD4g1mC6vdPuL29iObNRPfx2plg86RlZgIcp0C7Q4yCeQR1bd3Z9
R+wmr2e1v0/K/wDVzrZtPj1HW7Wf7VbPb6YxKW0cfzxzlCMs27gBH4XaDyDnpV+bT7K4aZp7O3lM
8YilLxK3mIM4Vsjkcng8cmuHgubmxbV7WDVbua8m1oRLJbQwtPPi2jYqN+IlYBTkkY+UgDJGI/Dt
9eap4h0m/vNRnzHaahGwZYfnWO4RRu2AjJGCdhxlBjjOUmnb7/wv/wAAcqMrXvt/wX+jO5utK069
mt5rvT7W4ltjugeWFXMR45UkfL0HT0FSSWFnLFcRSWkDx3JzOjRgiXgL8w/i4AHPYCuH0rXbq41a
ODUNSvG0y806a6M9wILddgZNskXlN5kaYY/6w7unOQa39ButVmupEkNzcaYEzFd31sLedmzyNowW
HUZMceABjfndW0KXPTc9vX+t/IxqKVNqLZof2Bo32BrD+yLD7GzBmt/syeWSAACVxjIAA/AVdt7e
G0t47e2hjhhjUKkcahVUDsAOAKkorMhyb3YUUUUCCiiigAooooAKKKKACiiigAooooAKKKKACiii
gAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigDn/ABl/yA7b
/sK6b/6Ww10Fc/4y/wCQHbf9hXTf/S2GugoAKKKKACiisPxldQ2ngvWZJ32I1pJGDgn5nG1Rx6sw
H40pPlTZpRpurUjTXVpfecDbkz/BjXr+T5rm+s7+4uH6b5CJATjoOFHAwK7PTp4rbREnnlSKGNWZ
5JGCqoBOSSegrF1y1msvhLqVpcJsng0KWORcg7WWAgjI46iuY8X6q8eh3+n3Or/2Xa/2VJJAuYl+
3Sszho8yKc4AXhMN8/XpRTXLCMfI1xk1WxNSa2cn919LHqIIYAggg8gilrgbnX76DWvs66p5NzHc
2sNrpPloftcDiPzJeR5hxuk+ZSFXy+QcHOjpery3muXMNzrYhv0nmjXRgIuI1zskxt8zkBW3Ftvz
YxyK1en9f13OJJ2v6fidbUNtaw2kbJAmxWdpCMk5Zjknn3Nebf8ACc3smj2zW+qQS38OhXVzexqq
Fo7mMR43qB8pBLfLx9KvWeta1Dr8VvLqc13ENR+xmKSOJRIrWvnAkqgIIbgYIGOoJ5o/r8bDcep6
DRXlll4p8RyaPq17Jqti80WmzXElvHKJZLOZRlVKCBPLwdw2yM5OOM7WNaOsSapNpPirR5dQub3O
jpdQsYoxIrOJQyAIgBU7BjIJ5PPTCeiv/X9aDUbtL+un+Z6FRWb4fnguNDtZLfUxqUezH2oPG28j
rzGAvHTgdq0qbVnYhO6uFFFFAwooooAKKKKACiiigAooooAKKKKACvG/Cn/IqaV/16x/+givZK8b
8Kf8ippX/XrH/wCgigCj8Qv+RE1P6Rf+jUr2fQv+PC2/3j/6Ea8Y+IX/ACImp/SL/wBGpXs+hf8A
Hhbf7x/9CNJ7j6HQ0UUVBZz9n/yUPWf+wVYf+jbuugrn7P8A5KHrP/YKsP8A0bd10FABRRRQAUUU
UAFME0bTNCJEMqKGZAw3AHOCR6HB/I1zNxd351wxavNdWGniTFubWL91N6ebOCWX+HgiLklcyCqN
1eXhvLSe3vTYDVtWe2MuxWbyY4nVQu8EZLR7hx/EODyD0TockOZu+23d9L/fsOK5pW/rRN/odvUN
wbWBTeXJhjECMTNJgeWv8XzHoOBn6Vx9hqurXms2lidSdooBeGSSOKPddeTLGqg5UgZ3ENtxyDjb
2ydR1XUZ/CcrXOpfbE1XQbm8eLy0UW7BU4j2qDt/eEfOWPA561zRlezXX/g/5HRHDNyUW+p6Illa
J5ey1gHlyNLHiMfK7Z3MPQnc2T33H1qG50XSr21FrdaZZT24kMoilgVkDkklsEYySTz7muau9X1K
O9vbqPUTHHZajbWS2HloUlWTysliV37j5pIwwHyjIPNRQavqUl5pF0+rHyb/AFGe3msvKQLGkay8
K2N4IKDcSTz02jii6en9dP8AMlU525r+fXs2ddJplhNN50tjbPL5Rg3tEpbyz1TOPun06VDDoWj2
1rJbQaVYxW8iGN4kt0VGUkkqQBgjJPHvWRo93fvqaRWE11f6Ng5ub2LZs9BHISGlXG3BKMGyT5pI
2109a1qPs5Wf9epipyta5mnw9ojWJsm0fTzaFw5gNsnl7gMA7cYzgAZ9BUy6TpqvA66fahoGZ4SI
VzGzfeK8cE9yOtXKKysh80u5Rs9F0rTpDJZaZZWzkkloIFQ5OMnIHfA/Kr1FFO1hNt6sKKKKBBRR
RQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFF
ABRRRQAUUUUAFFFFABRRRQAUUUUAc/4y/wCQHbf9hXTf/S2Gugrn/GX/ACA7b/sK6b/6Ww10FABR
RRQAVyXxE/0jw9baV93+1b+3s/N6+Vl927H8X3MYyOvWutrkvE3+k+MvCNhL81q889yydMyRR5jb
PXgk8dD3zWVb4Gu+n36HdlumJjP+W8v/AAFOX6DPHf8AyJHiX/sG3X/otquaP/yC4f8AgX/oRqn4
7/5EjxL/ANg26/8ARbVc0f8A5BcP/Av/AEI10HndC9RVe/lmg0+5mtovNnSJmjj/ALzAcCsIamy6
LcXFrrQvXHlebIFjb7MGYBz8oA4GThs4xzkVcYuRnKajudLRXJpqV5O0Nvbao8sEl/5CXqJGTInl
Fjg7dhw2RkDtj1qI61dQpaPc6phUuJoHjjMQnuNsu1SEK/Nx1C7TzkelX7F7EOtFK52JOBk0yKWO
eJZYpFkjcZV0OQR6g1zCa7M93b2DXkZu21CaKWD5d4iAcrkdQMBee/rVHT3WJvDcrXxt1S0khI3I
FaUFP3ZLA/MSCMdeOMc0Kk+v9aP/ACB1VfT+tUjuKK4e21vWHsb64e+tjIlnLK8KSB3t5AOAV8pd
mDkYdmJxxnBrrrJJ1sVaa4eeVxv3MqgAkdAABx9cn3qZ03DcqFRT2LVFcSfE1y+nwiG/ja7TTZ5b
lVCFkmULjcMfKQc8fpW5pdxdjVri0uLt7lPs0U6mREUqWLAgbQOOB1596cqTSuxKqnt/X9XNqiii
szUKKKKACiiigAooooAKKKKACvG/Cn/IqaV/16x/+givZK8b8Kf8ippX/XrH/wCgigCj8Qv+RE1P
6Rf+jUr2fQv+PC2/3j/6Ea8Y+IX/ACImp/SL/wBGpXs+hf8AHhbf7x/9CNJ7j6HQ0UUVBZy90+pa
Z4yvr+DQr7UbW60+1hV7SW3G145LgsCJZUPSVeme9WP+Eh1T/oTNc/7/AFl/8kV0FFAHP/8ACQ6p
/wBCZrn/AH+sv/kij/hIdU/6EzXP+/1l/wDJFdBRQBz/APwkOqf9CZrn/f6y/wDkij/hIdU/6EzX
P+/1l/8AJFdBRQBz/wDwkOqf9CZrn/f6y/8Akisy+d9RSyiuPAmsm3tHLpb77Dy2yjJtZTPgjDnj
1xXZ0UdLDTad0cvBqVxbeT5HgLVYvIjMUXltYL5aHGVXFxwOBwPQVDHOsP2vyvhzfp9sz9p2rp48
/Oc7/wB/83U9fU111FAcz7nKSXry6hHqEnw91J72Jdsdy32AyIOeA32jIHJ/M1SET/2nBqTeCdbN
7FM0zTg6crykqygOVmBYKrkD6DOTXcUUWGpyWlzn/wDhIdU/6EzXP+/1l/8AJFH/AAkOqf8AQma5
/wB/rL/5IroKKCTn/wDhIdU/6EzXP+/1l/8AJFH/AAkOqf8AQma5/wB/rL/5IroKKAOf/wCEh1T/
AKEzXP8Av9Zf/JFH/CQ6p/0Jmuf9/rL/AOSK6CigDn/+Eh1T/oTNc/7/AFl/8kUf8JDqn/Qma5/3
+sv/AJIroKKAOf8A+Eh1T/oTNc/7/WX/AMkUf8JDqn/Qma5/3+sv/kiugooA5/8A4SHVP+hM1z/v
9Zf/ACRR/wAJDqn/AEJmuf8Af6y/+SK6CigDn/8AhIdU/wChM1z/AL/WX/yRR/wkOqf9CZrn/f6y
/wDkiugooA5//hIdU/6EzXP+/wBZf/JFH/CQ6p/0Jmuf9/rL/wCSK6CigDn/APhIdU/6EzXP+/1l
/wDJFH/CQ6p/0Jmuf9/rL/5IroKKAOf/AOEh1T/oTNc/7/WX/wAkUf8ACQ6p/wBCZrn/AH+sv/ki
ugooA5//AISHVP8AoTNc/wC/1l/8kUf8JDqn/Qma5/3+sv8A5IroKKAOf/4SHVP+hM1z/v8AWX/y
RR/wkOqf9CZrn/f6y/8AkiugooA5/wD4SHVP+hM1z/v9Zf8AyRR/wkOqf9CZrn/f6y/+SK6CigDn
/wDhIdU/6EzXP+/1l/8AJFH/AAkOqf8AQma5/wB/rL/5IroKKAOf/wCEh1T/AKEzXP8Av9Zf/JFH
/CQ6p/0Jmuf9/rL/AOSK6CigDn/+Eh1T/oTNc/7/AFl/8kUf8JDqn/Qma5/3+sv/AJIroKKAOf8A
+Eh1T/oTNc/7/WX/AMkUf8JDqn/Qma5/3+sv/kiugooA5/8A4SHVP+hM1z/v9Zf/ACRR/wAJDqn/
AEJmuf8Af6y/+SK6CigDn/8AhIdU/wChM1z/AL/WX/yRR/wkOqf9CZrn/f6y/wDkiugooA5//hId
U/6EzXP+/wBZf/JFH/CQ6p/0Jmuf9/rL/wCSK6CigDn/APhIdU/6EzXP+/1l/wDJFH/CQ6p/0Jmu
f9/rL/5IroKKAOf/AOEh1T/oTNc/7/WX/wAkUf8ACQ6p/wBCZrn/AH+sv/kiugooA5//AISHVP8A
oTNc/wC/1l/8kUf8JDqn/Qma5/3+sv8A5IroKKAOf/4SHVP+hM1z/v8AWX/yRR/wkOqf9CZrn/f6
y/8AkiugooA4/WLvV9btrWyj8K6rbf8AEws5nmnmtNiJHcxyMTtnZvuoegNdhRRQAUUUUAFclb/6
V8V7yaH5o7PSUtpz02SPJ5irz1yvORkfjXW1yXhL/TPEPivVfueZfrZ+V1x5CBd2f9rdnGOMdTWV
TWUV5ndhPdpVp9o2+bkl+V/uGeO/+RI8S/8AYNuv/RbVc0f/AJBcP/Av/QjVPx3/AMiR4l/7Bt1/
6Larmj/8guH/AIF/6Ea6DzuhPe3cdjYz3coYxwxtIwUckAZ4pLa6Fy0oEM0YjIAaRcB8qDlfUc4+
oNR6tave6Pe2sWPMmgdFz0yQQK5uLQbia5VpdP8ALt5L9J5I2ZPu+RtbcASDluCOc59K0hGLTuzK
cpJqyOwork7jw/O/iAzeVcGMSRm3lh8hUgjUAFMspkXoeE4Oe2TWxrUFxI1hcW8DXBtbkStEjKGZ
drLxuIH8Q6mhwWmu4Kb1utvxNSiuRtNBmubiBtR05DDm7dopijhS8gZMjJBOPTOK39EguLbQ7GC6
BE8cKo4LbiCBjr3olFJb/wBahGbb20L9FFFQaBRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABXjfhT/
AJFTSv8Ar1j/APQRXsleN+FP+RU0r/r1j/8AQRQBR+IX/Iian9Iv/RqV7PoX/Hhbf7x/9CNeMfEL
/kRNT+kX/o1K9n0L/jwtv94/+hGk9x9DoaKKKgs4+00eHW/EHiWS9vNV/wBH1COGFINVuYERPslu
+Akcir952PTvV6TwjpEMbySXutJGgLMza/egKB1JPndKd4e/5Dniz/sKx/8ApFa1Hquh3U2sJqXl
2+qQIVK2N27KIWH8cfJjLDHG5N2WP7xRgVrShGcrSdv6/rcCvf6Bomn2kVzJda/JHLNFCpj128OT
I4RT/rumWH4Usfh7RmvI7OW48QQ3UiSSJE+u3pLIjBS2VmIx8ykDOcN06gY2qWIm1iVrnRbyXVG1
a0mgu1t2cJbB4iR5gBVVXD5TPX5sHrUmk6WbXxFpt9c6RI0oOpokxtSSjNc748tj5AVL4Y4HzHnn
nFPS7/rT/PQ6fYx5L31/4Df3G7N4T0a2geae/wBZiijUs7vr96qqB1JJm4FP/wCEN0v/AJ+tc/8A
B9e//Hq5XwxbXNv4ggv4dDeBGsJ/PhisJIHMpaNhHJLK/wC/f737w4BOeeeOq0HQ7nTruS5YW1jb
uu1dMsWdoIzn72WwuT1+RI+WO7fwa1pxjKm5N2f5/wBd9jKrD2crJ3D/AIQ3S/8An61z/wAHt7/8
eo/4Q3S/+frXP/B7e/8Ax6ugorMzOf8A+EN0v/n61z/we3v/AMeo/wCEN0v/AJ+tc/8AB7e//Hq6
CigDn/8AhDdL/wCfrXP/AAe3v/x6j/hDdL/5+tc/8Ht7/wDHq6CigDn/APhDdL/5+tc/8Ht7/wDH
qP8AhDdL/wCfrXP/AAe3v/x6ugooA5//AIQ3S/8An61z/wAHt7/8eo/4Q3S/+frXP/B7e/8Ax6ug
ooA5/wD4Q3S/+frXP/B7e/8Ax6j/AIQ3S/8An61z/wAHt7/8eroKKAOf/wCEN0v/AJ+tc/8AB7e/
/HqP+EN0v/n61z/we3v/AMeroKKAOf8A+EN0v/n61z/we3v/AMeo/wCEN0v/AJ+tc/8AB7e//Hq6
CigDn/8AhDdL/wCfrXP/AAe3v/x6j/hDdL/5+tc/8Ht7/wDHq6CigDn/APhDdL/5+tc/8Ht7/wDH
qP8AhDdL/wCfrXP/AAe3v/x6ugooA5//AIQ3S/8An61z/wAHt7/8eo/4Q3S/+frXP/B7e/8Ax6ug
ooA5/wD4Q3S/+frXP/B7e/8Ax6j/AIQ3S/8An61z/wAHt7/8eroKKAOf/wCEN0v/AJ+tc/8AB7e/
/HqP+EN0v/n61z/we3v/AMeroKKAOf8A+EN0v/n61z/we3v/AMeo/wCEN0v/AJ+tc/8AB7e//Hq6
CigDn/8AhDdL/wCfrXP/AAe3v/x6j/hDdL/5+tc/8Ht7/wDHq6CigDn/APhDdL/5+tc/8Ht7/wDH
qP8AhDdL/wCfrXP/AAe3v/x6ugooA5//AIQ3S/8An61z/wAHt7/8eo/4Q3S/+frXP/B7e/8Ax6ug
ooA5/wD4Q3S/+frXP/B7e/8Ax6j/AIQ3S/8An61z/wAHt7/8eroKKAOf/wCEN0v/AJ+tc/8AB7e/
/HqP+EN0v/n61z/we3v/AMeroKKAOf8A+EN0v/n61z/we3v/AMeo/wCEN0v/AJ+tc/8AB7e//Hq6
CigDn/8AhDdL/wCfrXP/AAe3v/x6j/hDdL/5+tc/8Ht7/wDHq6CigDn/APhDdL/5+tc/8Ht7/wDH
qP8AhDdL/wCfrXP/AAe3v/x6ugooA5//AIQ3S/8An61z/wAHt7/8eo/4Q3S/+frXP/B7e/8Ax6ug
ooA5/wD4Q3S/+frXP/B7e/8Ax6j/AIQ3S/8An61z/wAHt7/8eroKKAOf/wCEN0v/AJ+tc/8AB7e/
/HqP+EN0v/n61z/we3v/AMeroKKAOf8A+EN0v/n61z/we3v/AMeo/wCEN0v/AJ+tc/8AB7e//Hq6
CigDn/8AhDdL/wCfrXP/AAe3v/x6j/hDdL/5+tc/8Ht7/wDHq6CigDn/APhDdL/5+tc/8Ht7/wDH
qy9e0G20aztL2yvdZWddTsE/eaxdyqVe6iRgVeQqQVYjBB612lc/4y/5Adt/2FdN/wDS2GgDoKKK
KACuS+G/77wbDfyc3V/PPc3L/wB+QyMC2Og4UcDA4rR8ZXUNp4L1mSd9iNaSRg4J+ZxtUcerMB+N
W9AtZrLw5pdpcJsngtIo5FyDtZUAIyOOorJ61V5L8/8Ahjuj7mCk/wCaS/8AJU7/APpSv6IwPHf/
ACJHiX/sG3X/AKLalj1CLSfCsuozq7Q2sMkzrGAWIUknGSOeKTx3/wAiR4l/7Bt1/wCi2rj/ABDo
F5q1jcEaJ/bCTac8FkMw/wCiT7ny/wC9ZcZynzLk/J9M79Tgik9z0iNxJGrjOGAIzTq4O78PX8mu
tN/ZXm3T3VrLbar5kf8AokKBPMi5beM7ZPlUFW8zk8nF/S9Ikt9cuXvNFM1688zjWiYv9U2dked3
mcKQu3bt+XOelU/IhLT7jraK8w/sDxDNo9tYDSJ4ZbHQrqwErXEW2WVhGEKYckA7CcsFx3xV6z8I
3djr8V3aadDbJHqO5JY/LBSBrXa2Oc4MpyV7n5sd6P6/G3/BHbzPQagvb2306xnvbuTy7e3jaSV8
E7VAyTgcn8K8zsvBWqQaPq0f2W+/tCXTZreWSSS0WO8mYcMDGod8kE7piCM98tjYu/B0hg8RWNjp
9tBaahpUcaIAqxvdDzMsQP4uUy2OcDk4pPYaSur/ANbf5/gd0rB0V1OVYZBqvc3f2aa1j+z3Ev2i
Xy90Sblj+Utuc9l4xn1I9a4ux0SSDxDpV7Y+FGstkawym6jtDHbRjfkxGOQujkt/CCp3cgHJGl4l
S1n8V+GI4xC2ox3MkgwAZY4fJkBb1Cbtoz0zjvimyFtr2Okvbr7FYz3XkTz+TGz+VAm6R8DOFHcn
sKmVtyK2CMjOCORXmB8H6hPot3aDQkhuTpM1vdSvJERqV0SpjlyGJYhlZg0m1gX+uNGfwndPdX9+
unRHUP7UtJrW4ynmLEqwiTa2cqMK4I4zjocihLX+u9v+CU0unn+h21tf213cXUEEm+S0kEUy7SNr
FQwHPXhgePWrNee6j4VRtR1/zfDk10t/cRXMdzZraksqiPMbCZhkb0LFSCpznOa7HQY7mHQbKO8t
LezuFiAe3tlCxx/7KgEgYGOASB2J60La4no9DRooooAKKKKACiiigAooooAK8b8Kf8ippX/XrH/6
CK9krxvwp/yKmlf9esf/AKCKAKPxC/5ETU/pF/6NSvZ9C/48Lb/eP/oRrxj4hf8AIian9Iv/AEal
ez6F/wAeFt/vH/0I0nuPodDRRRUFnP8Ah7/kOeLP+wrH/wCkVrXQVz/h7/kOeLP+wrH/AOkVrXQU
AFFFVNTtJb7TpraC6e1kkXCyp1H5EHB6HBBweCpwQ4pNpN2ALvU7KxZVubhEdmjUJ1bLuEXgc4LH
GelW64LVdBMPhw2l3oFrOsN9bXMktrGbg3IEqh5GRgZDIU3ZBLkg43NzVPX7Se78Sme20dknhvbQ
pP8A2dNJK0StGWdJ9wSJQCymMAnhiR8xIdVRjPli7q/4aa/1+jN6dJTje9t/0PSHYIjMegGarabf
xappdpqECusV1CkyBwAwVgCM4zzzXE2enmDxazwac8kjT3Bmnm0+SKZFYMcm5DeXMmdoVMEgFehQ
1Z8Gadc6d/Zn9p2sstxJpcSw3DQMPsoVQGgI/g6qcnBY7s/dUCIu/wDXqOdGMYvX+v6/q2p2gdjM
6GJwqgESEja2c8DnORjuB1GM84htb6K8mu441cNazeS+4Dltitx7YcfrXOazaTvquoym0mns2Sy8
5EQnzY1eUuoA+9gEEqOo4wc4NW28Px6pYahBb6dYQWp1HzoItW0szJs8mNcpGWQrznHoMjHoUmp1
OWbsu5tLDQjRdS93Zfp576/1sdNqmrQ6SkTTQzyCUuB5Sg42xtIc5I7IQPciqF54qit5GS30vUr8
wxLNcm1jQ/Z1YZG7c67mxk7U3N045GZ/D+i/2Jayw+VpUfmPuxpth9kQ8Y+Zd7ZPvmsr7e/hnVta
Nxp2o3SX0wu7Z7KzecSHykQxkoCEYFBy+1cMOeDjar7NPlhrbr3+X9bHAr7v+v6/U6e0uoL6zgu7
WVZbeeNZIpF6MpGQR+FTV5/qekanql/rWof2b5GrHQ4Vs2zvEFw3nh1jkwBuAKgkEdRyAaxYdFv/
AOxNW/suFYbaT7L51tD4fmsoXCyZl/cPLvlYpw20DeMLljwM3vYdv6+49arlX8bolvcXjaDq39m2
00kU18Ps5jQRuUd9ol8zaCpPCZwM4rmNN8Om6GmW81iZtJfWGla2GkPZ28afZXBxBIzFUL4zuCgs
SQOcmY6DrMfhu7m+06lPZ/2jdvdaGYY1FxbGeQlYyIxJkqQ4+Y7vujAYYLW1HbT+vP8AyPSwQQCO
hory/UNMvrzxjLdNGySyXlvNYXA0SaWeOALHlVufMVIVyJA0bgHluG3AFBZQ2viXTY7nTrldck1q
4M1+0DKs0TRztEPOxtdQmwBASV29BjldP68hdP68z1Gq97fW2nwpNdSeXG8scKnaTl3YIo49WYCv
MrW31e60jT7LT7HUba/sfDdzYtJLbvCFuP3ACq7YBztOGU4OODxxTPh6ObSbyT+yVnsEuLGV7O38
Oy2keUmzIywyM7O/lkhiq4ZcDLYIFWV1rp/wbDsew1lT+IbG38R22hv5n2qePerADYvDFVJznLBJ
COP4D04zwupaTfT+M5pmj2SteW8lhcJoss00cAWPKrciRUhXIkDIwGctw24A2ZtD8UapZX2swXNp
bT3N0t9b2lxYP9oQQn91Hv8ANAXcq8goceY9T2b/AK/r9LCt0X9f8D/M9GorzuS1vXW8Mej3s+nx
QS6tb253QM80yEeSDwyuGMxPGVLr3rn7LQLhzfQ2+kmKwuH0zC2ejzWEbbLo+YfLdmbcq4y525Az
0GaaTvZh0v8A1/Wp7JRXms+hx2Et3bPosjeG4tb8yWwgs2kjaI2qAFYVB3oJjkhVPzc44JEeu6Yl
xbaMbbSTBoCR3Cizv9FmvxG5dSjfZ0cOny79pI+QHbhMgUv6/C//AAB2PTqyT4is0v5rWZZYRC7q
80oCxrsRHJLE8DEg59Qa841fQtVdLOK+EtwRpUMNpNNost5PFOC+4o0c2LeTmP52bBwPn+U49VLS
w2G4xvczJHyi7Q0jY6ckKCfrj3rSHKm+ZX/Al30/r+v+AWKK5/QdDudOu5LlhbWNu67V0yxZ2gjO
fvZbC5PX5Ej5Y7t/BroKKsIwlaLv/X9bNoEFFFFZjCiiigAooooAKKKKACiiigAooooAKKKKACii
igAooooAKKKKACiiigAooooAKKKKACiiigAooooAK5/xl/yA7b/sK6b/AOlsNdBXP+Mv+QHbf9hX
Tf8A0thoA6CiiigDkviJ/pHh620r7v8Aat/b2fm9fKy+7dj+L7mMZHXrXW1yXib/AEnxl4RsJfmt
XnnuWTpmSKPMbZ68Enjoe+a62soazk/Rfr+p3Yj3cNRh35pfe+X/ANt/rU4/x3/yJHiX/sG3X/ot
quaP/wAguH/gX/oRqn47/wCRI8S/9g26/wDRbVc0f/kFw/8AAv8A0I10HndC6xKoSFLEDO0dT7c0
yCXz7eOXy5I96htki4ZfYj1qLUVnfTbpbVI3naJhGkoyrNjgEelZPhfT7nTYruGWCSGF5RJEriIY
BUAjbF8q8gnA9RyTmrUU4t3M3JqSVtzforlU0/UVu7e3+wyeVDqE1ybjzE2FHD4wN27OWA6U/Q9D
m0240uUWiQuLJ47xkK5Z/k27sfe6HB5xVcituTzu9kv6udPUVzcRWltLcTtsiiUu7YJwByTgVzni
DTdQvNYguLe13rB5TxSRrCGBD5cMz/MOAMBcA5OTTk8PF9D1aGS1i+2XTXAR5ME7WclBnnA6HHr7
0uSNk2w55czikb8d0JLloVilwI1kEpXCNnPAPrxyPcU26vY7Sa1jkVy1zL5SbQODtLc+2FNcymiX
G27az0z7AkttChhHlqZCjsXX5GI+ZeM57/Wrrae5hsXstJNisF55ht18sHBQqWAVto5OcZ6A9+Kp
winuJTk1qjoqK5Xw5odzp98JriO5WZYys0rtAEnYkfMNi736E5cgjPfJqbX9LuLy7mdbD7Z5lsIr
aTeo+yy5Pz/MQR1U5XJ+Xp0pOC5rXGpyceax0lFcre6fqXn3kEdlJOtzdW84nV0CqE2bsgsGz8h6
A9a1detJbu2twlv9qhScPPbZX98mDx8xCnnacEgcUuRaa7jU276bFyyvY7+F5IlcKkrxHcB1Vip/
DIqzXHQaLNHZ24uNE8+1SW5b+z8xfJvfKNgts4GRweN3FWBpN1GLL+0LA6qEtEiC70byZR958uR1
4+YZPy1ThG+jJVSVtv6+46miuW1Cw1A3V9DDYySx3V3bzrMsiBVVNm4EFg2fkPQGqNz4ZupluWNh
G8kiXnzMUJLM4MPJPYZx6e1JQi93/Vv6Q3UlskdvRXJT6FeT699qnW6di8TxTxtAFhUBdylmUyDk
NwnB3dsmpbXQpoLu1uxZolyNQneWUFdxhbzMAnOSOV4/SjkjbcSqSf2Tora6hu42eB96q7Rk4Iwy
nBHPuKmrE8P6d/ZjXsJ09YGed5PPQIFlUsSo4O7gHHIHtW3USST0NIttahXjfhT/AJFTSv8Ar1j/
APQRXsleN+FP+RU0r/r1j/8AQRSKKPxC/wCRE1P6Rf8Ao1K9n0L/AI8Lb/eP/oRrxj4hf8iJqf0i
/wDRqV7PoX/Hhbf7x/8AQjSe4+h0NFFFQWc/4e/5Dniz/sKx/wDpFa10Fc/4e/5Dniz/ALCsf/pF
a10FABRRRQAUUUUANkkSGN5JHVI0BZmY4CgdST6VVi1OC584We65aCZYZRHgbSwVs5YgEBXDcE8d
MnisfVdDuptYTUvLt9UgQqVsbt2UQsP44+TGWGONybssf3ijArDk0vy7zWhBpEsVxPrVjdF0tSN8
W6Esd4GGwwkJ5OOSeua1nCMVGzvf/Nad/wAvI0pwUr3OtGu2TvZLEzyi7uZLVGVcASRhy2c4OB5b
DIzzjtzWhNNFbQPNPKkUUalnd2CqoHUknoK4HSdJezGm29npb2klvrV48pW1MaAMk/lvnGCu1owC
MjoPameEdPvbG9S4e1k+0xWbreRQ6W9sZ5cr/rJpJdsz5DYdcjliWAIzlF3kka1KMVdp7f5v9LHc
arqUOj6PeanOsjw2sLTOsYBYqoycZIGePWqum6veX1x5c/h7U7CMruE1zJbFfpiOVmz+GK5nVPDd
9B4U8QGGGK2W40+aOLSNN3yRBip5XOBuJ5wkacsc7zg1sT6NDovh/UprGHVb+ZrRx9ml1S5laQhT
8qF3bYT0yuDWlWMYN8rv/X9dWjnSvb+ux0E0jxIGSCSYllXbGVBAJALfMQMDqe+BwCeKkrx7S9Gu
orm7+x6T5NnJLpbILTRprCNjHdZcmN2ZiyrjLkDIGcYGav3fh64TQlnGnRjztaupNRFxpj3Zmh8y
fyt8KFXlQFkKgEgZDYwKi2l/66BbT+u1z1Kiud8IWU1p4VS3kaTBeUwq9q1sEjLEqqxM7MigHhWO
QMDAxgcLJbX954Zt7GPStTWey8L3djMHs5E/f4hARSR8+dpwVyDjg0JXdv62f/DfMcVc9cqvc2Nt
eS2sk8e97WXzoTuI2vtZc8deGYc+teeav4cuLJtct9FsPs9rNb6fJKqWrPHPiaTzyUUr5rFMblB3
MMDnIB3/AAHYvZWF9tXy7WW53wQppj2ESDYoby4ZHZlBYEnIXJyQOcksT/X3o6yivLbvw9cJoSzj
Tox52tXUmoi40x7szQ+ZP5W+FCryoCyFQCQMhsYFPg0mK3s9I/t7TbnU9DRLry7b+yJGWKRpFMX+
jZkdVCbwm7lAcHbnFIbVmehRanDNrNzparIJ7eCKd2IG0rIXAxznP7s549Ku15lrfh0ahHrdyujX
m+HQLcack6tJJFMvnkbTlszL8vzAlhu688t1LSNRn8aTTTJi5a8t5LK5TRpZ5khCx7lW6EixxLkS
bkbrluG3AGra2B6a/wBbI9PqlJqcMWs2+lssnnzwSTqwA2hUZFIPOc5kGOPWuBGgxQabDdX+jST2
sus3UmpwizaWSeLzJhCWjALSICyELhuoYDAzVs+H9N1bUtHjGgXCaNHp96EtbyA7FJliKBkbO0HB
ZUbBXA+VduBP9fhcdtbf1uegUV47e6Pq1zYaWNQhlZzottFbNNo897PBcgNvKOsifZ5clDvfGSB8
3ynHoPixZf8AhD5onsn1BnEUcsYjd8gsoZmjjO51AyxRT8wBXoacla5PVI6GivJtG0rVNMhv9S03
TGjmS9MdrDb6c1nG8U8MaFlhdiUUSKjtzkbGJA6VHrGhyRa5FBY6GVmsLqySK5/syaaaSJGjLSJc
7gkS8sDGASSGJHzEgS1S9P6+X9bMOn9f1/Xoeu0V5vp/h2W2u9L1CDTnh1J9Y1DzrkwkOIW+0lNx
xnyydhAPBJBHJpmm6cq+Gry20nRL+z8TnSpIrq8a3eASXGBndKxUTOWyVcFsc/Mu7lDas7f1vY9C
trs3Mtwv2W4iWGTyw8qhRLwMsvOcZ4yQM44yOas15LDot/8A2Jq39lwrDbSfZfOtofD81lC4WTMv
7h5d8rFOG2gbxhcseBueH9AvJ/D9/bWl7Jp8Mt2JIEi02bT4VARQyrD5olRS2Tw0eWBOCpO66cYy
dpOy/r+kI7K81O2sra5mZxIbfG+KMgvuONq4z1ORjOOtEGpQ3UKTWqvNCZZInkUACMoWDZDEEjcp
XgHnHbmsSCxuFh0zSv7It9Pt47nzplszugZUy42kKpBMmwkMBnDfe61hafocccFhYR6MYkj1i9+0
x/YykbRvHcBCTjaylWRQeR0HtVV4xpq0dXr/AJdPmaUoKSbfT/J/5L7zsrbXLO7urGG3LyC+tGu4
ZAuFMYKDnPIJ8xeMevSr0s8VuoaaVI1ZggLsACxOAOe5JAArziy0u/GgaXBpdhcWlzF4furcjyGh
K3BMORztwzEMQcjPJB71oeHdPeCLU/s+mxzW08McX2JdKfTrd3ywYskrsTwRuYLyAMbiMCI2c1Ho
/wDNmlSjGMXJPb/M7uisXw/o9zpSTedMixykGOygLmG2GPuoXJOB0+UIuAMIvOdqnUjGMmou6OZB
RRRUDCiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigArn/GX/IDtv+wrpv8A
6Ww10Fc/4y/5Adt/2FdN/wDS2GgDoKKKKAOSt/8ASviveTQ/NHZ6SltOemyR5PMVeeuV5yMj8a62
uS8Jf6Z4h8V6r9zzL9bPyuuPIQLuz/tbs4xxjqa62sqXwt92zuzDSrGH8sYr58qb/Fs4/wAd/wDI
keJf+wbdf+i2pY9Qi0nwrLqM6u0NrDJM6xgFiFJJxkjnik8d/wDIkeJf+wbdf+i2rj/EOgXmrWNw
Ron9sJNpzwWQzD/ok+58v+9ZcZynzLk/J9M79Tgik9z0J7sKbYLDNJ9oOBsUYQYzubngdvqRVivP
Ljwnfz+Lfts8V9IfOge3uoXtVS3jVV3IWdDMvKv8sfytu5I3MRr6VpMtrrtzLd6KZb5p5nXWiYv9
UxJRAd3mcAqu0rt+XOelNkdDrKK8yTwpqv8AZF5bwaN9luzpFxa3c/nR/wDEzuW27ZMhstyHO6Ta
Rv8Ac4uah4PuFnvINO0yGOxuBp7vHEURXkjnLTMRkc7MZP8AFx1p22G0u/8AWn+f4HoNFedal4Pv
fs19Z2dk8ekjVFuEsbMW+JYfIVSFSUGLAk+bawA4JHOM2F8Nz22m6TFc6Tc6tp8Hn+ZpczWzsrOw
MbFTshwgDDavC7sLkDNILHaPf20eow2DyYupo3ljTafmVSoY56cbl/OrNchqehGXX9B1NdESdba2
e3IHlO9q7FCj5cjITa3KknngHJrm7LwVqkGj6tF9lvv7Qm02a3lklktFjvJmHDAxoHkyQTumIIz3
y2D/AIIJJ2PU6Kp6Xp1vplilvbW8cIPzSBFALuRyzEdWPcnk1cpslO6CiiigYUUUUAFFFFABRRRQ
AUUUUAFeN+FP+RU0r/r1j/8AQRXsleN+FP8AkVNK/wCvWP8A9BFAFH4hf8iJqf0i/wDRqV7PoX/H
hbf7x/8AQjXjHxC/5ETU/pF/6NSvZ9C/48Lb/eP/AKEaT3H0OhoooqCzn/D3/Ic8Wf8AYVj/APSK
1roK5/w9/wAhzxZ/2FY//SK1roKACiiigAooooAbJIkMbySOqRoCzMxwFA6kn0pVZXQOjBlYZBBy
CK5zVdDuptYTUvLt9UgQqVsbt2UQsP44+TGWGONybssf3ijArmpbeK61/XDFply+rnU4DaXKwlhB
iKEv+8GVj4zuyRuHHzdK0qRjFRcXe/8AwNPx8kaU4c7fkek1UfUYY9Xg00q/nTQSTqwA2hUZAQec
5y47etcQNFjh02C4vdJlmgk1i5k1GMWpkeWLfMIiyAFpEBZCBg4yG6Cok0zVjabbK0u4SdN1NLNS
DG0SvNGYUyf9Wdo+UHBUDHG01im/69DZUI3tzeX5/wCX4o9HqN54opIo5JUR5WKxqzAFzgnAHc4B
P4GvPW0+Jo7xtJ0W6t9DItPtNn9jeDztrsZsQlQzfIU3YB3gY+bGKs6NawTweIbSw0CG6s5dQQJZ
3y+TCiiCJvmVlJUccKEJBI4A5GlJKc+V/wBbfLr3M5UuWLd/60/E72iszQ9NudLsTBc3z3blywJ3
kIP7ql2d8f7zHrxgYA06JpRk1F3XcxCiiipAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACii
igAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKK
ACuf8Zf8gO2/7Cum/wDpbDXQVz/jL/kB23/YV03/ANLYaAOgoorD8ZXUNp4L1mSd9iNaSRg4J+Zx
tUcerMB+NKT5U2aUabq1I011aX3md8N/33g2G/k5ur+ee5uX/vyGRgWx0HCjgYHFdbWdoFrNZeHN
LtLhNk8FpFHIuQdrKgBGRx1FaNTSXLBI2xtRVcTUmtm3b0vocf47/wCRI8S/9g26/wDRbVc0f/kF
w/8AAv8A0I1T8d/8iR4l/wCwbdf+i2q5o/8AyC4f+Bf+hGtji6F6iqmp263el3Vu0csiyRspSEqH
OR2LEDP14rlptDvbiys0m09ktYWlH2S2itg3JGx2R8xbuGztP8WRjJA0jFS3djKc3HZXO0oqrp1u
9rpttbyM7PHGFJd95zjucDP1wKtVDVnYtO6uFFFFAwooooAKKKKACiiigAooooAKKKKACiiigAoo
ooAK8b8Kf8ippX/XrH/6CK9krxvwp/yKmlf9esf/AKCKAKPxC/5ETU/pF/6NSvZ9C/48Lb/eP/oR
rxj4hf8AIian9Iv/AEalez6F/wAeFt/vH/0I0nuPodDRRRUFnP8Ah7/kOeLP+wrH/wCkVrXQVz/h
7/kOeLP+wrH/AOkVrXQUAFFFFABRRRQAVBb2Vvay3MsMe17mTzZjuJ3NtVc89OFUcelT0UBcKZ50
XnmDzU84LvMe4btucZx6ZHWq+p2kt9p01tBdPaySLhZU6j8iDg9Dgg4PBU4I5K90O5h0H+zG0mEF
9QtZJbiyZn+0gTpukk3ZcPgEncXwOrnmtVCLg5X17fr/AMMOKvJI6+/0+11S0a1u4y8RZW+VyjKy
kEMrKQVIIBBBBpljp9ppNq0Vsjqm4yO0kjSO7HqWZiWY+5J4AHauLPh1LOe9ms9K8p7fW7b7F5cG
PJgPk+b5WB8qHMm7bx97NV7PRbqbxC4vIFNy1zc/aGGkyZmgYOFWS5Z/LkjKlMIASMKNo2kjnbaV
7av/ACT/AF/A6VSTjbm0PQbO7gv7KC8tn8y3njWWN8EblYZBweRwaj1PUItJ0q61CdXaG2iaV1jA
LEKMnGSOa87+wIfC3hvT28P8RWjLILnSZrhEnAVWUwqVAZiWIlY4GDg/MTVW60yd/CzQ6tot/eXz
aJFFYMLZ5WhlCMHXIB8ts7SScbhxk4xTctWl/W5UcPHmV31/W3/D9j1gHIB9ahs723v4DNbSeZGJ
HjJ2kfMjFWHPoVIrz3xBZ3F14laaHRytzDe2hWf+z5pZWiVoyzpcbgka4LKYwCThiR8xIBp0Nl4a
OnDQAE/ticzh9NlliVd8jRuYY8GdduxRglQSp/hxS5tL/wBdP8yFQXKnfV2/Jv8AyPRTPEJ1gMqC
ZlLrGWG4qCASB1wCRz7ipK4TRtJvZvClvpsuiwM63Vw6PdqYEtB5rbHjQFnDAMCoVhgAjzFOCev0
qzmsNNhtri7e7lQYMr5yfYZJbA6DczN6knmuhwj7NTvq+n9fqc81yzcVrYuUUUVkIKKKKACiiigA
ooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACi
iigAooooAKKKKACiiigArn/GX/IDtv8AsK6b/wClsNdBXP8AjL/kB23/AGFdN/8AS2GgDoK5L4if
6R4ettK+7/at/b2fm9fKy+7dj+L7mMZHXrXW1yXib/SfGXhGwl+a1eee5ZOmZIo8xtnrwSeOh75r
Kt8DXfT79Duy3TExn/LeX/gKcv0OtooorU4Tj/Hf/IkeJf8AsG3X/otquaP/AMguH/gX/oRqn47/
AORI8S/9g26/9FtXHax4XvdYu4Lgw3tzbm28q3+zNaj7NKHclyZkZkzlTviy3y9OFquqJSuj0uoV
uN95JbiGXEaKxlIGwk5+UHOSeMnjuK5IaHqCeJ/7Qjs8WPmbDbl1LGXbj7Zjdtz/AA4xuI+brxWR
oHg7VrKK92G+s9Sexlge8lktRHPO2MSAwoJJOQW3SkMM9CScF/6/r+vxQkr/ANf1/Xyv6VVa+v7b
TrcT3cnlxmRIg20n5nYKo49SQK4+TRHfw3PFpvhhtMuEntZ2h3QK100ciuxGxyuSAQGYgknnHWq9
74fv9Z0zXZLrRCDc6pb3kNnctC7vHGsQYcMUDEI4wWxzycGq6/15f8H7gSXU9Borzl/Cl5c+KEvn
sL+BTLBJatE1mqWcSquYi21pUwVb5YiVbdjI3MR0nhTQhpcV5cXNpHHfT3ly3mnazmJpmZBuHRcE
Hb6k8ZoQmtDoqKKKACiiigAooooAKKKKACiiigAooooAKKKKACvG/Cn/ACKmlf8AXrH/AOgivZK8
b8Kf8ippX/XrH/6CKAKPxC/5ETU/pF/6NSvZ9C/48Lb/AHj/AOhGvGPiF/yImp/SL/0alez6F/x4
W3+8f/QjSe4+h0NFFFQWc/4e/wCQ54s/7Csf/pFa10Fc/wCHv+Q54s/7Csf/AKRWtdBQAUUUUAFF
FFABRRRQAUUUUAFNkkSGN5JHVI0BZmY4CgdST6U6ub1XQ7qbWE1Ly7fVIEKlbG7dlELD+OPkxlhj
jcm7LH94owK1pQjOVpO39f1uBsWOpwajLeRwbv8ARJhC7HGGJRXBUg8jDj9auVwh0+7GvX2oXllN
cad/asb/AGMwFuTBEonwM+ZsYAY6DDNyVGKum6PdP4oBu4gLn7XcG4kXSZA00DbwqvdGTY6bSmFA
JGFG0bSRg29NP60Oj2MbXv0/r+vM9ForgbfS7jV7W60xyxfRLeSzt5H5DTHDRv6kiNYjn1ciksLL
U7zVbaaWzmgj1F/7Qn8yEjy3j3hFfPRsGDjr+7P4Lm7L+v8AhtROiknd7Hf1U1PUItJ0q61CdXaG
2iaV1jALEKMnGSOa83Glz/2FcR2Gk31vfDRLiLU2Nu6Nc3RC7fmwPOfcJCHXd1PPzCrXijRLWCDV
bT+wJ7gNpwTSza2jSCKTD+YBtGI2LEEk439MnGKd/wCvvNI4ePMk3/Wnn5/dqekA5APrTIZ4riPz
IZUlTcV3IwYZBwRkdwQQfpXC6hp+3xgtxFpz3Ny11AwafT5CyKAoYxXaNtjjABJjbkkOMYcVsto1
3ea//aMcEOkqkgMk0Lk3F4BwBIFITHHG/wA07W4EbVtRjGabk7W/r1+69vy55x5Umne6OlooorMg
KKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAo
oooAKKKKACiiigAooooAKKKKACuf8Zf8gO2/7Cum/wDpbDXQVz/jL/kB23/YV03/ANLYaAOgrkrf
/SviveTQ/NHZ6SltOemyR5PMVeeuV5yMj8a62uS8Jf6Z4h8V6r9zzL9bPyuuPIQLuz/tbs4xxjqa
yqayivM7sJ7tKtPtG3zckvyv9x1tFFFanCcf47/5EjxL/wBg26/9FtVzR/8AkFw/8C/9CNU/Hf8A
yJHiX/sG3X/otquaP/yC4f8AgX/oRqyOheoqnq1q97o97axY8yaB0XPTJBArnLnTdR1KSZ302SFW
jtI9kskZLbJSz/dYjGD+NaRipbuxlObjsrnX0VyF54fuRFdW9tbFLD7asy2tuIv3kflAEKrgp9/n
DAdM9cVuaNZPY6OtuVlU/MVSVkLICTgfIAo+g4HQE0SilG6YRnJys0adFce3hyZPDOn262zCZSjX
sUQiLzAKQAS4KNgkEBuMDjtUw0aWGzsEmsJr60iMpexlaFiCxyhx8sfyjIwOBnjOM0/Zx/mJ9pL+
U6FL2N9SlsQr+bHEspOBtwxIH4/Kas1ympaA9817J/Z0Zb+zUitQzKTHKN/CkngjK/N+tMm0K8m1
37TOt1IxeJop42gCxKoXcpZlMg5DcLwd3OMk01CL6g6kl9m511Vrq9jtJrWORXLXMvlJtA4O0tz7
YU1gpoU6aTfbYFW9muZGzkbpITLu2BuwZe2QMnnFPl0eO7isIk0RLW0S8Mkts4j27fLYZKqSvJI4
GfWkox7jc5dEdJRXFz+HrxrW3hktppLSGa4xawiB8BnzGwWXKYC5GOCM8d66rTrd7XTba3kZ2eOM
KS77znHc4GfrgUpRSV0xxm27NFqiiioNAooooAKKKKACiiigArxvwp/yKmlf9esf/oIr2SvG/Cn/
ACKmlf8AXrH/AOgigCj8Qv8AkRNT+kX/AKNSvZ9C/wCPC2/3j/6Ea8Y+IX/Iian9Iv8A0alez6F/
x4W3+8f/AEI0nuPodDRRRUFnP+Hv+Q54s/7Csf8A6RWtdBXP+Hv+Q54s/wCwrH/6RWtdBQAUUUUA
FFFFABRRRQAUUUUAFFFFABQRkEetFVNTtJb7TpraC6e1kkXCyp1H5EHB6HBBweCpwQ4pNpN2QENr
DZ6RH9iso3kkLCR4zP5kpDNgyM0jbmA9SScLgZwBWjXFT6Td2WkR2Q0qBZBqNpM9zZln+04nj3SS
BsuHwCTuL4HVzzVOz0Ga3l069trB4tRfU78S3BiIcRN9oKbmxnYTsIzxkg96qqlBtR1S/wAkbRhz
x5pPX/gN/ods+owx6vBppV/OmgknVgBtCoyAg85zlx29at15fbaZMwxo+j3tjqQ0S5huZngeLfdE
xfxnAdyQx3huf73HE9jpajTtSWLT5HimWFbe3tdHl0+NbkMSsgEjMQw+UtJtC4A5YjFZc39fNmjo
Rte/9fp/wD0Ke9t7ae2hmk2yXUhjhG0ncwUsRx04Unn0qevPBpQW/wBKm1PSXutQtdWZr28FkZBL
uifZIpC/cz5Q4+4VAJ+XNM0/Sr5fE3mzRlL1bq4eaWPSpA8sR37Q90ZNjpgphQCRhRtG0kJysL2E
bb9P8/8AJfeejUyaaK2geaeVIoo1LO7sFVQOpJPQV57pXhS2kh8PQ3mjBo/7Gla6Sa34NwfI/wBY
COX+U9efl9qt+HdNuNLk0a6XTLgzzaKxvzsxJNOPJ2rIzYy/Lgbj6+laRTcrP+t/8iZUopXUv6+8
7qiuE1Pw5qFt4V19oIorUT6fNHDpOmmR41cqcFc4G4nn5I05Y53nBrG8UeG5ItS+z29lFHZfYUTT
/K0SS7aGfc5domjdBbyEsh3tgE4O75Ti6sIwlaLuv6/rR6mKWn9eX+Z6pVLS9Th1a0a5gWRUWeWA
iQAHdHIyN0J4ypx7Vx8djax+KLiTWtGvb/VWu4XsL2K0Y+XEEQcTD5YgGEhZCw3ZPDbgDV03w9La
3ml6hBp8sWoSazqAnuDEQ4gb7QUDHGREW8tgD8pJB6mo6XC11/XZ/wCR6PRXjNnoWqJoepgW8q6h
/Y1xDeJbaLNbtcTlRjzJmkIuJNwbDordWOQGAPR6jomk2GsNFqHhye8sBZxrpkdnYtJ5M25zLtKD
EMjEofMJTPXd8pwW/r7xf1+X+Z21lqcN/dX9vEsgexnEEhYDBYoj5HPTDjrjnNXa86vPD7Sanquq
jTZzfLr1k1tMYyXSHFuJCh7KRvDEcEKQcgVW0fSNQTxok9yvl3yX9xJNPFo0qySQEvsV7wyeW6bT
HhACQQo2jaSBLRf10X+Y3pqelSzxQ7PMkRS7bEDMBub0Gep4NLC7SwRyPE8LMoJjcgsh9DgkZHsS
K5qy0S80vUpp5oIdSaZWUagzt9pjU87CrkjZxk+WUGTxGOtcqPDs1x4eunuNKme7g8OWaWoeAlku
FWX7gxkSKdvTkZ960qwjB2g7rTX7/wCtTWlTU73dtvxdj0fUdRh0y3jmmV2V54oAEAJ3SOEB5PTL
DPtVuvO9UsBJrEpuNHu59UOrWktveJbO6rbB4if3gGFUYfKZHPzY703T9Muo/E3n3kJFyl1cSXEk
ekSl5oDv2q9yX2SJtKYQKSMKNo2nGClp/XZf0y/YxcL3O/vbyDT7Ge9upPLt4EMkj4J2qBknA5NT
g5GRXmN1oc02ialbXGjzzJPpsw0iF4fMNogJYRNx8jn5CMnsF6plpfEGmSXd2jQWZis3sIk05f7F
lmkt3BbIj2un2ZxlOW2jgc4U4XM7bDWHi7Lm7/p/m/uPSaK8+vdAe5bV5prCWW5l1ezUTeT87QD7
OXKkfwZDE4OMqfSlPh1LOe9ms9K8p7fW7b7F5cGPJgPk+b5WB8qHMm7bx97NUrtr+u3+ZHsY2+L+
vvO8hniuI/MhlSVNxXcjBhkHBGR3BBB+lSVzTaNd3mv/ANoxwQ6SqSAyTQuTcXgHAEgUhMccb/NO
1uBG1cRcaI+seL42fQjbLLf3MV7INMm87yWjljDPds22RG+UhFUhcqMjbztVhGLSi73/AA8uz9fv
SMFtdnrlFeYahZ31zpS3GsaM9zK9zHZM1xZS3aJHAr/vnt4julV5NxA6fMjH7oqHw94Xa8OmWusa
KXtIINTHkTWZSFd1xG0QEbFgo28quTjHB4rLv/XS40trnqtVri7MFxbQra3ExnYqXjUbYgBnc5JG
B0HGSSenXHm9pp0a2umN4n0LUdSP9jWkdmq2kk0kE4B8wbh/qZCSnzsU6D5vlOH6npGoT+NZ5pYy
tw17BJZXC6PLPNHCBHuVboSLHEuRIGRuuW4bcM0171v63F0PTqZJNFCUEsqIZG2JuYDc3oPU8Hiv
NNH0jUE8aJPcr5d8l/cSTTxaNKskkBL7Fe8Mnlum0x4QAkEKNo2kjpbPSrvQ9Rnvp7WLVWZWxf7m
N2i9dm1iw28ZxGVGTxGOtaUqcZxbbs+i7/Pb9fIHvZG7a6it3czRRW8xjid42nO3ZuXbkDnJ5JHT
qre2bleea1o+oDShH9mmnuH0G+ExijZs3ErROVHuW3YHXj2qTUNENjeanHZ6XKdMdLGS5ggiOLgC
STzuB99iu3cOSwwDnODnUspPl2/4Nr/qbxpKUFK+/wDmv8ztLPUYb64voYlcNZziCQsBgtsV8jnp
hx+Oat15jJpjtZXZstLe30g6x5rW1zpcsyNF9mRVP2YFWZN+MKPukA4+Xi0ukag2k2EGmxXC6igu
GjuWtmtUjtmJ/cgMXKhvlCKTlAAxA27TlzO23b8i5UI9Jf1/X5nepe28l9NZLJm4hjSSRNp4ViwU
56c7G/Kp686XS0Fxq0uiaLNYT3ehxJZObMxMjL5gZC2BsfHljBYE4BB4yK0GiyS2NzHb2jCzmubF
ZLa30eWxiOJwXby3diTs+8wUKQBycHDvrYToR3v26en+b+49OqN54opIo5JUR5WKxqzAFzgnAHc4
BP4GuAu/DERl1KWLSmSRdYtEtnihKmO3226v5ZA+VNu8NjjAIPStS20toLTWtLg8P2tzZPqAFvaX
CrFaiPyo2Jxtb5d+77qt83pyRpSXPJJ6L/hu9u/foROnFRumdfRWZoem3Ol2Jgub57ty5YE7yEH9
1S7O+P8AeY9eMDAGnRNKMmou67mIUUUVIBRRRQAVz/jL/kB23/YV03/0throK5/xl/yA7b/sK6b/
AOlsNAHQVyXw3/feDYb+Tm6v557m5f8AvyGRgWx0HCjgYHFaPjK6htPBesyTvsRrSSMHBPzONqjj
1ZgPxq3oFrNZeHNLtLhNk8FpFHIuQdrKgBGRx1FZPWqvJfn/AMMd0fcwUn/NJf8Akqd//Slf0Ro0
UUVqcJx/jv8A5EjxL/2Dbr/0W1M0zVUSW10uO2nmlMZlldNgSBCzBS2WB5KsBtB6c4p/jv8A5Ejx
L/2Dbr/0W1c5B4fuft2satZaZZvc3GlLBbyzRo3mShpQyt3wR5YOcAgAZ44rqSkmn/XU7S5u/s01
rH9nuJftEvl7ok3LH8pbc57LxjPqR61ZrzPR/COo2l1ZH+zXjht9Sa4iMwtkaKJ7Yo42w4VcyAZV
Rg5B5OSJpPBdzH4H0ayWxcTxmJtTt7cW7S3G2MqATKDG+1ipAbjC8HIFU9vu/r5Csnb+u56NRWN4
X019J0CC0dZ02s7LHO8bNGpYkL+7VUXAI+VRtXoCQM1s0MkKKKKBhRRRQAUUUUAFFFFABRRRQAUU
UUAFFFFABRRRQAV434U/5FTSv+vWP/0EV7JXjfhT/kVNK/69Y/8A0EUAUfiF/wAiJqf0i/8ARqV7
PoX/AB4W3+8f/QjXjHxC/wCRE1P6Rf8Ao1K9n0L/AI8Lb/eP/oRpPcfQ6GiiioLOf8Pf8hzxZ/2F
Y/8A0ita6Cuf8Pf8hzxZ/wBhWP8A9IrWugoAKKKKACiiigAooooAKKKKACiiigAooqpqdpLfadNb
QXT2ski4WVOo/Ig4PQ4IODwVOCHFJtJuwEk15bW/m+bPGrRRGZ1LDKoM/Nj04PPtTbG7a9txMbWe
3VgpUTbckFQc4UnHXHOOQe2CeaXSru00iXR/7Mt4jdzIk13aMzC4QkCR5N3zhygbli/JHzk1SudF
e+8Qsl1YSS2b66ZXDxExtH9hC5PGCpb5fQnitqtOMNIu/wDS7X7/AIF048176WVzunYIjMegGara
bfxappdpqECusV1CkyBwAwVgCM4zzzXBRaYtvBaRarot3dabEb2O3gS2eTyZPtDeUQgB2/u+FfGF
HcZ5z59G1B9N0yO5tnUjR7aK13aTLdSwTBTu2MrqIJM7PmbA4HPynHNzb6f1r/kdCw8dU5Hq9QWd
7b38BmtpPMjEjxk7SPmRirDn0KkVxt5YSHW2ujp1xJpK3EP26HySTczgYEwjAJZVOzOODjP8HzZh
0drfw+lpBpaQW8OsXD3sMmlPPHIhaTym8pNpmUAx42kgYHHy8HNoRGjFrft+T/Hb7z0yiuA0rQ3e
90j7XayT21va3kkPm2ZiSJjLGYgEZmKYGdgJ3ADoMYEGj+ErXy9CjudGBjk0VvtqywcSTjytglBH
LLl9obkYOOlF3a9v61/yD2MP5vw/4J6Es8TTvAsqGZFDPGGG5Qc4JHYHB/I1JXGRaXqOreHtEgl0
+KO8isYi+o3bOs1u5QbggjKybjjDfPHwerciuutongtYoZJ3ndFCtLIAGcjucADNdFSnGMU09e39
flo/zOdqzsS0UUViAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFAB
RRRQAUUUUAFFFFABRRRQAUUUUAFFFFABXP8AjL/kB23/AGFdN/8AS2Gugrn/ABl/yA7b/sK6b/6W
w0AUviJ/pHh620r7v9q39vZ+b18rL7t2P4vuYxkdetdbXJeJv9J8ZeEbCX5rV557lk6ZkijzG2ev
BJ46HvmutrKGs5P0X6/qd2I93DUYd+aX3vl/9t/rUKKKK1OE4/x3/wAiR4l/7Bt1/wCi2q5o/wDy
C4f+Bf8AoRqn47/5EjxL/wBg26/9FtVzR/8AkFw/8C/9CNWR0L1FU9WtXvdHvbWLHmTQOi56ZIIF
c5c6bqOpSTO+myQq0dpHslkjJbZKWf7rEYwfxrSMVLd2Mpzcdlc6+iuQvPD9yIrq3trYpYfbVmW1
txF+8j8oAhVcFPv84YDpnritzRrJ7HR1tysqn5iqSshZAScD5AFH0HA6AmiUUo3TCM5OVmjTorj2
8OTJ4Z0+3W2YTKUa9iiEReYBSACXBRsEggNxgcdqmGjSw2dgk1hNfWkRlL2MrQsQWOUOPlj+UZGB
wM8Zxmn7OP8AMT7SX8p0KXsb6lLYhX82OJZScDbhiQPx+U1ZrlNS0B75r2T+zoy39mpFahmUmOUb
+FJPBGV+b9aZNoV5Nrv2mdbqRi8TRTxtAFiVQu5SzKZByG4Xg7ucZJpqEX1B1JL7NzrqrXV7HaTW
sciuWuZfKTaBwdpbn2wprBTQp00m+2wKt7NcyNnI3SQmXdsDdgy9sgZPOKfLo8d3FYRJoiWtol4Z
JbZxHt2+WwyVUleSRwM+tJRj3G5y6I6SiuLn8PXjWtvDJbTSWkM1xi1hED4DPmNgsuUwFyMcEZ47
10P2W6g8Nm1hAlultiircMJAzbejHAB9OgpSgkrpjjNt2aNOiuLsNB1G1ilktoXt5ll/c+YYkxHI
gVwRF8owQHwBzgckk1KdEvIPEFvNb2e2C3ZY0eMRKGh8vb8zH94zBjyM4wOMmqdOP839f1+vYhVZ
Wvy/1/X6dzr6K5Cy8PXlpb2YtYUtLltOlhuJkKg+aQuwsRy2MHB5xU76VJLoVzbWWlPp0reX5gBi
DXAByw4LKSRkZbrnnik4R7/1cpVJfy/1Y6OCbz0L+XIg3FRvGCQDjI9j2qWuNfw9c/2OIYobxYDd
CWS0b7NuZNuMBAvlD5sNg5zjOQa6HQ7NrDSo4GEq4LEJKyFkBJIHyAKPoOB0BNEoJK6YQnJuzRo0
UUVmahXjfhT/AJFTSv8Ar1j/APQRXsleN+FP+RU0r/r1j/8AQRQBR+IX/Iian9Iv/RqV7PoX/Hhb
f7x/9CNeMfEL/kRNT+kX/o1K9n0L/jwtv94/+hGk9x9DoaKKKgs5/wAPf8hzxZ/2FY//AEita6Cu
f8Pf8hzxZ/2FY/8A0ita6CgAooooAKKKKACiiigAooooAKKKKACiiqmp2kt9p01tBdPaySLhZU6j
8iDg9Dgg4PBU4IcUm0m7ASS3SRyCFB50/wApMSMu8KWxvIJHyjn8jjJ4qeuKn0m7stIjshpUCyDU
bSZ7mzLP9pxPHukkDZcPgEncXwOrnmqdnoM1vLp17bWDxai+p34luDEQ4ib7QU3NjOwnYRnjJB71
VVKDajql/wAA2hTUoczdv+Gb/Q7Z9Rhj1eDTSr+dNBJOrADaFRkBB5znLjt61bry+20yZhjR9Hvb
HUholzDczPA8W+6Ji/jOA7khjvDc/wB7jiex0tRp2pLFp8jxTLCtvb2ujy6fGtyGJWQCRmIYfKWk
2hcAcsRisub+vmzR0I2vf+v0/wCAehT3tvbT20M0m2S6kMcI2k7mCliOOnCk8+lT154NKC3+lTan
pL3WoWurM17eCyMgl3RPskUhfuZ8ocfcKgE/LmmafpV8vibzZoyl6t1cPNLHpUgeWI79oe6Mmx0w
UwoBIwo2jaSE5WF7CNt+n+f+S+89Gpk00VtA808qRRRqWd3YKqgdSSegrz3SvCltJD4ehvNGDR/2
NK10k1vwbg+R/rARy/ynrz8vtVvw7ptxpcmjXS6ZcGebRWN+dmJJpx5O1ZGbGX5cDcfX0rSKblZ/
1v8A5EypRSupf1953VFcVN4d1e20PV20/wAjT5p7OSO303TpH8pHweVZiqqx6gokfLHcWwGrOuNL
0i70KW10Hw3fWUEt3YC5Q2ElskgE67/3bAEkLnc+3BGMsccXUhGM+WLvt/Xy8mzBHe3F2YLi2hW1
uJjOxUvGo2xADO5ySMDoOMkk9OuLNeXX2gXUfi+RI7eOApd2506SDRJJXht1WMFI7lZFjhTiQFCB
kFuG3AE03R9RXxd51xHsv1vbmSaaLRpRJLA2/Yr3hk8t02mPCAEghRtG0kZ9L/10/pjt/X9fgeo1
BHdJNPshHmoNweVGUqjKQNh5zu5Pbsc44zxej+E5j4F0W3t0W0mFvHLe2c6PGt1IUUMJihVs8bTu
3LgncjYGI/EWnXs1m8MOjNbbNBvbZYLVd8asTFtVCoHBwdowCQOgradOMY3Tu9dPv+/+vQqlDnmo
t2ud/VSz1GG+uL6GJXDWc4gkLAYLbFfI56YcfjmuL1DRDY3mpx2elynTHSxkuYIIji4Akk87gffY
rt3DksMA5zg0JNMdrK7Nlpb2+kHWPNa2udLlmRovsyKp+zAqzJvxhR90gHHy8c/Nq/67f5m0aMWt
/wCrX+89OqBL23kvprJZM3EMaSSJtPCsWCnPTnY35VwS6RqDaTYQabFcLqKC4aO5a2a1SO2Yn9yA
xcqG+UIpOUADEDbtKLpaC41aXRNFmsJ7vQ4ksnNmYmRl8wMhbA2PjyxgsCcAg8ZBzAqEdfe/q6X5
anotFeYwaLJLY3MdvaMLOa5sVktrfR5bGI4nBdvLd2JOz7zBQpAHJwcW7vwxEZdSli0pkkXWLRLZ
4oSpjt9tur+WQPlTbvDY4wCD0ppt/wBen+Yewje3N+Hod+88UUkUckqI8rFY1ZgC5wTgDucAn8DU
lchbaW0FprWlweH7W5sn1AC3tLhVitRH5UbE42t8u/d91W+b05IgvtNvNDj0K5uZrzUYrTUmmm+z
wyztEjQyoNqkySsNzLnJbGTjCjA25IezU27N9P62+ZhKNm0v60O2orzPTfDw1a9sRq2jSyWmzVnM
V3bkpl7tWj3KRjJHzDPpkdKybzRtVuNP0pb+CQsdEtorVpdHmvZ4LgBt+x1kT7PJkp874zgfMNpx
nbT+vP8Ay/EGtT2Kiub8W2E1/wCGrezMUtyzXlmJlVMlkE8e8kDPGMk9sZ7VyV9oF1H4vkSO3jgK
XdudOkg0SSV4bdVjBSO5WRY4U4kBQgZBbhtwBEtbf10/z/Mnpc9QdgiMx6AZqrpeow6vpNnqVurr
DdwpMiyABgrAEZwSM8+tcbo1lZwavL9s0O9fxF9puWk1FbR1UxMX2Ez8K6bCgEYZiDj5RtyMex8N
ahYaFp40ewntNSuPDM0dxKEKO1xiHy1kbj5x84XcQVGQMAULVf12b/Qdj1WivJbbQZZtOu4razYW
U9zp6yWtroc2nxEi4Bkby5HZmOz7zBQpAGScHG5FpemWXie4S+8PXM92t3D/AGVPa2TbILdUQKqT
DCxIpD7kLLkZ+VtwBEv6+7/MXQ7HS9Th1a0a5gWRUWeWAiQAHdHIyN0J4ypx7VdrzjTfD0treaXq
EGnyxahJrOoCe4MRDiBvtBQMcZERby2APykkHqaj8BaTe2ms28txH5NzHZtHqHl6NLa+dKSvMs7y
Fbh8hiHQHqxyAwBLajkrN/11sel0V5j8SrCfU7u6gh0QXFwunEWlw+mzXhZyW+WJlZUt3XAO88tl
cA7QDcn06/tzfW40u6vLK1hm1OGNWMZmmlQjylYfMHDecxxyN6Ec1PS4W1S/r+tT0KivG7LQLhzf
Q2+kmKwuH0zC2ejzWEbbLo+YfLdmbcq4y525Az0Ga2p9DjsJbu2fRZG8Nxa35kthBZtJG0RtUAKw
qDvQTHJCqfm5xwSKt1/rp/n+Aj0O9uTZ2ctwLee4KLkQwLudz2AGQM/UgepAqZSWQEqVJGSpxke3
FeZa7piXFtoxttJMGgJHcKLO/wBFmvxG5dSjfZ0cOny79pI+QHbhMgVQ1fQtVdLOK+EtwRpUMNpN
Nost5PFOC+4o0c2LeTmP52bBwPn+U4X9fmM9bkkSGN5JHVI0BZmY4CgdST6VTk1ONb2O1hhluJHj
EpMRXaqFgoYksPUnjOQpxzgHGv8AQr2TUYNRkWDVkjVD9jvGZPLdf+WkeCY9+QSNybssf3gXAqvq
dpeXiXN4babe+p2SRx7DuWGKZCSR6bjK2RxjBzjmul0qajzKV/8AO6Xr59BR1aXc6+qj6jDHq8Gm
lX86aCSdWAG0KjICDznOXHb1ribPQZreXTr22sHi1F9TvxLcGIhxE32gpubGdhOwjPGSD3qhbaZM
wxo+j3tjqQ0S5huZngeLfdExfxnAdyQx3huf73HHJzO/9dmdSoR5rc39Xa7+R6hUE97b209tDNJt
kupDHCNpO5gpYjjpwpPPpXntjpajTtSWLT5HimWFbe3tdHl0+NbkMSsgEjMQw+UtJtC4A5YjFTDS
gt/pU2p6S91qFrqzNe3gsjIJd0T7JFIX7mfKHH3CoBPy5oUrv+v6/pC9jFX17/lf89D0OivOdP0q
+XxN5s0ZS9W6uHmlj0qQPLEd+0PdGTY6YKYUAkYUbRtJC6V4UtpIfD0N5owaP+xpWukmt+DcHyP9
YCOX+U9efl9qSk2r2/qzf6A6EU7c34ep6FNNFbQPNPKkUUalnd2CqoHUknoKwvGX/IDtv+wrpv8A
6Ww1i+HdNuNLk0a6XTLgzzaKxvzsxJNOPJ2rIzYy/Lgbj6+lQ6podzp2nR3LC2sbd9T01V0yxZ2g
jP26H5sthcnr8iR8sd2/g10xpxcHKTs1+Ov3/O1vQwqR5XZO5p2/+lfFe8mh+aOz0lLac9NkjyeY
q89crzkZH411tQw2sNvLcSRJte4kEkpyTuYKqZ9vlVRx6VNXNCPLc2xFZVXGy0SS+5a/jf5BRRRV
nOcf47/5EjxL/wBg26/9FtVzR/8AkFw/8C/9CNU/Hf8AyJHiX/sG3X/otquaP/yC4f8AgX/oRqyO
hZubiK0tpbidtkUSl3bBOAOScCq1xrFhalxNPtKIjkBGPDttXoO54qa+tEvrC4tHJVJ42jJHUAjG
axj4cup3kku9QieRlgQeVbFABE+/oXPJ6VpFRfxMym5L4UaC65YNbNOJJdqyeUUMEgk34zt8vbuz
jnp056VbtbqG8gE0DFkJI5UqQRwQQeQR6Hmse+8Mx3slxK8kLvJcrcIs9uJIwRGEIZSRuGMnqMHH
pWnptimnWSW6LCMEsfJhESZJzwo6D8z6k9aGoWunqCc+azWhi/8ACVq4gdLeVEN69tKGgkYlQHwV
woySVHABxnBrQn120/s9Z7WRpHl3LEggkdty8HciqWAB68cfjUMWgyx3UTfbENvDePdonknflg24
Ft2CMvxwOneq8/hSOURuXtZpUlmcfa7QTR7ZG3Ebdw5GBg59eOar92yP3qvY0H1/TYfKWS63M6K4
McTsCG4U8A4yRgZPXjrTm1ywSyS8LzfZ2LDeLaQ7Npw28bcpgg/exVKTw0jHEdwsaiO3jCrCAB5U
hfOBgDOcYAGKr3vhEXkHkvdRshedissG8DzWzlQWwHXoG56nii1PuNuqtkWdS8RpZXV7aCN1kgtR
MszQyyR5O772xThRjrn19Ktza5Y2rxxTyv5jbATHBI6KW4UFgCFzkdSOtVbzQZ7nzdl7Gn2izFpP
mAtnAbDL8w28seDn+tV9T0O82ubGWN45p7eSaJ4/mJRlBKtuAAwoOMHp700qbsribqq7t/X3mwuq
WT+Xtmz5kzW6fKeZFzkdP9k89OKS11ayvZ/JgkctgspaJ1VwOpRiAHHI5UnqKzl8PTC8iJvYzZxX
T3Sw+Qd+XDZBfdjHzH+GnaN4bh0ecOi2ZEaGONorNY5CP9t8kscDttzzkHtNoW3K5ql9tDcooorM
1CiiigAooooAKKKKACvHvDWla8nhbSTHFo/lvZwyIZL6VW2sgIyBAQDg9AT9a9hrxXWPD2rav4E8
P3Ohare2eoQaRa4iiunjjnXylO0gEAN6N+B4wVART+Itvq9t4Ivjdw6Z5LmMMbe8kkcfvFOcNCoP
OB1717XoX/Hhbf7x/wDQjXhXinQ7vQ/hZfR6jql1qN9K0TTSzTu6qfMX5UDHgD16nqewHuuhf8eF
t/vH/wBCNJ7j6HQ0UUVBZz/h7/kOeLP+wrH/AOkVrXQVz/h7/kOeLP8AsKx/+kVrXQUAFFFFABRR
RQAUUUUAFFFFABRRRQAUUVU1O0lvtOmtoLp7WSRcLKnUfkQcHocEHB4KnBDik2k3YCSa8trfzfNn
jVoojM6lhlUGfmx6cHn2ptjdte24mNrPbqwUqJtuSCoOcKTjrjnHIPbBPNLpV3aaRLo/9mW8Ru5k
Sa7tGZhcISBI8m75w5QNyxfkj5yapXOivfeIWS6sJJbN9dMrh4iY2j+whcnjBUt8voTxW1WnGGkX
f+l2v3/AunHmvfSyud07BEZj0AzVbTb+LVNLtNQgV1iuoUmQOAGCsARnGeea4KLTFt4LSLVdFu7r
TYjex28CWzyeTJ9obyiEAO393wr4wo7jPOfPo2oPpumR3Ns6kaPbRWu7SZbqWCYKd2xldRBJnZ8z
YHA5+U45ubfT+tf8joWHjqnI9XqCzvbe/gM1tJ5kYkeMnaR8yMVYc+hUiuNvLCQ6210dOuJNJW4h
+3Q+SSbmcDAmEYBLKp2ZxwcZ/g+bMOjtb+H0tINLSC3h1i4e9hk0p545ELSeU3lJtMygGPG0kDA4
+Xg5tCI0Ytb9vyf47feemUVwGlaG73ukfa7WSe2t7W8kh82zMSRMZYzEAjMxTAzsBO4AdBjAg0fw
la+XoUdzowMcmit9tWWDiSceVsEoI5ZcvtDcjBx0ou7Xt/Wv+Qexh/N+H/BPQlniad4FlQzIoZ4w
w3KDnBI7A4P5GpK4yLS9R1bw9okEunxR3kVjEX1G7Z1mt3KDcEEZWTccYb54+D1bkV11tE8FrFDJ
O87ooVpZAAzkdzgAZroqU4ximnr2/r8tH+ZztWdiWiiisQCiiigAooooAKKKKACiiigAooooAKKK
KACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAK5/xl/yA7b/ALCu
m/8ApbDXQVz/AIy/5Adt/wBhXTf/AEthoA6CiiigAooooA5bxdZ3Go+F9dsbSPzLm5sriGJMgbnZ
GAGTwOSOtZBg8XwHy7GXTI7ZfuLPaNI49csJ1B5z2H9a7R7SRpGYFcEk9ab9jk/vL+dVoRqcZjx1
/wA/Oi/+C9//AJJox46/5+dF/wDBe/8A8k12f2OT+8v50fY5P7y/nQGvY4zHjr/n50X/AMF7/wDy
TRjx1/z86L/4L3/+Sa7P7HJ/eX86Pscn95fzoDXscZjx1/z86L/4L3/+SaMeOv8An50X/wAF7/8A
yTXZ/Y5P7y/nR9jk/vL+dAa9jjMeOv8An50X/wAF7/8AyTRjx1/z86L/AOC9/wD5Jrs/scn95fzo
+xyf3l/OgNexxmPHX/Pzov8A4L3/APkmjHjr/n50X/wXv/8AJNdn9jk/vL+dH2OT+8v50Br2OMx4
6/5+dF/8F7//ACTRjx1/z86L/wCC9/8A5Jrs/scn95fzo+xyf3l/OgNexxmPHX/Pzov/AIL3/wDk
mjHjr/n50X/wXv8A/JNdn9jk/vL+dH2OT+8v50Br2OMx46/5+dF/8F7/APyTRjx1/wA/Oi/+C9//
AJJrs/scn95fzo+xyf3l/OgNexxmPHX/AD86L/4L3/8AkmjHjr/n50X/AMF7/wDyTXZ/Y5P7y/nR
9jk/vL+dAa9jjMeOv+fnRf8AwXv/APJNGPHX/Pzov/gvf/5Jrs/scn95fzo+xyf3l/OgNexxmPHX
/Pzov/gvf/5Jrjofh944gtoLaLxeywwRJDEv9nw/KiqFUfe7ACvZPscn95fzo+xyf3l/Oj5hr2PE
9S+GHi/V7CSxv/FRmtpMb0NhEM4II5Dg9QK9c0iGS3tbeKVdrq3Izn+KtD7HJ/eX86clpIsisSuA
QetAalyiiipLOf8AD3/Ic8Wf9hWP/wBIrWugrn/D3/Ic8Wf9hWP/ANIrWugoAKKKKACiiigAoooo
AKKKKACiiigAooqpqdpLfadNbQXT2ski4WVOo/Ig4PQ4IODwVOCHFJtJuwEkt0kcghQedP8AKTEj
LvClsbyCR8o5/I4yeKnrip9Ju7LSI7IaVAsg1G0me5syz/acTx7pJA2XD4BJ3F8Dq55qnZ6DNby6
de21g8Wovqd+JbgxEOIm+0FNzYzsJ2EZ4yQe9VVSg2o6pf8AANoU1KHM3b/hm/0O2fUYY9Xg00q/
nTQSTqwA2hUZAQec5y47etW68vttMmYY0fR72x1IaJcw3MzwPFvuiYv4zgO5IY7w3P8Ae44nsdLU
adqSxafI8Uywrb29ro8unxrchiVkAkZiGHylpNoXAHLEYrLm/r5s0dCNr3/r9P8AgHoU97b209tD
NJtkupDHCNpO5gpYjjpwpPPpU9eeDSgt/pU2p6S91qFrqzNe3gsjIJd0T7JFIX7mfKHH3CoBPy5p
mn6VfL4m82aMperdXDzSx6VIHliO/aHujJsdMFMKASMKNo2khOVhewjbfp/n/kvvPRqZNNFbQPNP
KkUUalnd2CqoHUknoK890rwpbSQ+HobzRg0f9jStdJNb8G4Pkf6wEcv8p68/L7Vb8O6bcaXJo10u
mXBnm0VjfnZiSaceTtWRmxl+XA3H19K0im5Wf9b/AORMqUUrqX9fedhqN/BpemXWoXJIgtoWmkKj
J2qMnH5U6xuZLyyiuJLSe0eQZME5Qun12My/kTXD614UuD4R19TZ20cc9jIsOj2KvNCsgBKsoYAb
tw3DZGnJOd5waxdc0dv+EhRdP8OpbyWd3ZCGSPSppH8lGjLNFcBhHCgBZTEoJOGJHzEjSpCMZ8sZ
XWn/AAf6Tfcw6X9f0PVoJHljLPBJCQzLtkKkkAkA/KSMHGR3weQDxUledaVoM1xrWnteac5SBtVm
jM8BKJKbtWibkYBxllP4iqvgrRdQi1FDI0lleCxeK/lt9GktmeY7fnkmlkZLhwwYh1VhyxJAbBzS
u9f63/yHJWbPSLm6S3G0DzJ2VmjgVlDy46hdxA9O4HPNT1wt9oV9p/hnXrT+zoLu4ubKRRf2zO89
wdpwsiyMz8ZwuHf6KMCo7rQ2e/1HUf7Oka9XXLRoJvKJdYsW4cocZC43hiOMA56VdWEYz5YO67/P
+t9fQ0hTUo3btv8Ap/mdnd6jDZ3VjbyK5e9mMMZUDAIRn556YQ+vOKt151a6ew13TG/si6j1mO/u
Wu75rZtjKY5hGxlxtccoAMnb0wOlV9C0owJK2o2EsqiweLUbeDRpYmuZCV4eRpCJ3zuw6g9WJZQe
cOfS9jV0I9/6u/6Xc9Gu723sIkluZNiPIkSnaTlnYKo49SQKnrzO80WZtMli1vSZNQv4p7KczfZj
cA2yyKDGpC8so8wMoGW3FsYbAsX2mXk3i2WVoyszXcElnOmkySypCAmVW43qkS8OGRgOrcNuGWn/
AF939fJ9hewjb4v60/A9EpCQoJJAA5JNef2/hqOc6YbnSi5m1q7kvDJB9+L/AEkR+ZkcphlAzx83
vUmj6I2n3GjXMOmyRzrqV5FK4hwy2w8/y0JI4j4j2j7v3cU1cUqMVf3v618/L8Ud1DNFcQpNDIkk
UihkdGBVgeQQR1FPrmbLQ7ttUk1EQwaTFJvL2ds7MZ2b+ObBEYfnnCs3yjEhHFcTJbX954Zt7GPS
tTWey8L3djMHs5E/f4hARSR8+dpwVyDjg1tUpxjLli7/ANP5dFqu5hFXPXKK801fw5cWTa5b6LYf
Z7Wa30+SVUtWeOfE0nnkopXzWKY3KDuYYHOQDv8AgOxeysL7avl2stzvghTTHsIkGxQ3lwyOzKCw
JOQuTkgc5OdtxdjrKK8tu/D1wmhLONOjHna1dSaiLjTHuzND5k/lb4UKvKgLIVAJAyGxgU+DSYre
z0j+3tNudT0NEuvLtv7IkZYpGkUxf6NmR1UJvCbuUBwducUhtWZ6FFqcM2s3Olqsgnt4Ip3YgbSs
hcDHOc/uznj0q7XmWt+HRqEet3K6Neb4dAtxpyTq0kkUy+eRtOWzMvy/MCWG7rzy3UtI1GfxpNNM
mLlry3ksrlNGlnmSELHuVboSLHEuRJuRuuW4bcAatrYHpr/WyPT6pSanDFrNvpbLJ588Ek6sANoV
GRSDznOZBjj1rgRoMUGmw3V/o0k9rLrN1JqcIs2lkni8yYQlowC0iAshC4bqGAwM1bPh/TdW1LR4
xoFwmjR6fehLW8gOxSZYigZGztBwWVGwVwPlXbgT/X4XHbW39bnoFFeO3uj6tc2GljUIZWc6LbRW
zTaPPezwXIDbyjrIn2eXJQ73xkgfN8px6D4sWX/hD5onsn1BnEUcsYjd8gsoZmjjO51AyxRT8wBX
oacla5PVI6GivJtG0rVNMhv9S03TGjmS9MdrDb6c1nG8U8MaFlhdiUUSKjtzkbGJA6VHrGhyRa5F
BY6GVmsLqySK5/syaaaSJGjLSJc7gkS8sDGASSGJHzEgS1S9P6+X9bMOn9f1/Xoeu0V5vp/h2W2u
9L1CDTnh1J9Y1DzrkwkOIW+0lNxxnyydhAPBJBHJpmm6cq+Gry20nRL+z8TnSpIrq8a3eASXGBnd
KxUTOWyVcFsc/Mu7lDas7f1vY9Ctrs3Mtwv2W4iWGTyw8qhRLwMsvOcZ4yQM44yOas15LDot/wD2
Jq39lwrDbSfZfOtofD81lC4WTMv7h5d8rFOG2gbxhcseBueH9AvJ/D9/bWl7Jp8Mt2JIEi02bT4V
ARQyrD5olRS2Tw0eWBOCpO66cYydpOy/r+kI7K81O2sra5mZxIbfG+KMgvuONq4z1ORjOOtWIZGl
j3PC8J3EbXKk4BIB+UkYPUd8HnB4rnILG4WHTNK/si306CO586ZbM7oGVMuNpCqQTJsJDAZw33ut
Ytn4f+3X9rHqeltNbKmqEpPASm5rpWTIIxyPmX6ZHSqrwjTSUdd/u+V+zNKcFK93b+n/AJHbanqE
Wk6VdahOrtDbRNK6xgFiFGTjJHNWgcgH1ryq/wBNml8MtHqui397fSaFDHYuLZ5XilEZEi5APltk
qTnG4cc4xWlf6XfS+LZZZEIuDdwSWlwmlSTSrCAmQtyJFSNeJAyN1y3DbhnFv3rGzoRtv3/T/g6n
obMFUseABk1DZ3cF/ZQXls/mW88ayxvgjcrDIODyODXFR6WJNWLT6TK+h3E0yWtrJAWEMzLhpXjK
/Kj/ALwDPC7sn7/y5Q0p/wDhHPDcL6asdjBZPFcW9zos10FufkyxhQq244kxJgjk8/NzKnpf+v6/
zXcSoRel/wCtfxPUaK81u9AuptM1drqzubu8j8Pww28s0GZDKVmDBcFvnwVBwxPPJOan1fwxDE3i
E2ek/wCr02KazEcGR9q/e5kQY5l4TLD5ulVrcPYR25v608/P8Gd/HPFM0ixyo7RNskCsCUbAOD6H
BBx7isPxl/yA7b/sK6b/AOlsNRapo93q2prLDbQae8IVf7T3t9pdRyUUIR8mTn52K7l5jYYNSeMR
jQrUEkkarpvJ7/6bBW1SEYpNPV9O39fecqZ0NFFFZDCiiigAooooAKKKKACiiigAooooAKKKKACi
iigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKAOf8Pf8hzxZ/wBhWP8A9IrWugrn/D3/
ACHPFn/YVj/9IrWugoAKKKKACiiigAooooAKKKKACiiigAooqpqdpLfadNbQXT2ski4WVOo/Ig4P
Q4IODwVOCHFJtJuwEk15bW/m+bPGrRRGZ1LDKoM/Nj04PPtTbG7a9txMbWe3VgpUTbckFQc4UnHX
HOOQe2CeaXSru00iXR/7Mt4jdzIk13aMzC4QkCR5N3zhygbli/JHzk1SudFe+8Qsl1YSS2b66ZXD
xExtH9hC5PGCpb5fQnitqtOMNIu/9Ltfv+BdOPNe+llc7p2CIzHoBmq2m38WqaXaahArrFdQpMgc
AMFYAjOM881wUWmLbwWkWq6Ld3WmxG9jt4Etnk8mT7Q3lEIAdv7vhXxhR3Gec+fRtQfTdMjubZ1I
0e2itd2ky3UsEwU7tjK6iCTOz5mwOBz8pxzc2+n9a/5HQsPHVOR6vUFne29/AZraTzIxI8ZO0j5k
Yqw59CpFcbeWEh1tro6dcSaStxD9uh8kk3M4GBMIwCWVTszjg4z/AAfNmHR2t/D6WkGlpBbw6xcP
ewyaU88ciFpPKbyk2mZQDHjaSBgcfLwc2hEaMWt+35P8dvvPTKK4DStDd73SPtdrJPbW9reSQ+bZ
mJImMsZiARmYpgZ2AncAOgxgQaP4StfL0KO50YGOTRW+2rLBxJOPK2CUEcsuX2huRg46UXdr2/rX
/IPYw/m/D/gnoSzxNO8CyoZkUM8YYblBzgkdgcH8jUlcZFpeo6t4e0SCXT4o7yKxiL6jds6zW7lB
uCCMrJuOMN88fB6tyK662ieC1ihkned0UK0sgAZyO5wAM10VKcYxTT17f1+Wj/M52rOxLRRRWIBR
RRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFF
FABRRRQAUUUUAFc/4y/5Adt/2FdN/wDS2Gugrn/GX/IDtv8AsK6b/wClsNAHQUUUUAFFFFABRRRQ
AUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAc/4e/5
Dniz/sKx/wDpFa10Fc/4e/5Dniz/ALCsf/pFa10FABRRRQAUUUUAFFFFABRRRQAU2SRIY3kkdUjQ
FmZjgKB1JPpTq5vVdDuptYTUvLt9UgQqVsbt2UQsP44+TGWGONybssf3ijArWlCM5Wk7f1/W4F+/
8QWenzwROsspm8vDRAFV8yRY0JOR1LZ+in8dWuM1my1C/try6ihlS4l1KyjgDRFjHFFKh3Fe4DGR
sg4xjnHNZ1/plymmJatY7vI1Fm1GWfT5Ltb0FG2StGpBlGSmQMhCOmEGIq2i7L+tF+VzanTU4p3P
RKK8/iiufD+j6dqsaSSSK01osTW5g/dyufJURlmZVEgjChjlVc5C4xRf+G7u1aPSrON5IJ7VJpJi
hI+0QqxDMRxuZzEccZ2Gs+b+vx/L/IfsVf4v6R6BRXnr2KTfYdQ13R7m7srsXU8tt9iacxTOyeVv
iVSdwjUqGI+U56ZqOLQtUktbuW4s5pNUh0O1ihkc5cS/vRIqSf8APTaQCwPcc80XdrjVBWvzf1e3
f7zu4tRhl1a505VcTW8MczsQNpDlwMc5z8hzx6VO88UUkUckqI8rFY1ZgC5wTgDucAn8DXna6ZYz
f24dO0a/sdOktrLEa6a6q7LJIWHkMFLoMjeo5YZxnIJ09HspH8OXdkvhyyuLeW7PlwTQPZ2zrtUl
zDKHaIbgRgKcsN2AGJrSmlKfK/6+8VSkoq6fb8l/VjtaKzND0250uxMFzfPduXLAneQg/uqXZ3x/
vMevGBgDTomlGTUXddzAKKKKkAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAoo
ooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigArn/GX/ACA7b/sK6b/6Ww10Fc/4y/5A
dt/2FdN/9LYaAOgooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACii
igAooooAKKKKACiiigAooooA5/w9/wAhzxZ/2FY//SK1roK5/wAPf8hzxZ/2FY//AEita6CgAooo
oAKKKKACiiigAqCa8trfzfNnjVoojM6lhlUGfmx6cHn2qPU7SW+06a2guntZJFwsqdR+RBwehwQc
HgqcEc4ulXdppEuj/wBmW8Ru5kSa7tGZhcISBI8m75w5QNyxfkj5ya6KNKE1eUtb7eXf/hhN21Op
tZxdWkNwI3jEqK+yQAMuRnBx3qWuA1Hw8Lm81a8bTpGuW1q18mYRHeISsCyFGxkKRvDEcYBz0qHU
dHuIIbq1t7COLSIdX3/Zjpz3EJiNuuCIEKl180k4XOG5xwcczl1t/Wn+f4HTGhF2978DvmvbdL+K
xaTFzLG8qJtPKqVDHPTgsv51PXn2jaR9i1rRLyfT5Z9tteRwzHT2j8nMitGuCXaJdvmBd5GAccZx
WNZ6bqTzSz6dpElnJNplwsqQ2M1tJ5paNhHJNI2ZnxuAkwASSQeeJ5tvn+v9f8Oivq8W9Jf1dnok
osNR8QfZpY52udOjjuFzIwi/eFwp2hsMw2H7w44Iq/Pe29tPbQzSbZLqQxwjaTuYKWI46cKTz6V5
6bW1RNcfSvDd1Fp89tZReQ9jNEhPmSb28oBWcKCCyD73PZsmtpmjeXf2dxc6LutYda8yIRaU8SRx
vbYDpCdzIvmBSfQjJxjhp62G6MXdt7L9L/n0PUSQoJJAA5JNNhmiuIUmhkSSKRQyOjAqwPIII6iv
OoLS4k8bWl9Fo7W8i6jN9ocWEol2bJFBa5ZtsiMdpCqMLlRkYGek03RbsaydU8mDSYnLNJZ2rljc
M3O+XBEYf1wrNlRiQjitqMYzg5Sdrf16/P7zCtD2bSTv/X9ep0lFFFZmYUUUUAFFFFABRRRQAUUU
UAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQ
AUUUUAFFFFABXP8AjL/kB23/AGFdN/8AS2Gugrn/ABl/yA7b/sK6b/6Ww0AdBRRRQAUUUUAFFFFA
BRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQBz/AIe/
5Dniz/sKx/8ApFa10Fc/4e/5Dniz/sKx/wDpFa10FABRRRQAUUUUANkkSGN5JHVI0BZmY4CgdST6
VXW/he/SzTc7tD5+9cFQuQBk5784/wB01i6rod1NrCal5dvqkCFStjduyiFh/HHyYywxxuTdlj+8
UYFZHieGSfS9Qvbq2nIm1GygjhAKuYkmTge5dpMEdQRzXQ6cFDmTv/m2lbvpv8hxjzSUe53dI7BE
Zj0AzXn0Wiw3uo2ccGkSx6C2p70tZbRo4wotnDExMBsQyY4IAJ5xzkutNPddahKaZcpq639zJeXp
t2CyWxEmwebja64MQCAkrgcDaa5HJ2N/Yx7/ANa+fl97R22m38WqaXaahArrFdQpMgcAMFYAjOM8
81ary59LlGiWsV9pF5Pef2Fbw6YVtnc210FbdyAfIfcYyXbb0HPymp9btEju5m1DT531VtVs2gvR
CxUweZENokxtAzu/d5zn5sd6tv3rLv8Arb/glPDq9k/608/6Z6NDPFcR+ZDKkqbiu5GDDIOCMjuC
CD9Kkrmm0a7vNf8A7Rjgh0lUkBkmhcm4vAOAJApCY443+adrcCNq6WtasIxtyu/6fo/60RyBRRRW
QwooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKA
CiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAK5/xl/wAgO2/7Cum/+lsNdBXP+Mv+QHbf
9hXTf/S2GgDoKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooA
KKKKACiiigAooooAKKKKAOf8Pf8AIc8Wf9hWP/0ita6CsO58JaVdX9zes2pQz3Th5vsuqXMCuwRU
BKxyKudqKM47Co/+EN0v/n61z/we3v8A8eoA6Ciuf/4Q3S/+frXP/B7e/wDx6j/hDdL/AOfrXP8A
we3v/wAeoA6Ciuf/AOEN0v8A5+tc/wDB7e//AB6j/hDdL/5+tc/8Ht7/APHqAOgqC7sre/iSK5j3
okiSqNxGGRgynj0IBrG/4Q3S/wDn61z/AMHt7/8AHqP+EN0v/n61z/we3v8A8eoBO2x0FFc//wAI
bpf/AD9a5/4Pb3/49R/whul/8/Wuf+D29/8Aj1AHQVlt4d0t9UOotBJ55kEpUTyCJpAMBzHu2FgA
PmIzwPQVT/4Q3S/+frXP/B7e/wDx6j/hDdL/AOfrXP8Awe3v/wAeoGpNbM6Ciuf/AOEN0v8A5+tc
/wDB7e//AB6j/hDdL/5+tc/8Ht7/APHqBHQUVz//AAhul/8AP1rn/g9vf/j1H/CG6X/z9a5/4Pb3
/wCPUAdBRXP/APCG6X/z9a5/4Pb3/wCPUf8ACG6X/wA/Wuf+D29/+PUAdBRXP/8ACG6X/wA/Wuf+
D29/+PUf8Ibpf/P1rn/g9vf/AI9QB0FFc/8A8Ibpf/P1rn/g9vf/AI9R/wAIbpf/AD9a5/4Pb3/4
9QB0FFc//wAIbpf/AD9a5/4Pb3/49R/whul/8/Wuf+D29/8Aj1AHQUVz/wDwhul/8/Wuf+D29/8A
j1H/AAhul/8AP1rn/g9vf/j1AHQUVz//AAhul/8AP1rn/g9vf/j1H/CG6X/z9a5/4Pb3/wCPUAdB
RXP/APCG6X/z9a5/4Pb3/wCPUf8ACG6X/wA/Wuf+D29/+PUAdBRXP/8ACG6X/wA/Wuf+D29/+PUf
8Ibpf/P1rn/g9vf/AI9QB0FFc/8A8Ibpf/P1rn/g9vf/AI9R/wAIbpf/AD9a5/4Pb3/49QB0FFc/
/wAIbpf/AD9a5/4Pb3/49R/whul/8/Wuf+D29/8Aj1AHQUVz/wDwhul/8/Wuf+D29/8Aj1H/AAhu
l/8AP1rn/g9vf/j1AHQUVz//AAhul/8AP1rn/g9vf/j1H/CG6X/z9a5/4Pb3/wCPUAdBRXP/APCG
6X/z9a5/4Pb3/wCPUf8ACG6X/wA/Wuf+D29/+PUAdBRXP/8ACG6X/wA/Wuf+D29/+PUf8Ibpf/P1
rn/g9vf/AI9QB0FFc/8A8Ibpf/P1rn/g9vf/AI9R/wAIbpf/AD9a5/4Pb3/49QB0FFc//wAIbpf/
AD9a5/4Pb3/49R/whul/8/Wuf+D29/8Aj1AHQUVz/wDwhul/8/Wuf+D29/8Aj1H/AAhul/8AP1rn
/g9vf/j1AHQUVz//AAhul/8AP1rn/g9vf/j1H/CG6X/z9a5/4Pb3/wCPUAdBRXP/APCG6X/z9a5/
4Pb3/wCPUf8ACG6X/wA/Wuf+D29/+PUAdBRXP/8ACG6X/wA/Wuf+D29/+PUf8Ibpf/P1rn/g9vf/
AI9QB0FFc/8A8Ibpf/P1rn/g9vf/AI9R/wAIbpf/AD9a5/4Pb3/49QB0FFc//wAIbpf/AD9a5/4P
b3/49R/whul/8/Wuf+D29/8Aj1AHQVz/AIy/5Adt/wBhXTf/AEtho/4Q3S/+frXP/B7e/wDx6geD
NI82GSR9Vm8mVJkSfWLuVN6MHUlGlKnDKDyD0oA6CiiigAooooAKKKKACiiigAooooAKKKKACiii
gAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigD//2aBGHfAKGgEA7RdMnOsaYv8w
AWqo3hmEnv//2P/gABBKRklGAAEBAQBgAGAAAP/bAEMACAYGBwYFCAcHBwkJCAoMFA0MCwsMGRIT
DxQdGh8eHRocHCAkLicgIiwjHBwoNyksMDE0NDQfJzk9ODI8LjM0Mv/bAEMBCQkJDAsMGA0NGDIh
HCEyMjIyMjIyMjIyMjIyMjIyMjIyMjIyMjIyMjIyMjIyMjIyMjIyMjIyMjIyMjIyMjIyMv/AABEI
AccCmgMBIgACEQEDEQH/xAAfAAABBQEBAQEBAQAAAAAAAAAAAQIDBAUGBwgJCgv/xAC1EAACAQMD
AgQDBQUEBAAAAX0BAgMABBEFEiExQQYTUWEHInEUMoGRoQgjQrHBFVLR8CQzYnKCCQoWFxgZGiUm
JygpKjQ1Njc4OTpDREVGR0hJSlNUVVZXWFlaY2RlZmdoaWpzdHV2d3h5eoOEhYaHiImKkpOUlZaX
mJmaoqOkpaanqKmqsrO0tba3uLm6wsPExcbHyMnK0tPU1dbX2Nna4eLj5OXm5+jp6vHy8/T19vf4
+fr/xAAfAQADAQEBAQEBAQEBAAAAAAAAAQIDBAUGBwgJCgv/xAC1EQACAQIEBAMEBwUEBAABAncA
AQIDEQQFITEGEkFRB2FxEyIygQgUQpGhscEJIzNS8BVictEKFiQ04SXxFxgZGiYnKCkqNTY3ODk6
Q0RFRkdISUpTVFVWV1hZWmNkZWZnaGlqc3R1dnd4eXqCg4SFhoeIiYqSk5SVlpeYmZqio6Slpqeo
qaqys7S1tre4ubrCw8TFxsfIycrS09TV1tfY2dri4+Tl5ufo6ery8/T19vf4+fr/2gAMAwEAAhED
EQA/AOjzTgaZmlBr6Q8AdS03NLmgY6jNJmremWhvtQhg6Kxy59FHJ/Spk1FXYJNuyK7IyHDKVOAc
EY4PSphaTmzN2Iz5AfYXyOtamuNHeww6lAgVCzQtjttPy/mtMntrf/hHEubea65mCPHIw2btvJAF
ZKreKe13Y0dK0mvIx6murSeykEdwmxyoYDIPB+lajadp1jBENRnuPtMqh9kAGIwemc1a1ixa/wDE
EcCOFQW6s8hHCqM5NL2y5l21/AaovlffT8TmulFbkOnaVqEjW1jcXQuQCUMwXY5HYY5GfesQgqxU
8EcGtIzUtCJQcVcSlBrVjsLG1s4bjU5ZwZxujigA3bf7xJ4qRtGtze2BhmkeyvGwrHAdfUHtmp9r
EfspWuZAc015MVvx6TpMl++mi6uvtYLKJNoEe4dsdf8AGucuEaKR4n+8hKn6inCcZvQJQlFakxtb
g2RvfL/0cPs35H3vTHWhbSdrM3gjP2cPsL5H3v51og/8UK3/AF+f0pk9vbDwvHd2013zOEkikYbN
+3kgD+dT7R/jYv2a09L/AJmctDGtv+y9Ms5reyv7q4F7MoJMYXZGT0B7/wCe1OGjWs2ralbGSS3j
tY96sfmx0ySO4xzil7aI/ZSOeOKTANbT6fpl5ptzc6bLc+ZbYZ0nC/MvqMUyHT7G1s4bjU5Zw043
RRW4G4L/AHiTxVKqreZPsmZiIDU4j4q9f6fFapb3NrK0lrcAlCwwykdQardqanzK6BwtoyApzUTD
FWWNQvyatMlorPmoTVoqDTfLBqrisVqSrJgFRtFinzCsRUlPKkUw1QCZpKUiigLCUGikNMBKQ0tI
aYhDQaKKAEpKXvQaBDaTFLSUAJRRRQAUGiimMKTNLSUAKHanbzTBTiKVgJEc1KHqsnWpaTQXLSMM
VMlUlciplmwahxKTLgoNQLMPWpA4NRZl3FJprdKUkGmtQBG1Rt0p5phqkSPtYvOuY4/7zYP0rrQM
DA6VgaLFvu2kIyEX9T/k1v1zV3eVjWmtLhRRRWBoFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAY2ua
4dJeFEiWRnBJBOMCqEXjOIgebZuvrscH/CsjX5Xv9ekjiBfZiNQOenX9c1Wg095pPLgja6kH3hH9
xf8AgXevArY3Ee2kqT0vbY45VZ8z5Tq4/FmmuPnMsZ90z/KrkevaXIMi8jH+9lf51wtxD9lJRpLf
zBwUjG/B9yeP1qFJXZ1ULGSSBjyx/hQs0rQdpJf18w+sTWjPUFZXUMpDKRkEHgilpkMYhgjiAACK
FAHsKja7iVipYZBwa99JtHZ6nOZpabS5r0TjHUoNMzTqQD810GkeXp2k3WpTxGQSnyETdt3A/e5/
z0rnQacDUVIc6sVCXK7nT2U9nqlhd6ba2P2ZinnIDKXywx69Kqg48Hg+l5/7LWHRWfsbPR9bl+1b
Wq7r7zp9V06fWZY9QsNs0TxgON4BjIHIOauTXcdj4mAklWNZLURiXsp7H6cVxtJUfV7rlb0RXtrP
mS10/A62Z/E9uksklxGIYwW8z93hh7cZ5rlWYuxZjlick0ylzWlOnydvkrEVJ8/f5u510V5qV5pd
odHnTfEgjmgwm4EdG+bt/n1qqJ9UOvafb6lMrsrhwi7flz67e9c1RULDpX2+7X7ynWbXX79PuOgt
f+R3b/r4f+tYeq/8hS7/AOuz/wAzUdRSVpCnyyvfpYmVTmTVutzdsojfeD7m1t2Vp4Z/OaMsAdmB
zUJ/5EYf9f3/ALLWCaSq9jrv1uCqaLTo0d8LA3xstRuLCee6SJGDW8sYjkI5XO4g/X+tZ+nyXMuo
a+95EYpzavuT+7xx+mKyoZfDpWJ5rfUI5VA3JG6srEd8nB59se1U9W1JtV1B7pkEe4AKgOcAe/eu
eNGTbj0/LX1NnVSSfXT5/ganh4n+ytb/AOvb+hrWgvtUvtJs20W4TzIYxHPb/JuBHRvm7f59a4ik
xW08OpScv08rGcKzirHR6vdaoJYrfU5lZ1G8Iu35c+u3vVIPkCs6M1ZDHFUqairEynzO5OTULnmk
LGo2fmmkTcWnrUQYZ61IrChlIcTTGpxNRsaENjHqMKDTmPNC1RIvl56UeQTUqipVFLmKSKTQEdqj
KEVosBioGA9KakJxKRFNNTuvNM2VaZFiKipfLNIYmp3QWIqKeYyO1JtxRcVhlIacaTFMBlFLikxT
AKKTFFAC0lFFACgU9hxTR1p7fdpARrwalFQ55qZTxQAopaaKcDQAucU4SEd6ZRSsBMJiKf52arUm
Tmk4lXLJkBFN3ZqDJ9aUbiQByTS5RXOm0aLZZmQjmRs/gP8AJrRqOCIQ28cY/hUCpK8+Tu2zqSsr
BRRRUjCiiigAooooAKKKKACiiigAooooAKiuJlt7aWZ/uxqWP4CpaiubeO7t3gmBMbjDAHFKV7Pl
3B7aHF6RaPfwzOHxLcTiKRx1VCCzY+uMVq+IZBpGkxWtkvkrISpK+gHPPqa0dP0WLTLhpLaaTy3H
zRvgj2IPaptT06PUrXynwGU7kYjIB9/avNp4SccO4rSf9fmYKm1Brqea1oaHB9o1q1TGQH3H8Of6
VZvNBe2Y7mMI9ZASh/4EBx+IFaPhfTXiv5LhpIXVUwDHIG5P06V5NDC1PbxjJdTmhTlzpM608DNc
bNcyvPI4kbDMSOfeuqvpPJsZn7hSB9TxXIYr7PDrdnXUZfhikuJkhiQvI5wFFaH/AAj+qf8APr/5
EX/GtfwpDH9imn2DzTIU3d9uAcfrXQVzVsXKE3GK2NaWGjKN2ziP+Ef1T/n2/wDIi/40o0DU/wDn
2/8AIi/41uxX+oX+p3cdn9mjtbOZYZPNRmaVsAtgggLgEY4OT6VOmvabJd/ZluCXLMit5ThGZeqq
+NpIweAc8H0rnWYy8v6+Z0PAJd/6+Rzn9g6n/wA+3/kRf8aX+wtT/wCfb/yIv+NbJ8VaZJYT3Vs8
0vlwNcKhgkTzFHddy8jOMkZxnmpo/EFk1hbXMgnQ3Cb1iW3kZ8AcnaF3bRn72Mcj1FH9pPy/r5h/
Z7XRmD/YWpf8+3/j6/40f2FqX/Pt/wCPr/jW5J4n0iMqDdMwaJZ98cMjqsZOAzMFIUcHqRirL6zY
RictcYEEqQyfIxw742jpzncORxzT/tCT7f18xPA+T/r5HN/2HqX/AD7/APj6/wCNV7rT7qzVWuIS
iscA5BGfwruqZNDHPE0UqhkYYINVHGzvqtDN4SNtGcPaWNzfOUtoWkZRk44x+dXP+Ed1b/nzb/vp
f8a7XSbW2s7UQwLgj7xPU+9aFE8dLm91aFQwcbe89Tzr/hHdW/582/76X/Gj/hHdW/582/76X/Gv
Ra5TW/El3p+tz2cNxp6eVbRzRW0yEy3bszDy0IcYPygD5W5NZSzGcbXS/r5mkMvjN2TZi/8ACO6t
/wA+bf8AfS/41G/hvVyOLJv++l/xruZNbsIbwWksjrLlVYiJyiM2MKzgbVJyMAkHkeoo/tmze6kt
YnkeZNwLCFzHuAyV8zG3I9M54NP+0pLt/XzD+z15nAHwxrOf+PFv++1/xo/4RjWf+fFv++1/xrsN
D8U2epaZby3MoguTai5lDxPEm0AbmVmGGUZ6gnFWh4k0sW8k8k8kKRlAwnt5ImG87VO1lBwTxnGO
Dzwaf9pz8v6+Y3lyTtr/AF8jhf8AhGNZ/wCfFv8Avtf8aT/hF9a/58W/77X/ABrvpNesIhDva4DS
rvCC1lLqucbnULlB7sAOKpQeJoF1e/sb0mPyrpIIXWFyh3IhAZ8FQSWIGSO1H9pzvbT+vmCy5NX1
OO/4RfWv+fFv++1/xo/4RjWv+fFv++1/xr0CPWrCW++xpK/m7zGGMLiNnHVRIRtLDB4BzwfQ1oU1
mNR7Jf18yHgYre55kvhnWR1sW/76X/GmXemXtgqm6gaMNwCSD/KvUKgu7SG9t2hmQMjDHNNY+d/e
SsJ4ONtGeVE1A55rY1rR5tJnIOWgY/I/9D7/AM/5YrnmvUhJTXNHY4JRcXZjSxFKJSKYetJmrsJE
/nGjzc1BRRYdyYtmnrVYE5p6vilYLl1ak7VWSUVMsgNQ0WmK1QvUjOKiY8UITIm60gHNKetOQVZI
9VFSBBSKKlFQ2UkRtGDULwirJqJqE2DRUeMComSrT1Ca0TIaINtNIqyFzTvKBFPmFYp0lXPs9MNu
afMg5StSd6maEioyhFO4rCipO1RgGpR0oYEBGDUiHimuMUIaAJKUUnaikA7PFJSU4UxhSGlptABV
7SofO1GIHop3n8Ko1veH4SFlmPf5RWdWXLBsqCvI26x7/wAU6NpupDTrq823hTzBCkTu231woPpW
xXlGjXN7qHxb8SatZ2AvRZoLRVMwjCHgZBI/2G/M15k5WtY7Ixve53jeLdESS0jkvTHJeS+VbpJD
IrSNwMAFc/xDnpzWldahaWUkEdzMsb3DFIgf4iFLH8gpP4V51fs+t/GrRreSPaNNsvtEsYO7Y5BO
M9+WTmrnxD1D7PcTyc/8S/SZ5gR2kmIhQ/lvqed2bHyapG8nj7ww8CTjVVEDv5azNFIsZb03FcZ/
GtHU/EGmaQ8Md3c/v5/9TBEhkkl/3VUEmvHI7Oe78IeFPCFxbPp0GpTG4N7LtYS5JIChSSCQ4+9j
tXTfDFBrPiLXvEU+XMcgsrTdz5ca9h+Gz9fWpjUk3YpwSVzu9N8R6XqouhbXBElp/wAfEU0bRyRf
7ysAR0qinj3wzJDHONUUQSP5aTNFIsZb03FcZ/GvNfEOqNF468a6hbkrFb6V9ldh0MjeWgz75J/7
5qaDw9q2ufDzQfDVjps1vC0guru9uAqoFOWG0Zy33vTsPXg9pLZB7Nbs9KuvGOg2d7c2c1/i4tV3
zokTv5a4BySqkAcjmnT+L/D9tpltqUuqQ/ZLptkMqgsHb0AAJzXkOi6tc2Wl+Mtet7Ca4iupPsiX
W9dkK8jLDO44DJ0BqafR/sGq+CPDdkw1F4t2pOA2xZSx3jk9BhD/AJNL2rH7NHrQ8VaN5M0z3bQx
QpvkknhkiUDOOrKATz060tj4o0nUL4WUU8iXLReckc8LxF4/7y7gMiuW8faPr3ijw1Altax295bX
Qn+xtOr+coBwc8DOT0NZFnfxfEB9StL6wfS/FVlZSW6u0jCMBsqeO33sYOeDwTVObTsSoJq53C+N
dAeSMLesYpZvIS48l/JaT+6JMbSfxqSXxhoUWoXFgb4vdW5xLHFDJIUPvtU15not6bYad4C8baI0
USSB7WdJCqsQWIJwcEcnkH6jvV/4ZXOpTy67rlvpgu11G+OZTcLHtAJOMEc/f/SkqjbSG6aSbPTh
qdn/AGYdRecRWgUuZZgYwoHc7sEfjVO28TaXdXVvbrLLG9yCbczwPEs2OflLAAnHOK57xaW1bxp4
c8OvzZsz310h6SCMfIp9RuHT6VreMEsF0n7ddt++0wtf2yB9paSNTj6jnmr5nr5EWWnmXrvxDp9p
ePZ75Z7qNQ0kNtC8zID0LBQcfjUc3irQ4NFTWJdRiXT3bYs2D97JGMYyDweMdqzvh9Ym18HWd1MS
93qAN7cyt96R5PmyfwIH4V55a2517R/ECKubSe41LUoB2+VQiEf8Cdv++TSc2kn3Gops9olmhjtn
nkdVhVC7OTwFAyT9MVS0bUNL1az+36TJHLBIxXzUQruI47gVxuo64LzwJb4OYotJS9vD6/J+7j+r
OOfZT610XgXT/wCzPBGkWxXa32dZGB/vP8x/VqaleRLjZXZe1yXZZBB1dh+lc3zWxr8uZooh0Vcn
8ax69GirQOab1O68K/8AILl/67H/ANBWtyqmn6fFptu0MLOys24lyCc4A7D2q3Xi1pKc3JHo04uM
UmZA0m7t9Rubiwv0hhupFlmikg8w7gACUO4bcgAHIPTNVovDTxvBE18Gsra4e5hiEOHDtu+8+7BA
3txtB6c8V0FFc/sos6PbT7/1sc9H4WVbWyt3uyy21jLZkiPBcOFG7rxjb0561DP4UkuVsnuLiyuL
i1hMAM9j5kTJxg7C/DDH3gfwrp6KTpQfQaxFRdTAl8LxtFexRTrElzYLZhVhACY3fNgYHO7oAKhu
PC9xJNMItSjS2nnhnkja23MWjC8Bt4wDsHY10tFP2UO39av9WCr1F1/rT/JBRRRWhkTW3/Hwv4/y
rQrKVijBlOCKl+0zf3/0FS1cadjQrHvNAS8vb25a4ZGuIIo02r80TxszK4Prlhxjt71Y+0zf3/0F
H2mb+/8AoKlwvuXGo47GV/wiUbaub+U2ErSSJNK0mnq0u9QAdjknYp2jghiMnBHGL1npN1YzTRRX
kX2CSSSUQmA+YGcknL7sEbiTjaD0GfWf7TN/f/QUfaZv7/6Cp9lFbFOvJqzMv/hEYpLGzs5rovHb
6dJYttjwXDbPmGScY2dOetMh8IRpZvCW0+J2lgkLWenrApEbh8EBiSTjGc4HGB1zr/aZv7/6Cj7T
N/f/AEFP2Svcf1idrXIrrS7o6q1/YXkVvJLEsMwlgMuVUkqVwy7T8zdcjpxxzBP4d8/7b/pWPtV7
Dd/6vO3y/L+Xrzny+vv04q59pm/v/oKPtM39/wDQUezQlWkjNsPClvYaubxFsSgmeZG+wp9oy2SQ
ZcnIBY4wAeAMnnPRVn/aZv7/AOgo+0zf3/0FONNRVkKdVzd5GhRWf9pm/v8A6Cj7TN/f/QU7EcyK
fi3/AJF6c99y/wDoQrzRq9Qu1F/bNb3I3xNglenT6VmHw5pJ/wCXT/yI/wDjXfhcRClDll3OSvRl
UldHn9Fd/wD8I3pP/Pp/5Ef/ABqaPwlpkiBharg+sr/411fX6XZ/18zH6rPyPOqK9H/4Q/Tf+fZf
+/r/AONH/CH6b/z7L/39f/Gl/aFLs/6+YfVKh5xRXo//AAh2m/8APsv/AH9f/Gj/AIQ/Tf8An2X/
AL+v/jR/aFLs/wCvmP6pUPOM470ocjvXo3/CHab/AM+y/wDf1/8AGj/hDtN/59l/7+v/AI0fX6XZ
/wBfMPqlQ87800vmZr0P/hDtN/59l/7+v/jR/wAIfpv/AD7L/wB/X/xpfX6XZ/18w+q1DzvdzUqm
u/8A+EP03/n2X/v6/wDjSjwjpw6Wy/8Af1/8aHj6XZ/18w+q1DhkqUV2w8KWA6W6/wDfx/8AGnf8
ItZD/lgv/fx/8an67T8ylhpnDGoXrv8A/hFrL/ngv/fx/wDGmnwpYH/l3X/v4/8AjQsbT8weGmzz
tqi716QfCOnHrbL/AN/H/wAaT/hD9N/59l/7+v8A41Sx9Ls/6+ZP1SoedLUyiu//AOEQ04f8uy/9
/X/xp3/CJ6eP+Xdf+/j/AONJ4+n2Y1hZnBDFBrvv+EUsP+fdf+/j/wCNJ/wilh/z7r/38f8AxpfX
qfmP6rM8+ZRioHUV6R/widgf+Xdf+/j/AONNPhDTj1tl/wC/r/401j6fmJ4WZ5oVGakC5Fejf8Id
pv8Az7L/AN/X/wAaUeENOHS2X/v6/wDjVf2hT7P+vmT9UmeZyRn0qMKQeleoHwhpx62yf9/X/wAa
T/hDtM/59U/7+v8A401mNPs/6+YfU5nmoBx0o59K9L/4RDTv+fZP+/j/AONH/CH6af8Al2T/AL+v
/jS/tCl2f9fMPqczzTtQK9K/4Q7TP+fVP+/r/wCNH/CHaZ/z6p/39f8Axp/2jS7P+vmH1Op5Hmxp
DXpX/CHaZ/z6p/39f/Gj/hDtM/59V/7+v/jR/aNLs/6+YfU6h5r2rrdNh8iwiXHJG4/U1ujwdpoO
fsqf9/X/AMaujRYgMBEx/vGsquNpzVlcuGFnHcwK4fw34O1vwuL/AOyapp0z3s5nkkntHLZ9OJBx
yfzNesf2LH/dX/vo0f2LH/dX/vo1zOtBu5qqU1oeYXXhPUYfGLeJtKv7aO6ntxb3MNzCzIwGOVww
I+6vHtUGu+A7nXNEvLaXVQL+/mjkurnyflKJnbGqbuFGc9TzknrXq39ix/3V/wC+jR/Ysf8AdX/v
o0va0x+zqHm+r+EP7Rv/AA3PDdLDFosm4RmPPmAbQB14+7+tVNM8Jar4bm1KPQL+zSzvpjOqXULM
1u54O3BAYfXHQda9T/sWP+6v/fRo/sWP+6v/AH0aPa073D2c7WPH774YxzeFZdItdRZbm7ulub29
mj3PORk9ARjk5A/xrtJbIjR3sLZ/KP2cwxvjOz5cA49q6z+xY/7q/wDfRo/sWP8Aur/30aarU1sg
dKb3PJ7T4fGz+HNz4WS+Qy3BLNc+VgZLA/dz6ADrUdt4F1Ow8S2+tW2qWjywWUdnHHcWzMAFQKTw
45OCfxr1z+xY/wC6v/fRo/sWP+6v/fRpe0p9h+zqHmN14Z1abxDYeIUvbI6jbQvbvGYXELoc4x8x
KkZPrmsy9+GZ1CO8vbjUlOt3N1HdG4WLES7M7UCZztwfXPAr2H+xY/7q/wDfRo/sWP8Aur/30aHU
pvcSp1EeV6j4N1DXdSOpapf263MFtJDZR28R8uF3BBkbJyx56cYwKm8LeGdZ8LaVb6XBf6dLaxSF
mZrVxIwLZPO/Gew4r07+xY/7q/8AfRo/sWP+6v8A30aPa073D2c7WPMf+EX1j7fZaxJq8M+r2rSr
ukt9sUkDniMheRjqG/PNWv8AhFv7Qu7u91ydLm4uLVrNY4VKRwRN94Lkklj3Y+g4Feif2LH/AHV/
76NH9ix/3V/76NHtaYeymeaQeHtdi0CPQBq0EdnHH5Auo4j55iHAAydobHG7n1xV/T/DNpprSx24
VLX7GlnFEB9xQXLEnuWL5P0rvP7Fj/ur/wB9Gj+xY/7q/wDfRp+2ph7KZ5UPh+I/AJ8MxagQ8rIb
i6ZCS4DA4AzwMKFHPAFdmiLHGqKMKoAA9BXRf2LH/dX/AL6NZ2trb6HpbX0tpLcASxQrDAw3u8ki
xqBuZV+846kUKtTWwnSm9zhdVl83UZSOgO38qpZrome2dizeDNWJJyf9Mtf/AJJpv+if9CXq3/gZ
a/8AyTXZHHU0rWZg8LNu90dvVS/1BbHyV8mWeaZ9kUMW3cxAJPLEAYAJ5Iq3VDVo1ktkBsLi7IfK
i3kVHjOPvBiy49ODnn0zXmRtfU7JXtoXInaSJHaNo2YAlHxlfY4JH5E0+uMv9D1S/kt5b9Z7iT7M
qDyDB+5kycsTIp25BX5oxn5Tx0rotWtLi40d7eBmaTC5G7BkUEFlzx94Ajt1qpQStqRGbd9DRorn
J9OEmnQpBofk2qXPmTadmIeau0j7obZ94g4J52561Xt/D8k0lkt7YRtapHc/uJCrrCHdTGmOnAHb
IGOD0o5F3Dnl2/r7jq6K4v8A4Ry8uNOlF3ZLLcrpUcMLOysyzrv6HPBGR8361PPoV5Pr32qdbp2L
xPFPG0AWFQF3KWZTIOQ3CcHd2yar2cb25ifaStflOtqG2uobuNngfequ0ZOCMMpwRz7isiwsHg1a
WS400y3DTSONRJT7hztXOd/AwuMY4zWRJ4enW0mto9OZE+2tNMYFg/0mMlyqgPkHbuHDgDjjtSUI
vqVKclqkdpRXLWnh5vtGmrcWzyWkMc+6O4aNthZlKqVUBexOACBjrwDXU1MopbMqEm91YKKKKksK
KKKACiiigAooooAKKKKACiiigAooooAK0bb/AI91/H+dZ1aNt/x7r+P86mQ47lGw8QaXqmrajpdn
debeaayLdx+Wy+WWBK8kAHIB6E1p15n4C/5Kt8Rf+u9r/wCgPU/xU8fS+EE0vT7W6hsZ9Td1a/mh
aVbSNcbnCAHc3zDA5HHNS3ZR80vxRpb3mux6LRXivg/4m3Uvjey0H/hKIfFdrqEb7bgaa1lJbSqC
wBGAGUgdeTn0xzN4T8W+JbzxhBaeJfFUOl37XDiTw7c6WIlaPlV8qc/fycbecnB6jq0rtIluybPZ
KKr38rwaddSxna6QuynGcEAkV5p8Mrvxp4l0TTvE+teKk/s/95usYtPiBnCsw3PJjKnI6KBwo7k0
l18hvS3mep0V88v8X7zWjd6ivju18O7HYWmlf2O9z5ij7pkl2naW6Hb0HbNdOvxO1zxHoHhO10SG
2sda8QPNHJcSoXjtxFw7op6nuAc9MHPWhXa0/r+vwB6PU9O17WrXw7oV7rF6JGtrSIyusSgsQOwB
IGfxFT6bfRappdpqECusVzCkyBwAwVgCM4zzzXm3i7SvE+l/DPxWuv8AiSLWontFMDixS2eM5+YE
IcEfd9+vSsUan428F+F/DGvz+ILS+0qc20EmlCxVBHG6gDbL95mAHU459RxQtZNen43E3ZX9fwse
20V4143+J0tv43uvDkPiaHwxa2CI0l82nNeSTyMoOwJggKAwyTzkVHonxO1TUvBfjFYtThvr3RIP
NtNXhtfKFwrA7WaJxhWBByMY+uMlJ3i5fMq2tj2mivNfDmoeKrHwefGviTxCt9a/2X9rGlwWUcSg
7AwJkA3EkDJAAALHsAKTwvF8Q/ENlpniWfxVZWttdtHcHSY9NRoxCSPl80nfkrz9T1qnFqXK+hN9
LnY6R4osNb1rWdKtUnE+kypFO8igKzMM/Lzk4xjkCtqvEtE0zxPqfxD8eL4e8RQ6Ksd6jSO1ktw0
rbTtX5uFXryMmrDfFzU7D4UQ6zeRWjay1+2meayt5O9ckylV5xtHQd+gxxUp3in1sn99v1Y/tNeb
X9fI9lorwbSfipdWHiTSLdfG8Piy2v7hba4tzpDWb2+4gK6MFAbk8g9u3ORp3Xi7xPD49ubPWvFE
PhmJb4JY2Nzpga3vbcEEt9pPQlevI5IAweBVtUu/9f1YV9G/6/r1PZqKKKQwooooAKKKKACiiigA
ooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAK53xv8A
8i9D/wBhTTv/AEshroq5X4ifa/8AhD3+weR9s+32Hkefny/M+1w7d2OducZxzigDyXxX4x8R2XiG
O30Pw7f3VnbSn7TK1nJi46gqh28Add3cgdVHzdJF4nspIUdrPV4mZQTG+lXG5D6HCEZHsSKz2sPi
KWJOo+E8555uf/iaT+z/AIif9BHwn+dz/wDE1qZnrdZms309jFAYnhhWSTbJc3Clo4RgnLAEdSAO
oGT+B06r3iXckQFnPBE+fmM0JkBHpgMv86I76kyvbQrz6rb6eI4r2YtNsDSNDA5VR/eON2xevLHH
B54NWri6htbZ7maQLCi7i3Xj2x1/DrXPv4OgPkYa1lKQLA7XdmsxwCSCmSAh+Y9iOnHHO1qGnrfa
cbUP5WCjIwXIVlIZeO4yBxx+FVJQ0syIuet0Z9r4ijl/tCSVZFignWGFPs8iyuSgbGwjcTyeg6DP
vVmLWbZLCCa4l3ySZXZBBIzFh94CPBcY75HHfFZ83hd7tJnvLi0nuHuRcLvtMwghNmDGXORj/aHN
WU0J7WO1eyltYLmAOMi1AiIcgsBGrLjkDHJPHOetU1T7/wBW/wAyU6vb+r/5Fq41vT7Ty/OmYB0E
mVidgiH+J8D5B7tgcH0NJJrmnxXhtWmcSCRYmIhcorNjaC+NozuGMnvVe+0W4u2kKXyxm4thbXRa
DcXUZ5T5htPzN13DpxxRLoAdLtFuNouLmGcfJnb5ezjrznZ196SVPqym6nRf1b17liHXNPnu1tY5
nMjO0akwuFLrncoYjaSMHjPanQazYXEjLHMRtUvvkjZEZR1ZWYAMB6gkc1VTQQq26m4yIryW6PyY
3b9/y9eMb+vtVWx8I2trDLAy2nktA0CtDaLHKVbjLvkljjuAO+QexanbcL1L7aF6fX7ZNKvL+FJp
RbRGTY0Mke8Y4xleQcdQCKcdfsUhikkM6eYnmFTbSZRem5xtyg4PLYHBo/s26uNMubG+vI5UmiMK
mGDy9oIIycs2T+Q46Vn3Hhc3k0c9zJp80/lCGRpbAONoJwUDMdrcnk7geOKaVO9mxN1bJpGvHqln
NevZxSM8yHDhY2IX5Qwy2MDIPHPNXKpWOnLZXV7Mrgi5kVwoXGwBAuPfp7dau1nK3Q0jfqFFFFIo
KKKKACiiigAooooAKKKKACiiigArRtv+Pdfx/nWdWjbf8e6/j/OpkOO55/cfDvxDB4r1nXNB8a/2
V/asiPND/ZUc/wB0YA3O3uegHWreo+ANQ1nR7D+0/E88niHTp2ns9YgtEhMZP8JiB2suMZGRnH1B
7qip6WLvrc5jw3oHiTTL6e513xfJrSvGEji+wR2yRnOS2FJye3+PbBl+Gur6nq9hNr/jO61LTdPu
xd21r9hiikDKcqGlHJHY8DPbHGPRaKL6p9gtuiG6g+02c9vu2+bGybsZxkYzWJ4K8Ljwf4Rs9BN3
9sFtvzN5Xl79zs33cnH3sda6Gijv5gecR/DbXdHa5tvCnje40fSZ5GlFi9hHc+UzfeCOxBVfQDp6
k81s+JvAw8RWWlumrXNnrWlENaaoiKzhsANvXgMGxyOPyyD11FHSwdbnCSeBtf1Hw5rela74yl1J
9RgWCOU2EcKW4BJJCKfmJz1yOg9Ks+IPAf8AbvgvSvDv9peR9ge3b7R5G7zPKGPu7hjP1OPeuyoo
639Pw2Fa/wCP47nE674DvLnxJJ4h8N+Ip9B1O4iWK7ZbZLiOdV+6SjEAMOBn0+pzafwlqd74G1Lw
/q/iOTULu+SRWv3tVTZu6ARqcYHpn1rrKKVla3Qq+tzHsPD1tbeD7bw5eFbu2islspSy7RKoQKTj
Jxn61ymj/D7xHob2tlZePbwaDazK0di9jE0nlht3l+dnOO3TGOMYr0OiqbblzdSbacpzXh7wl/YP
iHxFqv27z/7YnSbyvK2+TtBGM5O7r6CsK1+FFkvgqfw7d6lNK7X739vewJ5UlvKTlSvJ6dPfPY81
6FRU2X4W+63+Q/Pzv/X3nH6D4a8WWGrQ3Ws+OZdWtYkYC1GmxW4YkYBZlJJx/P8AXM8SfDjWfFFx
dWl/40uT4fuLgTNpwsYi6AEHas3UYI446evf0Oin1TDyGxxrFEka52ooUZOeBTqKKASsFFFFABRR
RQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFF
ABXO+N/+Reh/7Cmnf+lkNdFXO+N/+Reh/wCwpp3/AKWQ0Ac7J/rG+pptOk/1jfU02tjI7CsbXg0k
2lQebNHHNd7ZPJmaMsPLc4ypB6gVs1zNxrWiaza28rW+szQ8TQS2+m3q5yOGVkQHBB9e9KLSd2KS
bi0iL+3ptMuZ9NjhmvXjmZYmfzHIjCITuZEdiQXxkj6nPXRh12WW9topLL7NDNEr77p2jYsc5RV2
4LDHQkHHOOKj0+LRNYtGjs4rqMWUxibcs9rNG5VXOS21zuDqxJ65B5rQOj2TTwSmN/8AR9vlR+c/
lrjofLztyPXGa0coNbamXLUT30KS65cNpM+qmxT7Gtu08JE/zuAMgMu3C5HoWqpeazdWt1HdXFoU
VbKe4SJLokMF2nDrs4bnqCcc9a1hodgEnj8qQxzo0bxmdygVuoVc4X/gOKTUtHt9QtZI/wDVym3k
t45OTsVwAeM89B+VJShfYrlnbczrzWr9NK1LNtFb3sFp9pjKTeYhUhsHJQcgqeCMdOfSNNYura8u
Hu7fM/2a32RR3RaNmd2VeCg2nPU88Y9K1rXRbG1t5ohG0vnoEmaaRpGdQMYJYk45PHTk0i6Fp6xy
RmKRxJGI2Ms7u20EkfMxJGCSQeo/AU+aHYlRqNK7/r7im+vXSOtsbCL7abr7MyfaD5YJjMgYPsyR
jH8IPX8dDTNQOoWJneIQukjxyIG3AMjFTg4GRx6Ckh0exgEeyFi0cvnB3lZ2L7du4sSS3BxyTxj0
qxbWsNpG0cCbFZ2kIyTlmOSefc1MnG2iLip31ZzLeIJzf22ozRGLTvsVxOiRzFmkVSmCyYABx05P
WrUfiO9e0nkOjTiSPYVG2YIQxwclog3HU7VbitCLQNNhmMqQMco0YR5naNUb7yhCSqg4HAFOj0Sy
igeFPtKh8ZcXcu/A6APu3ADngHHJ9apyp9v6uRy1e/8AVv6/4JBqV6zeFrm9jKMfszPm2ueMY5KS
bfrg4p1vqVxcXZgtbVZIoCiTySTbWBZQ3yjad2ARnJFWxptoumHThDi1KGMpuPIPXJznJyec5pja
VZtdJcbJFkXbwkzqrbem5QcNj3Bqbx1KanpqZEeoTtrSXZEwtJZ5LVP9IyCyBs5j24AyjfNuLfgc
BYPFLC2S5vLEQwS2b3cZim8xiFxlSNowfm45P4Vqro9il6bsQt5pYuAZGKBiMFgmdoY88gZ5PqaE
0ewSOCMW6lIIWgjViSAjYypBPOcDrT5odv61/wCALlnfR/1/w3/DmXH4jvXtJ5Do04kj2FRtmCEM
cHJaINx1O1W4rctJxdWkU4aFt6hswyeYh/3WwMj3xVWPRLKKB4U+0qHxlxdy78DoA+7cAOeAccn1
q1a2sNlbR29umyKMYVck/mTyT7nrSk4P4UOCqJ+8yaiiioNQooooAKKKKACiiigArRtv+Pdfx/nW
dWjbf8e6/j/OpkOO5z+ia+V8Nalq2sXQENnd3geUqBsiilcDgDnCqB6n3NZ1t8UNDutPurqKOV3t
miDQx3FtISJG2od6SmNRnOdzqR3HIzY0nw9p95a36W2t6jdaTc3F0k9jIsSxb2dxKA3lCQYctg7+
3UiryaQ0ET6e/inUmvbhAY5JXtzKI06hYzFsI+blihY5GT0xP/ANHu7d2X77V003w/caxeW1xDHb
27XEsB2GRQq5K8MVJ+jY96xNV+IGmaLbWkt9bTwSXZc28M89vC0ka4zJmSVVA+ZcAsG5+7wcXItD
0seHJfB0ctx5C2XkuQPmVHBXO7bsB64AGB2AGKs6joCX0lpPBf3lhd2qNElxa+WWMbY3KRIjKQSq
npkEcEc5H5CWyKieMLK7W0bS7S81P7RbpdkWoQGKFyQrtvZeuG4XLfKeKzovF89l4h1i21C1vJrG
LUYbWK5jSPy7fzI4tqsNwc5d+oVsZ5IFa9x4aje6hubXU9QspkgW3lkhdHa4jUkqHaRWORlvmBDf
MeemEuPCljc/bt8tyPtt7DeyYZeHi8vaBx0/dLnOTyeR2atfy/4K/Qf9f18zPt/iNoN14jbRYpt0
wmeBXE0JDSIDuXYH80fdb5mQKcdeRme18a2t5o9rqUWm6h5d6UWyiYRCS6ZlLYQb8DAVslyo44JG
DVu08Nx2V7JLDqWoC0aSSVbDeghR3yWYYXeQSzHazFQTkDgYgPh7TYdJ0rQYtQmt7ixQPYzK8ZuF
8sbC4DKVbhsHKkfN24pLb7v+CGl9P67FHUvE2o2uv6QkWlag8VxZ3Ms2noIPODI0QBLM4XgM3RyD
nvxUeo/FHw3p0dlJJMzLdWqXnMsMTRxNnDFZHVmPDfKgZuOnIzux+H4lvbO9nvbu5urW3mtxLKUz
IJCpYsFUDPyDGAAPSqEHgq1s4bSKx1TU7NYLWOzlMEiA3ESZ2hyUJUjc3zJsb5uvAw1/X4/8ANP6
/r1Lum+I4NV1m90+1tLgrZ7RLclohHuZQwG3f5nIbglADg80TeJbSC8uLR4Ln7TDcRQCPauZPMGV
defuAB8k4x5bccDKjw9G3iSPWp7+7nlhjeO3gcRCOEPjdgqgc52jhmYd8ZAxZm0azuNZt9VkVjcw
RPEuG+Uhu5Hcj5gD2Dt60u1hf1/X9fcYi+PdP+xzXkthqENstlJf28kiJi7gTG5owHJHDKcPsPzD
jrifVfGmn6Q9wktvdSPDFbykJ5agiZ2RBud1UcqcliB05qODwNp0cEltPd313a/Y5LG3gnddttA+
NyIVUE8Koy5YjaOeuVtvB7Wz3U6+IdWa7uIIrdrl1tiyxxliFC+Ts/jIJKk09P6+f/AG7dP62/4J
q32rppvh+41i8tbiJLe3a4lg+RpFCrkrwxUn6Nj3rIl8dafZ6fe3WqWl3pj2kcUjQXZiDOsrFYyr
K5TBYEcsMYy2BzU154YWPwBdeGdMfaGsXtYXnbjLKQC20cDJ6AYHQADAqOHwZbm0uBfalf3l5OsK
/bJGjWSHyjuj8sIiqNrEtypzn5sjijuC2Xf/AIb/AIJWtPiNpF9ZwTWkFzcSzXf2JYLd4ZWEvlmQ
DekhjIKjqGIBPOMHE1x44toL97EaTqctwsogKoIcecYhL5eTIBnZk5+7wRnpm+nhuMtYy3eo395c
Wd0bpZp3TLuY2jwVVQoXa3RQvIycknMcnhOwk1RtQM1z5rXv24gMu3f5Hk46fd28+ue+OKT/AK/D
/ghp/Xz/AOAZOo/FHw5psdlJLKxF1aJeEGaGNoon6ErJIpY8N8qB246cjN0eJ7xvFt9pcWmSz2cO
nxXcdxGYxlm8zrukBwdgAwvXOcDBpYPBVrZw2kVjqmp2awWsdnKYJEBuIkztDkoSpG5vmTY3zdeB
jRk0KJ9eGrx3dzDK0IgniQoY50XcVDblLDBdjlSvXnNOVtbef/ADT+vl/wAE5e2+Jtra+GNG1DW7
Rra91GHzEg8+3hDqApZ1aSYKFywABbd/s8GtCf4haYkBubayv721Syj1CWe3WPbHA+7DEM6k42HI
UE+gNTQeCo7O3tIrPW9Ut3s1aK2mTyC0ULbf3PzRFWX5VOWBbj73WrNz4SsLuPUEknvCL7T006Vj
LuYRrvwwZgSW+c5Jz2odt/6/rb8QVuv9a/5EcHiG7m8cXOiDT3ayjs4bhbpSmAXL/ey+SDtAGFzk
HPGDVXxr4pm0bStTg0y2up9RgsJLkyQCIrajBCu/mMMjKngBj8p49dYaDFHrkWqwXd1DKIFt5Yk2
FJ0XcVDblJGCzH5SvXnNVNf8IW2vSXEh1C+sWurX7JdfZDF+/iySFbzEbGNzcrg/N16YT6Di1e78
v0v+pROu3Oma7CmrX0iWZsbi9JEMZiMamPqwIcMgJONpB39eMVTXx21pqmr3er213p2mW1jayxQX
XkB2eSSRQQVcgbsIPnYAYydoya6PUPDOn6pNG935sipZTWRj3YV45du7OBnPyDBBHU1nR+B7fN29
1q+p3k88UMazymFXg8li8ZTZGoyGOfmDZ75HFP8Ar8/xtYS+Hz/4b/gkNp8RNK1CzhmsbW6u5pbs
2YtreSCRhJ5ZkA3rKYyCo6hzgnBxzhLzxrMYdCn03Srm4W/v5LOeBvLEsTRrJuXmQLuDIeckYBwe
RnWTw3GWsZbvUb+8uLO6N0s07pl3MbR4KqoULtbooXkZOSTmB/CFobGK3gvLy3lhvpb+G5jMZkjk
kLlsBkKkYkYYKng+vNGn9f16hpb+vP8A4Bzth4o1PUtY0rT1fU4oppr2a4uDDaoyLDNs8lhucbVz
gsvzH5SD97Fyz+Knhy+jvZIHkdba1kvF2SwSNNEnLEKshZDyOJAh56cHGzYeErDT72G7SW4kki+1
YEjKQ32iQSPkBR3HHt1zUKeDbcaTdaVJqupy2E1q9pFA8qbbaJhjCYQFiAAAZN5GOvJyun9f12/E
ejl5X/A1rPUGv9Oa6FrcWwIJjE+3c64yHAVjgH0OD6gVxVr8T9N0rQNFOt3Pm39xp8V3csJYItqs
PvbXdC2SG+WMMeOnIz6AkapCsXVVULz3Fc3b+CbeyjhjstW1S1SOEWziF4wZYVJKRsdmRtDMAylX
weWJwael/wCvP/gErbXcvab4jg1XWb3T7W0uCtntEtyWiEe5lDAbd/mchuCUAODzWZ418UzaNpWp
waZbXU+owWElyZIBEVtRghXfzGGRlTwAx+U8euoPD0beJI9anv7ueWGN47eBxEI4Q+N2CqBznaOG
Zh3xkDFbX/CFtr0lxIdQvrFrq1+yXX2Qxfv4skhW8xGxjc3K4PzdemF2HF2eo1vF9tBdrbSWl5JF
HJDb3N8iJ5MM0gXajfMHJO9OVUgbhkjnFq18Qx3t9LDbafeyWsTvE18BH5PmJkMuN+/ggjO3bkda
rzeELOa/Nx9svUt5JYp57JWTyZ5Ygux2yu8EbE4VgDtGQec2bPw+ljqEs9vqF4lpJI8p0/8Ad+QH
fJZs7N/JJOC2Mnp0wPy/r+tfw8xLRfd/X9eZRbxzpaabaX7xXaw3WnS6kvyLlYowpYEbvvfOOBno
eaSz8b2d1qUVlJp9/as85tzJP5WxJBH5oU7XJ5j+YEAjscHiqyfDuwFubaTVNTltlsZtPgidosQQ
ybchSIwSRtGCxY/WtAeENOGoC8Mtwzi8F5tLLtLiDyMY2/d28/Xvjinp/Xr/AJD0/r+u5kWfxU8O
X0d68DyOttayXi+XLDI00ScsQqSFkPI4kCHnpwcWdS8avDoevT2+l3UGoabZfa0t7sRkSIwbY/yS
Ebco2RkNx05FWk8G240m60qTVdTlsJrV7SKB5U220TDGEwgLEAAAybyMdeTm1ceF9Pu5b95zM631
ilhMm8AeWu/GMDIPznnPpSdraf1/Wg1a6v8A1t/wSvp/io3urQaU2kX0N21stzMHeDEKsWAJAlLM
CV6oGAyMkHOLur66mlSwW6WVzfXc6u6W1qYw+xMbnzI6rgblHXPzDAPNUl8J+ZdabNe65qV8unyC
WGKZLdRvAYBiUiVujYwCAQOQec29Z0JdVkguIb65sL2BXSO4thGW2PjchEiMuCVU9M8DBol5Ex8z
Ph8daZPpdxqC294IrfTI9UdSi7vKcOQo+bG75DxnHTmrOgatJqV5rgZrki2uxHHDLFGnlr5SMApV
juBzuy2CN2CBisW2+HiyeHbSwu9Uu7af+y0029+wtHsuEUHjLxkjBZsFdp55rqNN0e30u4vpoHlZ
r2VZZA5BAKxrGMYA4wg9ec1Ttd2/rX/IenT+tP8AO5lN4300WUFyLe8cyw+Z5SxrvRzIIliYbsBz
ISoGcZVskAZqW38XWk09vbS2d7bXct6bF7eZU3QyeUZRuKsVIKAEFS3UD1xJP4U02aLUkBnja/nS
4aRH+aKRCGVkyCBhxvxggszEg5Iqs3g23a2GdU1H7f8AbBe/2jmLzvNCeWDjy/Lxs+XGzGOevNJW
6/1/Wv4BpYSPxrZ3GoWljbWF7PNczXEQAMKbfJk8t2+eQbhnnC7mxziumrlT4Ftm0yHTn1bUms1u
WupY28k+fIZfNyzeXuXDdNhUiuqo6Ce77BRRRSAKKKKACud8b/8AIvQ/9hTTv/SyGuirnfG//IvQ
/wDYU07/ANLIaAOdk/1jfU02nSf6xvqabWxkdhXE2aeI5PC3gibR7+1gtY7O3a4SW2dzj7K43NiV
N6ZKAIBkNhs4XFdtXC2ek6BqFhb3tr8MEkt7iJZYn+yWA3KwBBwZQRwe9ZsqJsaBJ5uo+Kn9dSX/
ANI7ao7O/l03wJYXEMPmy+TEiLxjLEKCckDAz6j6jrU/h42IstStNL0VNEktrgxS27QRKolMSOGI
iYqw2un8QPGOMVFaaHIsTS2beHxHOm1nh0riRD2JEvINa0+W2vl+plU5r+6u/wCgh1XXBZO8ltDE
8E2J5DEHKR7N27yklJyMjjcTjkDnFaOqanJa6Ml7Z+VM0jxBC2drB2UZ/I1Sbw/cvapasNCa3jYs
kR0klFJ7gebgGrUllrEyBJb3S3QEHa2nORkHIP8Aruxq3yNozXOls9vIo6jrGsWl21rBbwzvBbie
aQRqiMCW4G+VdgAXlvm69PW9Ff3t1qMyRm3t4LZ40kSVCzSFlB+VgwA64HByRUE+n3t5dItxd6JP
cQYkQSaazPHk8MMzZHI6+1Fxpt613Bc3N1ohuVISGWTTW3g8kBSZs+vSj3bB793v+BQ0u9vbGRBm
CS0udSuYvLEZEindI2d27B+7jGO/Wkg8Sau+nzX0tlEkLWklzBu2DG0AgcSszjnBO1cfjxqjTdUX
bi60gbXMi401uHOcsP33U5PPuaiTRb6MzlJNFU3GfPK6Uw83/e/e89T1p80HvYVpp6X/AAHte6mZ
LO1D2qXF0ry+YYWZI1UL8uN4LN83XI6dKzb+7v7TVr++tpLQtBpkUsgaNmWTBkOFIYbc888/Sr97
p99cRRW99d6JLGzgRxT6azAsAegM3XGf1qQ6XqZVlNzpBDxiJgdMb5kHRT++6cnj3pJxWo7SejT/
AK+ZUk17U31ORLaxU2kMkUchcoMlwpzuMikfe4Gxs4688X9NvruXULm1vzFHMuXihWIg+XuIDb9x
DZ47KQeo5FQtpGovdR3TTaM1xENscp0ti6D0B83I6mp9L0uawuZpX/s0CYZf7JYmBmbPVm3tnqe3
frQ3C2gRVS+t/wAP6/q5q0UUVidAUUUUAFFFFABRRRQAUUUUAFFFFABWhbf8e6/j/Os+tG2/491/
H+dTLYcdzzvTtL1e7vLSxvZdeSyT+09zfa7iNji4XyN0gYMflztyeRnqKWC0v5b3wZq+rQ6qblNM
aGZ4xcZW5byivmpH0BIbcWG3j5ugr0iip6f15/5/kaN3bZ5JYW/ipdG1iV9Q1eTUjpc/nwixuY8X
WBt8t5JmUsDux9nUKR1x8orY8Tadq1tFpUMGoanHYOkkl3Mkd5dyGchNuRbypKq434AOwHqB8teh
0UPX+v6/qwXPPUXVLTXNIN1PrV/cvaRxTKsNxDHbnY5aZtha3dugMbEnOME8KcvGuHw0tpaSawlt
DfIt3qM0N+81zH5R+ZYWdbhAH2AiNsdxxuUerUUd/wCuv9f1ay6/1/X9ep53Z6Xq95Jo9pfX2tS2
Zs7xnljNxZtnzI/JD4kLg7c43tvIzu53CmWtpeS6h4K1fWYdWMyaa0Nw8QnytwxiKiVI+gOH3Fht
4+boK9Hopp2/r1/z/ACrpt9/aNhFd/Zbm18zP7m6j2SLgkcr26Z+hFWqKKQBRRRQAUUUUAFFFFAB
RRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFF
FFABRRRQAUUUUAFFFFABXO+N/wDkXof+wpp3/pZDXRVzvjf/AJF6H/sKad/6WQ0Ac7J/rG+pptOk
/wBY31NNrYyOwry2HV9IvfD3gySLx3Z6e+n20DT263drmNvsskZIDox8zMgUhjgDPG7Br1KudsdY
16/0zTr5NM0aJNQjSS3SbVpFdtyeYFx9n5baCSBnhSe1ZsqJB4Uv7bVJvE95Z3MNzBJqQ2ywyB0b
Fpbg4I4PIIqvY63HF4Jtk067tZL2GCMSIJVLQrkBmYAEjaDnJBx3Brc0bVLq+fUob61gtriwuhbu
IJzMjZijlBDFEPSQDGO1aFrcw3lrFc2774ZVDI2CMg+xrSDSWqvt+pnNNvR23/Q5F9WvotI+0za3
aCFLg/vobiIvKgTJVHaJY2bPYKOmCQQa3NcD3fhO98rzg0loxUbPn5XOCMde2MVr0U5TT2RMYNbu
5wrTyh7290/WHlNtpccglQROJSrSHa2FxgYxxg+9WrjU9Sl8QIgntIfLeMQ28sgDSqyjcwTy2Zur
DKsAMc9DnsKr3F9bWqTPNMiiCPzZBnLKnPOBzjg/lV+0TexHsWlbmOQudX1ULcyJqEibUvHVVjjw
vkuAo5U9Qef0xVx9duf+Eot4Fn2W7SLFLBJImfmj3BlUJuC5KjcX5ORiuqVg6hlOQRkGlpe0j1iN
05PVSOH092t762h+3maUarMJLWRYiUBEhDfd3KTjOc9CccUq65fyFvI1My3bWNxNLZqsR+zSrt2r
gLuGMkYYnOK7YkAEnoKqwCz1A22pw/vD5Z8mTkfK2CeD64HUU/aJ6tB7Np6P+rnN3PiOeYXj6Zdw
XEcdrbtvVlKxMzkOxYA4wvPQ4xnFRvq19FpH2mbW7QQpcH99DcRF5UCZKo7RLGzZ7BR0wSCDXZ0U
vaR/lD2UusiOCQS28cgDgOobDrhuR3HY1JUYnja4a3DEyKodhg4AOcc9Ox4qSsmbLYKKrvf2sc80
Mkyo8MYlk3cBUOeSTx2P5VOCGAIIIPIIosFxaKYk0cjuiSIzRna6qwJU4zg+nBFPoAKKKKBhRRRQ
AUUUUAFaNt/x7r+P86zq0bb/AI91/H+dTIcdzymDSYf+EJ8aai2i6Yk5OprHqEeGuZB5koIb5AVA
wAPnbIHary61qOjXmrxaXZ/aL2+1aGCPcqsF/wBCjcna0kYY4TAG9euecYPTQf8ACC297qOoQf8A
COxXduWF/cx+QrxbiQwlYcjJyDu6mrMVj4TvrSOCK10W4tru3XZGkcTpNDGflwOjIpYY7DPbNSnZ
fJf5/oat3b9X+NvyMVfE3iFLPTr2/gtLCyEkkWoXBhFxsZZQijbFOfL3c5OZAh4bgE1t+Kb/AFbT
bGG40xYRErlryeS3a48iIKSWEaujNyB90k+immpbeEL2C0u44dDuIdPZIrWZVidbZjtKKjfwE5Qg
DHVcdRT7qTwp4kM9pdvo2qGwYtNDKYp/sxGQSynOw8Ec46Gh7Erc56Txlrc+vSJpunRT6Tb3FvBJ
M3lKJPNVG3h2nUpxINq+W+7AAPzcTW/ifXDaS6zcnTk0i11Ca1uYxC4kWFJWj87zC+AFwpYFTwGO
R0Gk2q+B7mRfEDX/AIelktSIV1EzQsYSQcIJc/LkE8Z7mtA3egW4Gnm402MXZyLbfGPOMpY/d/i3
kOf9rB680/T+tv6+YdNTj77xl4oSYpZ6TA3k2Yv5twjAETu+xWaS4j8vCoNzgOMk/KMYNy58Va3D
f30oWwWwstStbKSBoWaV1mEOSJA+0FTKf4SDjt1q7dar4a1jxlZaO9vpOp3lrFNOZS0cslk8bIMY
wShJPXIxs/K3Yan4f1a31S8jbR5bCGdZJrmOeKVWZFU+ZIRwpXAwSc4UHjihW0fT/g/0hvsVvDUu
qy+KfFC3V/HNZQ3qpDD5Tbo8wxMMMXIC4PICjJJORnFZ76/La/Ehbe2tUe0u5lsLmcQeWRKsLSqN
5l+cgekWAGxv4xW22q+EI9niRr/Q080fZl1MzRDeBz5Ylzz0Py57VoHR9Jmvv7RbTbJ7ttp+0mBD
IdvKndjPHb0oXTyE9b+f9fmZ2u6nqUWr2OlaZLZW81xBNcNcXkTSoFjKDaFV0OT5gOd3AU8HPHHR
+IdRl1K88UWj2VtEPDtpfXFvcRNJvXMzbEkDLt7jcVbqDjse01K58KavfroWqTaNe3iuGXT7popJ
A23ORG2TnaSenSm6hB4Snki1W/g0SaaBmjhurhYiyNHuYqrt0K7WOAeME9jSTsrv+t/+B93mV5W/
q6f6GDqGt6tpninXtQWZZdPstEiu/wCz2Rtxb98cBt+1DleW2nIAHbJiXxb4ottPuDfWFpFcCSzE
LyLGoKzTCM5jjuJTgDJDblBORjjnes9T8P6vPo9zqA0ZNcmtxNawtcQzTIrKd3lMOWXAPK8HBp9y
vg7wvapaXQ0LSbeeTzlhlENukjqQdwU4BYELz1HFO1nZ/wBai/r8F/XzOcm1nUptf0601JNOuJrD
WXtzLFBJGGJtDKrqPNO0gMykNvBzkYrpvCGpanrXh2z1XUjaKbyCOVIbeJl8vK85Ysd2eo4GOnPW
p55vDkGqwQXEmlR6jdP58McjRiWV9uzeoPLHblcjtx0qC68SeHtB0e7eK7shBptu0j2trJHuREJX
ATIA+YFQOBnii+n9fMHq1b+tWcve6rqOq+INDvXa2XT4dcuLaK1SBjPuihnQsz78HJViFCDqOak0
fxb4t1a1adNGtx9ssZLqwV2hX5ht2rxcM0o+YAttiwcZxu43IJ/BN1rFlqcT6A+rXq77W4BhNxNw
V+RvvNjBXgnoRUkCeDH1LUdMt10Br+6z9vtYxCZZccnzUHLdSTuHelsrP+u/9dAbTd1/Wr/rzLWg
6pLqGjPNNcRzXcLvFPstWtwkinlCjO5BHHIYg9QcEVyp8V+JJPCOjX62trLe620aQRW8P+ozEzsT
vmQOTt4G5MZ6tjnodB1XQDpd5/ZT6RBo1i7KHs54jCoxuYsE+VBknqeevekuNQ8Gy+Gohc3mgvoL
kQxiWWE2rFeiDJ2HGOnbHtQ9fw/r5gtPx/r5GHZ65rWn6TpLzWdlpemQs8F7KIRcCMrII1G2Oc+X
u5ycybD97oSbcfiu+ni09Hitg13rF3pzqFbISITbSOfvfu1z25PAravdL8M21ra31/Y6RFb6cqm3
uJ4Y1S1UEY2MRhBnGMY7VDbxeEZryXW7aPQ3uljFzJfxiIuEIYCQyDnBCsN2cYB9DQ9bpiWm39f1
dHIeGrjU4j4Git7+OCyOhyS3ELxO4cL5OejgbsHgkHHPBzwk3jDWdU8L+KV3C2kg0oX1jdpB5DNE
4kw20TOynCZBJU88qMc9isfhK6v49IVNEmvLWQ3SWYETSQufmMgTqpO7O7HfPenaXF4WS9u7LSI9
GF3CGW5gtBFvQMfmDqvIyRznqacnzfj/AJ/1/wAHRp2d/T+v6/QzYdV12x1bTLfVbiyGnzxxxrcx
2T/6RO275M+cfKOAvLKwbn5gSBVbxdq0+ieIUv47e1ma30S9uId6uHVkMZIyG2lW+X+HI28HnFTa
6PBvgWxOr/2XoNnfW8EjWSbIbeSUgElI2xnndjgH73TmtCfU9ElRZNfj06zaZntbcX7oDOjbdyrv
AyG4yoznAovd3Xn+On6ij7tubb/Iw7TxbrY1uK0vDp8kP242T+TbujEm2M6sCZDgDhSMHPXI6VRs
vHevTR2lzOum+TLHYXDxpbvu8u5lMewMZMblILbsYOcYGMnt3XQY5ZZXXTVkhuEEjkICkzKEXJ7O
VZVHcggdDWTaat4On1DUNMVdKhm02SG2kjkEK/dKtHtGc7VdwBwMPkDmhWuvl/wR9P63/wCGMnT/
ABDrGo+LYruXRoxpy3VxYQyOYlePYW3FW88szExcp5IIHfC5bndd1TU9VtotauTp0lvdeHr+4gtD
byDZETCTHI4lBcleNy7MHnB6V6EL3wfa6hBq4udCivdRHlw3vmQrJdDIG1X6vyFGAT2pILDwadcv
bSC00E6vLG32yGOOHz3RsFvMUfMQcgnPXIpLS3z/ACY1JJ39P6/QyV8W3sfi+x0uGFJNMllFnI/2
fYYpvIMu0OZcvwB0jxhvvZGDnabqviq18PXN79stbmFNUu1nneykma2hSSXJ2eeGcZCgBeVHADV2
M9p4chv57y4t9KS9giSaaeRIxJHGudjMx5CjacE8DBx0rl/EWoeBINT1S2vtL8P3GrR2yXhW++zR
i5Yhgi+Y/wDFx1I4Dj1p3/r8f8/yJS0t6f5fqvzOh8Ra/Lpfhb+1NPiW8llMKQYwFYyuqq3zMox8
wOCy56ZGc1zGqaz4nufCk/n+XpmpW+q2kHmBV+ZXkiOGjinfZ98AqZDuX03cbJ8UW1/qcuh3NjZs
j3X2OSOe7j/eRm3ErMEYfvAN4UqM8HPSp4dQ8EReG5Iobzw8mhBzBIiSwi1DNyUIB2ZOc4o2d/T9
P6+Y1sifxLqeo6N4dSe2e1a+ae3t/MkhYxZklRC2wODj5iQN341gXni/XbWKXT4ba1vtVTVBp4nt
ogImzAJs+XJMvzAfLt83rzn+Gr2vS+Fbn+zPB17JbwW96iT20MbRLE6xSIVjCnghjgBQDkBulXYj
4Ml0u90eE6C+n2WWu7JPJMUGCSTIg4XkE8gcijv/AF2/4P3guhQ0rxRqtxe6baahaW9u89vePNhl
Y74JEUY2SOq53HK7mKkYzxzU0XxlrGoWmnpPb2f2zUYYLu38pGCGArum+UsSWUqQOcfvI8989BfW
fhWS1gsNQttGe3tBG0NvcJEUhDHbGVU8Lk/KMdegp1lq3hgT2FnY6hpAmeEiyhgmj3NF3Eag8r8n
bj5faj+vz/4HyQjj7Xx34lfRLvVrjSreK3fS5r+03mIbSgBC/LcO0o+YAtsjxxkfNgWda13XV0Px
TZTXVql1baQt9b3VpC8RQOJBtwZCdw8vhgR16cc9Je23hTQIbq5vodG06LUG2XMs6xQrck5OHJxv
Jy3Bz3q7JLo8Mt1LK9hHIlspuHYoCIPm2lz/AHPv4zx196Ts1/X9dik7NP8Arp/wfvKd1qN5ovgq
41O8Md7dWtm87eQhiWQqpIADM23tkknufauFgm1vTvB3itDbDTbkaebyOdHVWZ2D5fYlzK247c+b
uG49jt59Hgg0nRNNjht4rKwsNwVEjVIosucAADAyxP4k1kXmoeFPBmkXDJBp1lZ/ao4LmK1SKNRJ
JtHzjIH3SGOedozQ9W33FDRLy/r+vUr6fquvvrv9lTTWEkdrYQXc8yWrhpd7SAoqmQ7ThBySeQeD
niv4R8U6/rl5bPqGmRW9hfWzXNuwMSsgBXAG2d2lGHALbI8HGR82BHZeIdA0iZRpOm6NDYPeGyF3
Y3MIjEawvOWbYMKA28bWI6lu9aegX/huN7aWKPRNN1nV4VuZLa3nhaWfILZ3Jgyj73zDIPJqut/6
1/r5W8xWsv66afmdPRWVY69Zajq17Y2l3ZT/AGNQJjFdI7o+SCrIOVxjqcc5GOKI/E+gTafNqEWu
aY9lAwSa5W7jMcbHGAzZwDyOvrUgatFRW9zBd20dzbTRzQSqHjljYMrqehBHBFc/aeONEvNU1GCH
UdPexsLaKaW/S8RolLs67WI4UjaOp/ioDpc6WisufxLoNraQ3dxremxW0674ppLtFSRcgZVicEZI
GR6ipW1vSVv4LBtUsheXCeZDbm4TzJV5O5Vzkjg8j0oAv0VS1TV9O0Wz+1alfWtnDnar3MyxKzYJ
CgsQM8His3TvF2l3OiaPf395Z6dJqkKSQQT3SgsWA+Vc43HkDgdxQtQN+ud8b/8AIvQ/9hTTv/Sy
GtWPWNMl1STS49RtH1CJd8los6mVF45KZyByO3cVleN/+Reh/wCwpp3/AKWQ0IDnZP8AWN9TTadJ
/rG+pptbGR2FeUQ3Nrqmm+HLU6Z4qN9olrbpdR2i3EQB+zum3asiFGy5+fblgpAJU16vXI/DW8ud
R1fXL+8aE3F1bafcN5KFEG+EsAAWJ4BAznnGeOlc1Zv3Unu/0Z6GBhTaqzqRuoxva9teaK/Up6Xr
l5Z3WtTTeGfELfbrsTx7LAnCiCKPByeuYz68YpkOuahb+F4NNj8M+IftKRJGX+xyIoxjJBVg34Aj
PTIrs49fn1HWbjTdMhhU2jgXMt1KAyjttiB3nODy+wYwylxWfceNnt7Nrma1sraOS9ks7Z7q+8pG
aNnDNIxTCD93xjcSSBgdapxqw0cvwL5sLN6Uf/JmYml+I9RtNL+zXWgeJJp1Zwsw09j8pJ253MTw
MdSenU9axoNT8QpBOP7G8SRzSRxxbmhmmBIbMkgBYbCRwFXp2I612Fh4lfVtWsry1DSR/wBn3ha2
guFeOSWOWJflbIVh12sccNzjkVRm8c6hfQNFp0eltdRXVmGe11ETxFJZdhUsI+G4wRjgNkEkAEU6
t/i38g9nhXaPsdv7zMU6jqy2QiOl+KJik3mLGLOaIMu3GwyeazjnnOTj0I4ov768u729u4vD3imG
aWzWKEpFKmyQbuTtYZHI/XjmuuvfHVtZa82nv9h2RXEdtKrXqrcb328pDj5kG9cnIPDYBwMxTa9f
3msaLMIBbaVJfTIJhcnMipDNnzEwABldw+Y/dBODxQqlVv4vwEqeE60f/Jmc7JrWqPM9z/YfihZ0
li8gC2cRiMbd4ZM4Yn5+SCeRyOzbfWNUhvIbltD8Us4upGlVreRkaFt21QpbbkZXt2610OteI7Vr
xryxvRfWEekXsrpaXhVXZGh/jQ8MASMjkZq5J4quo7+eNdMRrK3vobGSc3GH3SCPaVTbggGQZyw4
GRnpRz1bfF+A+TC/8+f/ACZnPaj4gu7+4gT/AIR3xRHZqrmRYrV43Z+NvKsDgfNkZ9OtY0d5rotb
S2XSvENtHbWqRr5enysfMGdzfLKgI+7gNuHt1z2nhrX57mSWwjVruWG6u2uZZJiPKQTuEVeCWbGP
l4AGMkZUGfRPFF1r0k8EMVhBKITIu27E727ZwEniwjI3qASMhhkcZcZVY6KX4f13FUjhW23R/wDJ
mcza69f2+rS3Mvh/xPcRyj+K1kXyuAMCPcUIJBOcAj3zTpNevZdZa6bw/wCKRbLCgjhW1dR5gLEl
gGAIwRx37jgV2Wl6+13qk+k3lskOoQIHkFvOJ4wD05GGU4I4dVzzt3AE1t0SVZPWX4EKeD29j/5M
zyC01DXEhlNxY+JhLPCyyGLTZTiQ/wAQLSkDHP3VX8OMXLTXtThntS3hzxKsUUcqSL5Esm9iV2t8
7E9jwScZwCa9TopOVV7y/BCTwa2o/wDkzPHTe6nLYXcVx4f8RSTT6alqZPsj5Mg3EknOcfMP14qe
41XVRLZix0HxLDFbBMmSCd2k+bLAjzNuMZwWDdcfLgV63RT5617834CbwTX8H/yZnkkl5dtcapNF
ofiqCS7mR0KW0uNoC5BAcYyVIyDkA9e1bVp4rnitIo5PCniVXVQCPsjS4/4GxBb6mvQaKluq1Zy/
ApTwad1R/wDJmcL/AMJdJ/0K3iX/AMF//wBlR/wl0n/QreJf/Bf/APZV3VFTap/N+BftsL/z5/8A
JmcL/wAJdJ/0K3iX/wAF/wD9lR/wl0n/AEK3iX/wX/8A2Vd1RRap/N+Ae2wv/Pn/AMmZwv8Awl0n
/QreJf8AwX//AGVH/CXSf9Ct4l/8F/8A9lXdUUWqfzfgHtsL/wA+f/JmcL/wl0n/AEK3iX/wX/8A
2VWofG5jiVT4V8T5Hpp//wBlXYUUctT+b8AVbCr/AJc/+TM8afWPEog1O3sfDfiDT7KV1eC1iErb
yZS8hEuwPBvXjCbgpOV245g06913R/sM9r4T1m4mt2vUMU8c2PLuJFkB8whmZlII5Hzdcg8V7ZRS
5J2tzfh/X/A6D+sYb/nz/wCTP+v61PHNFafT49HS48OeIdlvZxJeJFpxIkuIl2xupLDgBm6jOVj9
KzbK2u4NHuLGXwhr7yRadJZWs0kl3MJC23DGN22wD5FJVQ/bBAXB91opuNRtvm38g+sYX/nz/wCT
M8TTUPETadIJfDnib7Zc3qzXpWR0N1GItigywxRFNuFO1VG7bgtyav8AhS9vNEuo5rzwzr7tFpNv
pyvFYsWzG0mTyRgEMh6nkEdsn12ilyz25vw8rB9Ywv8Az5/8mfe54bG2tXFrBpd54Z1qGztdIudN
juoLZ3lmMuzEjRkKF+4SQHPXr3qTF5c6RfJN4R8R215KLcIBPeXPmCGTzApldw0ak8AIuV5OW6D2
6iny1P5vw87j+s4b/nz/AOTM8Wa91ODS3ksfBOvRau9ybhJnubqQ27eX5YfzZA5lOByrIq4wCDjJ
6+y8camk0i3vhrXpYRHGI3i0tkcvg+ZuBcjBOCMepB6ZPdUUcs/5vwF7fC/8+f8AyZnjl3qmtXGs
aig8J6uNNvdTtr83BtXM8YhEXyiPG3JMWN2/gNnB6VHFqOtx6jaQ/wDCKax/Z1rqtzqCzfZn85xK
svymPbgEGXruOQO3SvZ6KXLO1ub8PT/JD+s4b/nz/wCTPz/zPGtF1PW9Hl0NLfwrrkC21rDb6hcx
wu32hY1YbBCV29Tw+5WHuPlOnr/ifWZdfsNV0nwbrFwYLW4t3ivLd4h+8MZBG1XzjYcjjr1r1Kim
4ze8u/TuCxGFTv7H/wAmZ4ddHW/s+kWUGieJJrXTre0WMPDLAiyQyBmPlISrhwqgFydmOAa2YL+Z
fB2uaK/hrxDHPqUt4/mppxYDznYqTyDkAgH6V6xRQ1Ud/e38u4LEYZO/se32n0PFNV1TxPrM9nLP
4Y12JbcW7pbxtP5UckUu8naqqJN4CjLj5COAetQxjU531K1vPDPiJLOWC9gsnjiLfZ1nfccRiNWO
eM7pW6HGM8e40UnGb+136dxKvhVtR/8AJn0PEcXlzpF8k3hHxHbXkotwgE95c+YIZPMCmV3DRqTw
Ai5Xk5boJWvdTg0t5LHwTr0Wrvcm4SZ7m6kNu3l+WH82QOZTgcqyKuMAg4yfaaKfLU/m/APrGF/5
8/8AkzPOdc8V6re+HPslnoHiZb7935ki2TW4lAYF1DqWaPcARlQSM8Vzmmi6t7a0in8NeIQFuZvt
Sizkm862eQzCMs7biwfAy2cqXPVsD2mijlqXvzfgL2+Ftb2P/kzPGtMluLPX/Pm8KeJZbaO8nvIr
gtdM26TecC33iJGHmEb8nIB+UFsjX8MeJ9T0i0t9Nu/Busm0sofJguo7Vnmm5HzMpACE4yQGbJ78
V6dRSUZrTm/Ap4jCvX2P/kzPIPFer6xqM+qSaX4T1qYalpn9nuLu2eLyOXO9dqvuzv5Hy/dHJzwv
jHU9W8QWEFjaaB4mS2NpLBNGYZYAJGUBZD5ZzIB8w8tiFOcnOK9eoo5J2tzfh/XcPrOGvf2P/kz8
v8keLXeo6/LPdRReE9WNte3tnfTSvbyb4mi8reirtwwPlcMSvXkVLqt9qd7datBH4T1p7DUb61vW
eW0dXXyzEGj2AEEFYiQdw5OMd69koppVP5vw9P8AJCWIwyVvY/8AkzPHfE1zc6vrk15D4T8STwXd
mtpNHIbm1ESqXOdkL4mUhzlGK9PvfMcaFh4i1Oy8Uy3Fv4T8QWukyBmmRYXma5faqq3lsAIiADkq
53dwTyPUqKSjNfa/AHXwr3o/+TM8f8U6trOo3WrPpXhPWXTVdLFhIbq1eMwkGTDAKG3g+Z0yuMdT
mk13UtWvJdTFl4V1t49S0gafI09q6GFlEm1gAG3gmTnlcY79K9hooUZ2tzfh/Xcr6zhr39j/AOTP
y/yR43Jd6h/bwul8La5JafbkvWD2bBji0aBkxgjGdpznoTxxzCuq+JzpKWX/AAjviKC0juU8uwie
YbYBGV2fagqy43kNtx0G3dg4HtVFNxm95fgT7fC6fudv7zPHrDU9X02Lw2Y/C+uTS6bYyafODbOg
KMU/eI2GJYCMfKQOv3uMnN0+1uYtJudOuPCviNCumzafb3Wbq4LbwBu8qR9kI+UEqu7PGCNvPudF
DjUd/e/D+u7GsThla1Hb+8zxK6vNd1ia6m1HwhqkHnR2EXlQ28kqlYJzI5JKr1U4Ax16nvXXaZqV
54h8aSz6Vp8+lLaeSupNeyMss0ZDlY/s+0rnuH3KwB7jg9/XJeH/APkoXjH/ALcv/RRpNzjKN3fX
9P8AgFxWHrUavLT5XGKad2/tRj+TLuu6ZqUur2Oq6ZFZXE1vBNbtb3krRIVkKHcGVHOR5YGNvIY8
jHPNXXgfWrXSJdO0yTT7hbnQ49JlluZXh8tkDgOqqj7gd/3SRjHU1qP43uI9Hv8AVH0j/Rre6eyh
VJnkknmE3lD5FjJCHgkjcw5AU4GUsvHUzIsup6JcWMGZUaZllVS6oJFCCWKNmDKHGSowyY5yDWq2
0/r+r/iefdp2/rf/AIBreIdHudU8OLZWrxC6ikgmj81iEZopFfaSASAduM4OM5welYj+F9au9P1p
7kafFe3uo29/DDHO7xjyhF8jOUBGTEeQpxnoelWk8ZzrYXk11pIhntL21s5IRcbsNMIsnO3+HzcY
xzt6jPEVl46nv9dezg0K9ksvOlgS5SGflo9wLEmIRBCykAiUnlcgc4d2nf8Aro/8hJWSIj4V1eXU
H1OT7Clw2qR33kLO5QL9mEDrv2A5BJI+XnAzjPDNI8K63pR0aG3a0t1gtIbbULqK7djOqKw2CEx7
ep4k3Kw9x8p3/DGuT67p7z3Vtb2lwjBXtY53kkhyAdsqvGjI/PQjpggkGuev/Et/e6/oz28S2+jr
q01s0wumEk5jilDBogmNm5TjLH7oOPQf8r8vw0/ruGslf+urKunfDq4j0u4066dIwunS6fBdrqV1
cMwcAbvKdgkIwoJVd2ezLjm1beDryOyupJtNtnvXECRo2vXsmPLYsGE7qWTBOQqp65YhsC94Y8az
+I71Yzol3a2k0JnguGhnC7eMBy8SIGIII2M44PPQmTXPFl7pWqX9vb6VBc2unWKX11K14Y5PLJfI
jTyyGYCMnllByBkdaHe/9f13DfT+un/ALraTqV/4Kl0nU9QVtRuLN4JbuNeA7KRuAAXOM9gucdFz
gc+/hvxPcPqFz/xL7CaW0tLWKOzv5fnSKRmcGTylaLcrbQVBI7VpyeMXjk1yZtN/4l2jAmecTEyS
fuVlASPbyfmwcsMcHnJApW/jjVZtNu5z4YuluIDFtUx3SRMrttJLPbq+V6ttRgARz1wuv3C+zb+u
n/AG6B4N1DTL2zluJLZordL9QBPJK3+kSJIvzOMnGGBJOTwe5AXRfC+t6PJoaQGzgW2tYLe/uUu3
f7QkasNghMe3qRh9ysPcfKb8Pi2aTVbK3kt9PSzuLdZherfM0czEMSkB8rbKRtzjcrY524FReGPG
s/iO9WM6Jd2tpNCZ4LhoZwu3jAcvEiBiCCNjOODz0Javt/Wl/wDg+oPVa/1cu69pepz6tYappiWk
8ttDNAbe6naFCJNvzhlR8MNmMbeQx5HflR8O9QWysYZDBck6VDp10v8Aad1bRx7N2WCxY85TvPyN
s6dRuOPS6KS0/r1/zY7s5qw0fU7LxTLcW629rpMgZpkW6eZrl9qqreWyAREAHJVzu7gnkP8AG/8A
yL0P/YU07/0shroq53xv/wAi9D/2FNO/9LIaZNrbHOyf6xvqabTpP9Y31NNrUzOwrjPhZDdWt7q9
re2sltdW1np0EsUjKxDJAVJypIIOMjnoRnB4rs6474Xz3F1qGsXV3cvc3FzZ6dPJK6qpLPAWPCgA
AZwOOgGcnmuar8UPX9Gejgv4OI/wL/0uB3d5pdlfywy3NtG80DFoZcYeInrtYcrnGDg8jg8VQbwz
bfYY7eG6uoJIrmW6iuIyhkjeRmZsblKkfOwwQePcA1t0Vb1Vmcik1sYE/hOzu4DHdXV7OWtJ7R5J
JBudZSpYnjg5UYAwoHGMYAhbwZbyrO02qajLcSiEfaGaMMhicvGVAQKME/3cHuK0td1u30DTje3K
O6bguFKqMn1d2VFHuzAZwOpAOPfXuqrdaFJeGGDz7xw0FrMzKUFvKQGfA3cgH7oAOOuM0+RtcxpG
c27Jmk3h1P7Ra6j1G+iSSRZZreN0VJnUAbidu4ZCrkKwBxyOTmCDwla2+pW92l7e+VbTyXEFoXXy
o3dWDY+XcQd7HBY47YHFZCeM7mHSkmtdJElvbaVb6hMZr1i6xuHJUEqS7gJ1JG7uR3n0/X5h4i1T
TIQbq5fUBtjlmKpBD5ERJzg45JwoHJJPADMJVt0Vy1LNmzq3h201h5GuJJkL2c1mfLIHySFdx5B5
+QY/Hg0j+G7N1uVMk+Li9ivWww4ePy9oHH3f3S578nn0g8R3V3bXmjizBZ5LplMfmFFf9zIQGIzx
kA9D06VDb+KJrma1hSyQO6TPcFpjtjEUgR9pCndyeOBnvilzLUqNOq4qUS5D4atLd7Z4ZrhJLeea
ZXDDLCVmZ0PH3SWBx1+VeeKjtfC8MNw01xqOoXjCBreIzyqGijYgsFdFViTtX5mJbjryc8/eeNpb
7RtQWxNmJzYyXEJgvRI8ajGd4C/I4DAgDIyCMjrUsniqTRWGnvdeGkeFVDLfeImWYEgE7g0RPfgk
8jB46VVNOo/d6CqU6lOF5vc7CysbTTrVbaytYbaBM7YoUCKMnJwBx1JNWK43xMmq6X4e1fXtP1N2
njt5rmKJpCYkzGg4yCCF2MwBXBLdsk1TvvEmsaRreqXUlitxDa6TbXV1CLwiOEBpvM8vKfO5AGMh
AdvJGBVNa73OdHfUVxWofESysfED6cTp/lxXEVtKsl+qXReQLgxwFfnQb1ydwPDYBwMuTxnqc08K
w6FC0V1e3Fhbu18QWliMnLDyztjIiY7gWIPG09akDs6K4678bTW+h2uoG002BpJpoJzf6ottBFJG
zIVWQoS5JU7fkGQCTt6HLj8Z6hfwavqMlmv9jroEGoRwpeGOYM4kJAZUyCdpG4NxtUjliAW1sB6L
RXKXfi27gu7kW2kC4sbS6gs552uSkgkk2cqmwhkUSLk7gc544zU8PiwSJYO1psW61C5sifMzsEPn
fP05z5PTtu6nHLsOx0lFcb4Z+INp4i1WKzjOnn7TA1xB9l1BbiRVBX5ZkAHlPhhwCw4YZ4GdHWvE
s2jagto+neabpAtgyyn/AEifPMTfL8mB827n5Qx/h5QjoaK4688Zaha3V4o0SOW3s72GylkW8+dp
JVj27FKYIDSgHJXA5GelRS65fahqmlWsyfYbmHVpLS6itrlpI3/0SSRcMVUsPmQ8qMEe2aaV2Fjt
qKzNK0y40yBll1Ce8YxxqDMxPKoFJ5J+8RuPua5nRNX1ZRMotUub6ee5kYSXz+UkcchTAyh2nJAA
C4IGSQeKUmlKyNadGVSLa6Hc0Vys3i+T7PNc21hvgh09b5zJLsbDByFACnnKYPPGe9LN4nv7ZrsT
abCBaRrczEXBOIDu5Hycv8rfL0/2qnnRf1ap2OpormNS8Vtp+rRWjRWvlySRxqHu1E77yBuWLByo
JwSSDweOOakHibULTw/9tv5NGila9mhBvtR+zxlVdwAG8s5I24AxyBnOeKqPvS5UTKhOMOd7HZUV
y1lcz+LLLzItUsYTBI6ltI1A3StujZQGYKmCCwYDn7op8niK6sdVTQjYebfOU+yM0523EIH7yVm2
naVwcjnkpz83FSjy6PcwudNRXGJ4z1OaeFYdChaK6vbiwtna+ILSxGTlh5Z2xkRMdwLEHjaetQrq
d34j1SygSefTmuNO1CGVYJiwjmjmij3Kfl3YO7DYBwe2aSVxnc0VnCC50/Tb0pO1zMWklj85iAuc
kLnnAHTp+FZmia7dPp2lHU40D3Vj9oM6vkMwCkgjaMEg7uOBgjtkqTSdjSFKUo8yOkorlj4pvnLm
LSgUitI7yUPPtYI2/wCUDb9/CdDgc4yMctl8bWyaqtsptfK86OBg90FnLPjBWLHKjcMnIPBwDgZn
niafVavY6uiuPfxmw1ZrL7X4WGJ/K2nXcTfexjy/K+9/s568Zq3dmfw1bvfPd3GoSTOLe3tpJNqt
JLMSgyc4A3hc4OFXgHgVs6biveOa+tjpaK5y417V7W2toZ9GgXVbq6NvBCt7mBwEMhfzdm4KFVhz
HncMYwd1Uh4x1C5ltbSy0WJ76RLozRzXhjjieCRUcbxGxIJbKnaM8ZAycZjsdhRXJ23i+91VLZtF
0ZLotYw3twk12IWRZQSqJ8rB3wrdSi9Pm54r6j8Q7PT/ABE+msbDZDcxWsyyagqXW+TbgxwY+dBv
XJ3A8NgHAyAdpRXHR+MNSmVpRo0Udo93PYQTNefM0yM6qSvl8IxTG4EkE/dI5p2gw6t4i8MaNqd9
qMltcy2KGUW8hKyFjG4c4CgMQpBAGBvIBI60l30Dpc6+iudiuNTuLjUbzTmgmEdwLeOG4kZI3VBh
sMoba28sCdpzsxjuL+ha5b6/Ym6tkdFVyhDMjjI9HRmRh/uk46HBBAcqbSuK5p0UUVAwooooAKKK
KACiiigAooooAKKKKACiiigAooooAK5Lw/8A8lC8Y/8Abl/6KNdbXJeH/wDkoXjH/ty/9FGsqnxR
9f0Z3YT+DX/wL/0uBtnQNLOlz6abUfZJ5HmkTe2d7PvLBs5U7juBBGDjGMCmR+G9KjsDZNbGaEzJ
cMbmV5neRSpVmdyWYjauMk8KB0GK1aK1OExL3wlouoai1/c28zTNJHK4S6lSN3jIKM0asEZhtXkg
ngCpI/DOlQ6lJfxwSrM7NJtFzJ5auwIZ1j3bFc5OWUBvmPPJzr0UBcztK0Sx0YT/AGNZy87BpZbi
5knkfAwMvIzNgDoM4GT6mqw8J6Murpqi28wuEma4RRdSiFZGBDOIt3l7iGbJ25JJPU1tUUeYdLGV
pnhzS9IuGnsoJEYqURXnkkSJSclY1ZisakgcIAOB6CqGoeDLDVvEU+qahJNNDLbRW5tFmkjjbYzt
84VwsgO/G1gRx710lFFx33KKaPp6fbx9lRl1Bt10r5ZZfkCcg8Y2qBgcVTh8KaVBZy20X29Vl27p
RqNx52F+6ol37woyflDAcnjk1tUUCMSHwlo0E1lJHBPtsgPIia7maJSM4YxltjPyTuILZ5znmkh8
KaXZw3K2UBjaaF4VE0kk0cSN1VI2bainjKptBwPQVuUUPUFpsV7Gzi0/T7ayg3eVbxLEm45O1RgZ
PrxViiim3d3YkrKyCud8b/8AIvQ/9hTTv/SyGuirnfG//IvQ/wDYU07/ANLIaQznZP8AWN9TTadJ
/rG+pptbGR2Fcf8ADKyu9N1PW9PvlhFzaWun27+RIXQ7ISoIJVTyADjHGcc4yewrD8Lf8j14u/7c
/wD0U1c1X4oev6M9HBfwq/8AgX/pcDsqKKKs4xCAetZH/CMaYjWv2aH7LHbTNOkMGFjDMjIfl6Dh
yeMZPJzUuu63b6BpxvblHdNwXClVGT6u7Kij3ZgM4HUgHHvr3VVutCkvDDB5944aC1mZlKC3lIDP
gbuQD90AHHXGatRla/QqCbkrFtPB+npptxYia58qfTotOYll3CNA4BHH3vnOT06cVO/hq0YzOs1x
HLJeJeiRCu6ORUVPlyOhVcEHOQzetYKeM7mHSkmtdJElvbaVb6hMZr1i6xuHJUEqS7gJ1JG7uR3n
0/X5h4i1TTIQbq5fUBtjlmKpBD5ERJzg45JwoHJJPADMM+hry1LNnS3enxXlxZzyM4a1lMqBSMEl
GTn2wxqnaeHbSzuhOjyswWddrkEESyCRu3qMD29ar+I7q7trzRxZgs8l0ymPzCiv+5kIDEZ4yAeh
6dKht/FE1zNawpZIHdJnuC0x2xiKQI+0hTu5PHAz3xSutSo06vInF6P/AIJMvhW3FncWj399Jbyw
NbpGzriJCMYXC8nAGC+48deTndWNVUDHSuEvPG0t9o2oLYmzE5sZLiEwXokeNRjO8BfkcBgQBkZB
GR1qWTxVJorDT3uvDSPCqhlvvETLMCQCdwaInvwSeRg8dKqkue6gFeFSMeaozrdT06DVtKu9Oudw
guoWhk2HB2sMHB9eay5fCdrc2t/Dc3t5O9/YJYTzOUDlF34YYUAMfMbPGOBxVi1024/tD7e2pTPF
I7SCAOWjAZEUAc8gFSRx/Ea0Ly6isbG4u53CQwRtJIx7KoyT+QptKOzOZMy28NoNTe7g1PULaKWR
JZ7WB0WOZ1AAZjt3jhVBCsoOOQcnKweGbK3+xbJZz9jvZr2PLDl5fM3A8fd/etjvwOT34eW8tbTV
Zv8AhKL7xAiRaVb3T/Y5r7ZC7vM0hf7OcKBgAbuy8dK0l8Wz+GtF0u0v5rM3lws8sL6xqS2wNuj4
j3SbW3SFGj4xzhiSD1Bu9zbbwXaiWCW21LUbSWFrk+ZC0eWWeTzJEO5DgbgMFcMAOtRr4D06Oyks
472/S3l0waZIgdDviXdtYkqTvG9sEcc8g1zL+NHfWpfEEqqmkx6baSWqSam8KB7h3QGVQPLxkYLE
ttCAruJwNi08fvqEMMdhZ2F5eyX5sv8ARtR8y2z5RlDCZUJI2jB+QEHPGMErXcHcseJPCctzuudN
uLsPLd2k09mjosUpjljzI2RuyEXoGAO0cE1ch8HWkWpR3f26+aGK6lu4rNmTyY5JFcPj5NxB8xjg
scHpgcVmWvxFs7nxAunL/Z5SS4ltUWPUFa6Eke7JeDblUJRsHcTyuQMnCWfj6Y2MV/qWkC1tZ9Lf
UoDFc+a7KmzcjKVUAkyLtwSD329Keoa7m5pnhwaX8kWr6lJBHEYbaCR02WycYCgIC5AAAMhcjHuc
pqHha01SSaW9uLqWV7cQRSFlDWxBDb48L8rlgrZ55VewxVO88Uaho2i3N/rmmWllsMSwsuoB4XaR
toDyMilNpILHaQAcgseKzk+IscukS3UUWmPJDeC1lmXUw1jHlN4drgIcKRheUB3kDuDSEbp8LWjw
3CSXN1I1xewXsjsVBMkXl7eigYPlLkY7nGOMOHhmzGqf2h5s/nfbjfbdw2+Z5HkY6fd28+ue+OKz
xrk2rWmilNsElzI9xKLW5WZGhiySVkT7yM3ljoCQ+CByKxXa7XwH/wAJoNTvf7V+xjUdjXTi327d
/k+Tnywu35c7d38Wd3NO476HolYT+Frfaht727tpkaYiaIpuKyvvdTuUjGcY4yMDnrnPm8X3kN9q
A/shDp2n3MVvcXP2rD/OkbBkj2fNjzBkFhxyNx4Fa2+Itnc+IV05Tp7RyXMtrGqagrXQePdkvBty
qEo2CGJ5XIGThWuVGcobG2fC9h9lubZGmjhns0siqsPljQMBjIPPznk56CprvQLW8+3+ZJMPttst
tJtI4UbsEcdfnPXPauefxxfR+G9P1mXTtKs4r4eZG1/q4gjVCgZQzGPPmNk4UKRhSSw6VX07xzdz
z6hq11bxx6JFolvqKxiYNKhcSEjGwA52kctgbVP8RwJD9rU3ub8vhO1mvJJzeXapJOlw0KsuwyJt
wfu7v4BxnHtWjpulxaZHNHHLLJHLM8wWTB2FiWIGAOMknnPWuVsPiJDdiaPy9NuJ45rVD/Z2pC6i
2zyiPJcICGU5JUjpjB5OL954tuY9QksLPTI57n+0v7Pj8y5MaE/ZxPvYhGIGMjAB6Z9qSjZ3Q5Va
ko2k9DqAAOgrDuvCtpd3M1491drfPPHNHdKy+ZAE+6iZXATBcEEHIds5zWdaeMZb7X5tK+y2UW1p
UKf2gv2uMJnEj27KCEbGQVZjhlOME4n0TWfsPw1sNZv3muDDpcdxMxO6SQiIMeSeWPuepptdTOxd
g8M2Vv8AYtks5+x3s17Hlhy8vmbgePu/vWx34HJ7lh4ZstOvobuGWdpIhchQ7Ag+fKJXzgdmUAe3
XPWsx/F1/aGa0v8AR4otTxAbeGG8MkUvnOUXMhRSuGU7vlOBgjcTio4vFc02qw2mo6YbW4g1E2j+
TesyZ+ytNv4Vd644AYejYBAFPUNTr5EEkbI3Rhg1zN9oDDTtM0WAXM8EMgzcyMn7qIDBQ4wTlCyD
APXJPeqDePL2LTv7Qn0IJazabNqVqwu8s8aBSFkGwbHIccAsBzyav614yg0WXUEnhjVbWC2kWSWc
RozTyPGoZiMIoKAlueCeOMGXG5dOpKD0H3Xh6W+8QXksk9xb2ktrDCfJdR5oBk3IcgkDDLyMHng1
c/4R2Fb77RDd3cMRdZHto2URuwAAJONw6LkBgDjkcnPPp8RY5dIluootMeSG8FrLOuphrGPKbw7X
AQ4UjC8oDvIHcGun0bU5NW0SG/8AJgSSVSQsVys0TYJAKyLwynGQcA4PIB4pcq3KeIqOyuaO1fQV
T1XS4dX09rSd5IwWV0kibDxurBlZScjIIB5BHHII4rm28cTjT9SuBpH73SrSSXUImuCPKmUErErb
MPuA3buMKVOPmxTLrxnqtkdQE+gwL9gt0vZyL8kC3bd0/d8y/I3yfd4+/VbmJqyeFlms40m1nVJL
2K4+0xX7vGZY32lPlXZ5YG0lduzByTjPNPsPC1lp89tPHNcySwxTxl5GBMpmdZJHbAHzFlzxgDJA
GMYzLO3vNY1LXY11S7t1t9RKxhHPCtZxgKOeAGffj1GevNW/FTX1roVrBaSFpJLiCB5GnaJiC6qf
mUEgnoSOQCT1GKqXuq9y6cHOfIhq+C7aCC1istV1OyENpHZSNbyIGuIo/uhyUJUjLfMm1vmPPAxb
fw2n9pvdwanqFtFNIs09rDIojmdQAGZipkHCqCFYA45Byc1LbxDPG0QkssWLyyW0MxnLyM6BuWBH
CnY2G3EnjI54ih8Ualcx2hh0uDfd2jXkavdEARjZ947Dgnf2B6DnnjNyVjX6tU7EOgeEJId0+pXN
4AuoXV1HYmRDCGeWTZJwN2djA7d20E527ua6DRdIj0PR4NMiubieG3XZE05UsqD7q5UDIA4HGeOS
azrHxJPdhWaw2rPZG9tVWUF5FG3IYEBVPzLj5iOeorGm8Y313GIrFdPa4S5tQz29750RSSTbt3bO
Dxg8cA5B7U+dNhHC1JOx058P6dLpsWn3UAurZGLtHPgrIxJJLr91uSTyMZweoFaYAUYAwK5LVvGD
abqc1mbrwwhjIG281zyJRkA/MnlNt6+p4wa0HsdRhafVLW7e8kIeaKya4KxOSiAIHwcDKEg7erni
tpRla8mc3kb1Fce3jh5dNl1Gy0pprVJ4LUb5TG7TySKjptKn7hYAnPLAjtmiPxhqS3Ekd5otvClt
fRWN3JHelwry7NhjBjG8fvE3btmOcbqyGdhRXG6HZX2sae1y2r3kZS7vYcCRjkC7JXv2VNg9AxHt
Wtrd7qFpqmiw2giMNxctHPvfBIEbNgfKfQnqOQB0JIcko2KhBzlZG5RWGPEDGCH/AEUi4a4kgeIN
nZs3ZbOOmFGOn3h61Rg8XSrp8d9f2At4JrM3cOyYOSAASrZAAPzDByR646VDmkarD1HsjqqK5GLx
osljeyeboyy2wjcyNqYFttckANLs+Vsg8FfTnnh+mavL4oDwR6jpCGCSKYtpOqfamIDglXGxNqsB
jvnJrWMHJc3QynBwlyy3OrorkJvEU3h2S6sZ4mu7bStPF5d3ss5EjKfMwFXBDNmPuwGDnPFYGqeO
LvXNJnsdNOmNdi5s1kk07WjInlSzBMCVIwyPkbTwMBtwJIxUegkmz06iuF034gWTavBpKmxaMzSW
cajVBNdiSMMCZImG4KSjYbcScqSBk4ZJ8RXh0vTLm5tdKsptSha6t0v9W8iPyQE6uY/9YS4woBGA
TuHSgS2O9orhpviFNJZy32naQtxZwaZFqczy3flsI38zKqArBnHlnHIB/vDvsJr+oXerzwafpUdx
Y2s6W9zO10EkDlVYlI9uGVQ65y6nhsA4GTzA6GiuJtviDZ3/AIhXSUewCT3MtnH5eoK10sibgWeD
blUJRsEMTyuQMnF+4s7rStMSzOq3VxcXrwWiO7kOMKBIynPB2q759auMObqK509cl4f/AOSheMf+
3L/0Uauza9caVqsFjqcMLpdyFLWW2lBdv96Jju4yBlN/diEFUvD/APyULxj/ANuX/oo1jVi1KHr+
jO/Cfwa/+Bf+lwOtoooqzhCiiigAooooAKKKKACiiigAooooAKKKKACud8b/APIvQ/8AYU07/wBL
Ia6Kud8b/wDIvQ/9hTTv/SyGgDnZP9Y31NNp0n+sb6mm1sZHYVzngu8tb/xh4rubO5hubd/seyWF
w6NiNgcEcHkEV0dcV8KDulvz66ZpJ/8AJUVzVfih6/oz0cF/CxH+Bf8ApcD0uiiirOMQgHrWR/wj
GmI1r9mh+yx20zTpDBhYwzIyH5eg4cnjGTyc1Lrut2+gacb25R3TcFwpVRk+ruyoo92YDOB1IBx7
691VbrQpLwwwefeOGgtZmZSgt5SAz4G7kA/dABx1xmrUZWv0Kgm5KxbTwfp6abcWImufKn06LTmJ
ZdwjQOARx975zk9OnFTv4atGMzrNcRyyXiXokQrujkVFT5cjoVXBBzkM3rWCnjO5h0pJrXSRJb22
lW+oTGa9YusbhyVBKku4CdSRu7kd59P1+YeItU0yEG6uX1AbY5ZiqQQ+RESc4OOScKBySTwAzDPo
a8tSzZ0t3p8V5cWc8jOGtZTKgUjBJRk59sMap2nh20s7oTo8rMFnXa5BBEsgkbt6jA9vWq/iO6u7
a80cWYLPJdMpj8wor/uZCAxGeMgHoenSobfxRNczWsKWSB3SZ7gtMdsYikCPtIU7uTxwM98UrrUq
NOryJxej/wCCTL4VtxZ3Fo9/fSW8sDW6Rs64iQjGFwvJwBgvuPHXk53VjVVAx0rhLzxtLfaNqC2J
sxObGS4hMF6JHjUYzvAX5HAYEAZGQRkdalk8VSaKw097rw0jwqoZb7xEyzAkAncGiJ78EnkYPHSq
pLnuoBXhUjHmqM7aRS8TIrtGSCA64yvuMgj8xVK90sX9s1tcXc7QvGqOmEw+CCSfl74wR0wTgDrV
e1024/tD7e2pTPFI7SCAOWjAZEUAc8gFSRx/Ea0Ly6isbG4u53CQwRtJIx7KoyT+QpySRzIgTSrd
NWutSy7S3MEdu6MQU2oXIwMdf3hzz6VkReDYLS3t4rDVNRsntfMS3liMTNFC5BMIDxspQFVxkFhg
AHFYNzoj+d4Ze7v9ZS51G6b7aiavdRrzBLIUCrIAoDKMbcfdq/qni8eGdVtdJMFo1v5kECfadXBv
JRIwTekTBmkUE8lmBO1uDjJQGrN4SsZvOZri88ySC3hErS73QwszxyBmBJcM2SWyDgZGM5lh8OIs
tnNdalf3txa3JuVluHTLMY2jwVVVUKFY8KF55OSTnLtfGMl94gn0oW1lHteaMp/aCi8jCZxI9uVB
CNgEFWY4ZTjBOKXhXxbPdeE7eeG1m1JLHS45LqcSlppp/LB2IuCXPByxIGeBuIbax9DoLfw1Ha3r
SxanqC2hkkmWwDoIVd8ljwocglmO1mKgnpwMRL4O0z7HZ2khnlgtdOfTVV3A3xOEBLEAHd+7HIx1
PtjNtfGUuo6DqlzGummWFVjt5dO1FbyN5ZPlRCdqMrbivBXHzDBPOOenuNLtdQ1y31jUvExlt7mK
1tpba5vhGMwQhQWjPlBi7H7x6tzwaXkHRnZjwqr2U1veazql67mMxzTyRhoDGdyMioipkNzkqSej
ZHFSnw9MbLyv+Eg1j7V53m/bPMj3527duzZ5W3HbZjPzfe5rm77x9J4atbSy1ZtObUrfT4rm/Fzq
CWzuxBDCFdpEj5RuMqOVGeeNK58Y3K3M72eki5062uYLSa4a4KSeZL5ZyqbDlAJVydwOc8cZoEjV
0jw5aaO6vFLNNIEdWebblmeQyO5wo5Zjk4wOBgDFVP8AhDbTd5Jv786V5vm/2XuT7PuzuxnZ5m3d
zs37e2NvFJD4sWRLB2tNi3WoXNkT5mdgh875+nOfJ6dt3U455a6+J73+h6k2ktpguzpst7ZtBqKT
vGEAz5yBP3bgMCF+ZSQQWHUtp31C2huweEpLvXdaur65vIrO5v45haxyJ5VyqRRBSwwWGHVuAVzj
nIxWrb+Go7W9aWLU9QW0Mkky2AdBCrvkseFDkEsx2sxUE9OBjD1z4gp4fmW2vE0tLmG0S6uoptTW
FiG3fLAGQea3yNwdg5Xnni1J41YeJY9LitrLY8kaKJ78Q3MyuoPmRQsuJEGeSHByrgAkYIPXcsnw
bbLDpKWupahaNptqbOOSFo90kRCAq25CATsX5lCkdiKS18EaZaxfZ1nu3tW05dOlgd1KyxLu2ljt
3BhvbkEdecmq767cw6hcPaR/bJ7y++w2UEs5ihxEhaRywDYwwkBIUklVGO4sv4i1KK/02wm0eKK5
uYpprgNd5SFInRWKlUO/IcFchc8A7T0SFuPk8KC50+e1vda1W7eUxsk8rxq0BjbehRURUyGAOSpJ
6HIAFLZ+ErW1uo7p729ublb03zSzMmXkMHkchVAA284AHPtxWBYfFPTbpJ5pfsJgWxkvoxZ6glxK
qJglZkwPKfDDjLDIYFhjl9v8R0ntroRW+m3d3C9sqpp2pi5iYTSeWuZAgKsD1G3pjBPOGh+Rvf8A
CLxvqkd5canqFzFDK80FrM6NHC7hlJU7N54dgAzEDPA4GILHwclppf8AZM+t6ne6X9lNp9juBAE8
srtxuSJXyB33VjaxFqQ1G4utZtNcNq0UXkzaHfSGOzJGH3RIyPKQ/OfLfK44GCKn/wCEt+xRebCj
atN9k07FwsxiS58+VowyxnKxnOWOOTkA/dFJbBqyfUfCjQaXdTLJqWs6i5gCyyTwxTxrE+5PLOxY
9ylmYBh8x4Y46M8OeF52ml1LVftqXDaibyKO5kiaU/6OIP3vlgpkjc2EOBlfcU+LxhqS3Ekd5otv
CltfRWN3JHelwry7NhjBjG8fvE3btmOcbqW28X3ty4ebSVg0+W9msI7hbrdJ5qM6htmwfIdnXdkE
9MfNTVw30K7+CAms21v595c6KdOu7MxSypttkkMe2NMANjAbBO4jaOelaUfgy223LXOqald3M8cC
faZmjDxmF2eNl2oFyGbPIIOBkHnPM2/xFi0Tw7o8d1NZzXCaTb3l019qSwTShl/5ZBgfNf5WJBKj
JXnnjutS1Ke00c6hZWZvdoWQxB9jGPgsV4OWC5IXjOMZFLZB1Kp8PTGy8r/hINY+1ed532zzI9+d
u3bs2eVtx22Yz833uan0/Q00uwjtLW9ulAMrySERlpZJCWZ2+XGdxJwAB7Y4rGbxlc3ENlPpulxX
MGo3bW1hI9yYxKojd/Nb5CVUlCBjJI+b2LLHxfe3slotxpMdrBdTT2YkW7LutxEJN2F2AGP902Gy
D0yop2uJFmXwNpr2j2yXN5Es1pLaXTI67roPkl5CVOXDMzA8cu3Y4q7f+GbLUP7U82Wdf7Sslspt
jAbUXfgrkcN+8brkcDisvwtZXt/oOhanNq12zPZWkkkbOSHKxtuJJPO4uM/7o69l8Q6hdWniS2dg
5sbaymu3SK4ZGdlKD7oGG6gAE4O456DJK0ErM0pU3Uk4o37DSoNOuL6aF5Ga8mE8gcggMI0Tjjph
B685p9/p8WoxRRzM6iOaOYbSPvIwYfhkVhy+Jry0V4LvTo1vQ0ASOOcsjCV9incVBBBByMdMdc01
/FF/FJKG0yIpDdR2kjLcEnzHVMbQUGRucAkkcDOD0qHJdTWOHq3uvzLqeGLVLzzvtNy0KySTR2zM
vlxyPncw43ZO5uCSBuOB0xPbaBa2v2TZJMfstmbJNxHKHZyeOvyD9eKoSeJLiLTZ5pba0iuLe5+z
zebdhIIztDBjIVBxhlHC5ycdOap6X4lvtW1qy8lLZbKS1uGlAn3DfHIqblYLyvocjIYnHAyJq9kX
yV2m29Eaknhaxks4bVpJzHFYNYD5hkxttyTx975B7deKhPhC3cStJqF888nlfvyUDKY3LoQAu0YJ
9MGqGneMG1TUIrL7Z4YPnEriz13zpeh+6nlDcfxFWppbnwjYJd3dzNf2a+Ul3PNKc28aoFMu3ncC
w3NyMZJ5xWk6SjrLcwWIqLRM6UIAADyR3Peob61N7YzWq3M9t5qlfNgIDpnupIOD74rmn8V6s8lj
DbaFC097bz3USz3hjCxIyBS5EZKswcHGDg8Z6kZWp+Mr2/8ACl/Ktk2ni70SfULCaO5JlCqq53AK
NjAyKRtZs+3SpZmdAfBmmq+23e4trYm2c2sJURb4HVkfBUndhFUnPKgdwDVibwzZzfa90s4+1X0N
++GHEkXl7QOPu/ulz35PI7PtdKuE1H7a2pXDxs7P5DMdoDIigdegKE/Vj+NC41jVLXXdXX7PHNaW
lnFPHGsmHJJfOBt6naeM/wAI/vHDnZO17l04Sne3Q2dL0yHSbR7aBpGRp5ZyZCCd0kjO3QDjLHHt
SahpkeoSWkjTSxSWswmjaPHJwVIOQeCGI/wrM1HxMbR8W1obkfuAGD7QWlfaADjqBz+I9ar3Xix7
G3Md5BaW96LgQES3e2AZTfu8wrnGOPu5zxjHNQ5x6mkKFVWcUT2umSyavqmoPbvAsi+VFG5UljgB
pPlJ4YLGBnn5OgzUOjeFETRrWLUZbmWQWK25geQbYMqA4UqAc5HUk4xwRUFx42RNOs7qKbQovOMi
t9v1YW6lkbafLYRtvXPfjgjjnAtWy3HiS0h1CLVYIV2NGRpl4biFj5iNnfhcnCFenG4/jaorlUns
Eq9SL5Nv+Aamm6T/AGfvZ766u3cAbpyvAHYBVVe55xk9zwMaAUDoK4nT/FOsW/hOfU9Sg04ypqM9
uJJ9QEEEcazOgMkhjGAMbRhWLfKTjJxF/wALG36LZX6W2mRC4eeNprvVBFaBon2YScRkMW6qMDID
HjFFraGMm5O7OnufD9jeXOozXAkkGoWqWk8ZbC7FL4xjkH943Oewxiqo8LrJbmK+1jU74+dBKrzv
GNvlSCRQFRFXBI5ONxHGeBjDbxVPb+KZolieS6vdPsmtNPkuQEV3abcS67lUAbcsM5woG4lQegaz
k0+efVrvU5hbx+ZPJAXJjRfLQEdeg2Mw4/iNOMbkt2C28NR2t60sWp6gtoZJJlsA6CFXfJY8KHIJ
ZjtZioJ6cDEX/CJwRWOmQWOo31jNp1v9lhuofKaRosKCrB0ZTnYpztzkcYyc1f7T1PQtEt9Qvkhn
tTEJboS3IilhdjkhTIQjDLBQCybQvBbIFdJa3CXdrFcRq6pKodRIhRgD6g8g05QcV5AmY8/hOxuL
fUIZLi8YX1glhKzS738td+GDMCS37xsk57U5/DMf9qPeQanqNtFLIk09pBIqxTOoADMdu8cKoIVl
B28g5OdyioAxbTw4llqHnw6lqC2oledbAOghV3JLHhQ5BLMdrMVyenAxoz2UdxeW1y5bdb7ii8Yy
RjPTOcZH4mrNFNNrYCnaaXY2M89xb2yLcXDbppiMySdcbmPJAyQATgDgYFc94f8A+SheMf8Aty/9
FGutrz2PXU0T4g+JF+w3d7NeT2VvDDa+WGLfZ3fkyOqgYU96yqNuUL9/0Z3YNfucR/gX/pcD0Kiu
aTxpaTS2MFvp+oTXV4JttuqRh42hdUkVyzhQVJ6gkHacE5Ga0PxH0C48Qvo0cpaZZZIFdZYW3yIC
WURhzKPusMlApxweRnTY4bHXUVycfju3m0nTtQj0jUGXUp/Js4xLa7pjtLZDedsHQjBYNkYxSQeK
zBearHNDqFzOupLZ2tgsMKvnyVfCN5m0rtDPudlIyR2ALt0/rp/mC1OtormG8bWzLara6VqV1c3C
Tt9miWJXjMLhJFYvIq5DN2JBwcE8Zl07xhZ6tqdrZWFpdTC4s473z8xKscTg7Sys4c9MHapAJAJo
t/X9egPTc6KisrV9dTSpYLdLK5vrudXdLa1MYfYmNz5kdVwNyjrn5hgHms2Hx1pk+l3GoLb3git9
Mj1R1KLu8pw5Cj5sbvkPGcdOaW47M6eisLw9qsmqX2tK73G22u1iSKaKNfLXykYbSjHcDu3ZbBG7
GBioLLxna3l+tu+n39tBJczWkN5MIvKlli3blG1yw4RyCygHb6kAlheZ0lFcRZ/FTw7fJevA8jrb
Wsl2vlywyNNEn3iFSQsh5HEgQ89ODjZuPFljba3DpckF1vkWFjMFXy083eE3HdkZaPb06svrw7A9
NTeoritS+KPh/S3jW4Mq70aU75YIyIg7KJAryKXDbWICBmIx8oyAb8vjayj1CS3Fhfvbw3UVpLeq
sfko8oQpnL7yD5ijIU474HNJa7A9Dpq53xv/AMi9D/2FNO/9LIaXRNfvdT8Q67p0+nSRQafcCKK4
ym1gY0bB+ctuO4kfKBjGecik8b/8i9D/ANhTTv8A0shoXRg+xzsn+sb6mm06T/WN9TTa2MjsK5jw
Hp1tpHijxPp9ksi21utkkSvK0hVfLbA3MScDoBngYA4FdPWH4W/5Hrxd/wBuf/opq5qvxQ9f0Z6G
C/hV/wDAv/S4HZUUUVZyCEA9ayP+EY0xGtfs0P2WO2madIYMLGGZGQ/L0HDk8YyeTmpdd1u30DTj
e3KO6bguFKqMn1d2VFHuzAZwOpAOPfXuqrdaFJeGGDz7xw0FrMzKUFvKQGfA3cgH7oAOOuM1ajK1
+hUE3JWLaeD9PTTbixE1z5U+nRacxLLuEaBwCOPvfOcnp04qd/DVoxmdZriOWS8S9EiFd0cioqfL
kdCq4IOchm9awU8Z3MOlJNa6SJLe20q31CYzXrF1jcOSoJUl3ATqSN3cjvPp+vzDxFqmmQg3Vy+o
DbHLMVSCHyIiTnBxyThQOSSeAGYZ9DXlqWbOlu9PivLiznkZw1rKZUCkYJKMnPthjVO08O2lndCd
HlZgs67XIIIlkEjdvUYHt61X8R3V3bXmjizBZ5LplMfmFFf9zIQGIzxkA9D06VDb+KJrma1hSyQO
6TPcFpjtjEUgR9pCndyeOBnvildalRp1eROL0f8AwSZfCtuLO4tHv76S3lga3SNnXESEYwuF5OAM
F9x468nO6saqoGOlcJeeNpb7RtQWxNmJzYyXEJgvRI8ajGd4C/I4DAgDIyCMjrUsniqTRWGnvdeG
keFVDLfeImWYEgE7g0RPfgk8jB46VVJc91AK8KkY81RnbSKXiZFdoyQQHXGV9xkEfmKpXuli/tmt
ri7naF41R0wmHwQST8vfGCOmCcAdar2um3H9ofb21KZ4pHaQQBy0YDIigDnkAqSOP4jWheXUVjY3
F3O4SGCNpJGPZVGSfyFOSSOZEN5pcN9d6fcyvIHsZjPGFIwWMbJ83HTDnpjnFY934Ltby/urltS1
GOK5uYruW1jeMRtNHs2tnZv/AOWa/Lu2+2awbnRH87wy93f6ylzqN0321E1e6jXmCWQoFWQBQGUY
24+7V/VPF48M6ra6SYLRrfzIIE+06uDeSiRgm9ImDNIoJ5LMCdrcHGSh6mt/wi8b6pHeXGqahcxQ
yvNBazOjRwuwZSVOzeeHYAMxAzwOBhLfwlZWkNpHb3V7ELfT/wCzi0coRpYgAFLEAHcvJBXGCzet
ULXxjJfeIJ9KFtZR7XmjKf2govIwmcSPblQQjYBBVmOGU4wTil4V8Wz3XhO3nhtZtSSx0uOS6nEp
aaafywdiLglzwcsSBngbiG2voHQ27XwnDFdm8u9RvtQui8TGa5EQJWPcUTCRqMBnLZxnOOcDFXBo
Fg0erRTI08OqyF7mKXBU5jWMgcdNqD8SawbXxlLqOg6pcxrpplhVY7eXTtRW8jeWT5UQnajK24rw
Vx8wwTzjnp7jS7XUNct9Y1LxMZbe5itbaW2ub4RjMEIUFoz5QYux+8erc8Gl5B0Z2H/CIqiQ+Trm
rQyLbrbTzJJH5lzGpO0OxTII3MNybW565AIp+JPCct1uudNuLsPLd2k09msiCKUxyx5kbcN24IvQ
MAdo4JrPvvH0nhq1tLLVm05tSt9Piub8XOoJbO7EEMIV2kSPlG4yo5UZ540rnxjcrczvZ6SLnTra
5gtJrhrgpJ5kvlnKpsOUAlXJ3A5zxxmgEWofB1pFqUV39uvmhiupbuKzZk8mOSRXD4+TcQfMY4LH
B6YHFEfg63GnXGmy6pqc+nyWr2kVs8qBLeJhjC7VBYgAAFy5GOvJykPixZEsHa02Ldahc2RPmZ2C
Hzvn6c58np23dTjnlrr4nvf6HqTaS2mC7Omy3tm0GopO8YQDPnIE/duAwIX5lJBBYdS3cXQ66bwt
5rxyprWqQTmBbe5mhaJXukXON58v5T8zfNHsPzdeBh154Yjvr4TTapqJtPOjnaxLo0LPGQVOWUuO
VU4VgCRyOTnF1z4gp4fmW2vE0tLmG0S6uoptTWFiG3fLAGQea3yNwdg5Xnni1J41YeJY9LitrLY8
kaKJ78Q3MyuoPmRQsuJEGeSHByrgAkYJYDSn8M20um2lrFdXVtLaSmaC7hKeajndublSp3BmyCpH
zdM4Ifa+HYLe6tbqS7vLqeCCaAyXMgcyCVlZi3AHVBgLhQOAMYxlPrtzDqFw9pH9snvL77DZQSzm
KHESFpHLANjDCQEhSSVUY7iy/iLUor/TbCbR4orm5immuA13lIUidFYqVQ78hwVyFzwDtPRIEPtv
CNtDaS2M+oahd6e1u1rHZzSKI4YiMbV2KrNgAAM5ZhjgjJy4eF1ktzFfaxqd8fOglV53jG3ypBIq
hURVwSOTjcRxngY5+w+Kem3STzS/YTAtjJfRiz1BLiVUTBKzJgeU+GHGWGQwLDHL7f4jpPbXQit9
Nu7uF7ZVTTtTFzEwmk8tcyBAVYHqNvTGCecC8h9TeuvDCyX9zd2Or6jpjXZDXKWhiKzMAFDESI+1
toAyu0nAz0FMPg3S9w8ozxIq2iLGjjCi3kMidQScknJJOR6HmuY8W+L10/VYln1my0640q1S9ubM
XoH2mRmGYV3bTIPLWTqvV4zjPTpj4pVppYYbYSSGW3W2xJxPHMMiTOOMASHHPCe/AtBbMsTeGbOb
7ZulnH2q+hv3ww4ki8vaBx9390ue/J5HbI0HwhJFum1G5vAF1C6uo7EyIYQzyybJOBuzsYHbu2gn
O3dzVFviS0M+owzWFg0tpY3F35FrqqTyoYSMxzKq4jY7uxcZBGTitF/GN5bPe295pEcd5GLY20Ud
3vWbz3ZIwzFBsIKndgMAOhbpT13HdlpPBtvbwWsNjqmpWSw2kdnI1u8Ya4ijBChyUJUjLfMmxvm6
8DGlqOjJqdrLaXF3dfZZSm+FSoDIOqE7clW/i5yRxkA1jap4tutC02GTV7LT7G8nuvs8Xn6kFtT8
hfeZigKjAIwUzu4xj5qzZfibZ/2dYzQtpKXFz5+TeaqsNt+6YI2yba2/JIK4UZGSduMUhHQReFbK
DUI7mOe5WOK8a8itgV8qORo2Rto25AbezEZ+8c8ZILo/C9lEloqy3GLW8nvUyy8vL5m4HjoPNbHf
gcnvLZ6y+q+GItY0u2E7z2wnggllCbiRkKXAYD0yMisVvHDy6bLqNlpTTWqTwWo3ymN2nkkVHTaV
P3CwBOeWBHbNFxpvodJpWnQ6RpNnptuztDawpCjSEFiqgAZwAM8elQ3+iWmpXDS3O9g1rJasgbAK
OVLe+flHOfWsGPxhqS3Ekd5otvCltfRWN3JHelwry7NhjBjG8fvE3btmOcbqbodlfaxp73LaveRl
Lu9hwJGOQLsle/ZU2D0DEe1NRUtxxk46o1Y/C9vnfcXt3cz+ZC/nSlN2In3ovyqBjOe2Tk89MWH0
C1fz8yTfvryO8bBHDpswBx0/dj8zzWd4qmvEutHghO22luj55W5eFiFjZsZUZxwT1GSAOhJEf/CW
XENk91dacI43snvbYLNuZ0XB2uNo2Nhl4G4deeOc+ZI6lGtKKknuXrrwxbXEjypd3UEzXX2sSRlC
VfyxGQAykY2juD1pbLwxa2F1b3EFzdB4TL95g3mCRtzBsjP3gDxg8daoXfijULM3PmaZCRaWyXVx
tuScIS/C5TlsJnBwOcZ4ybJ8Q3UUV8s9nClxbIkqr9pATy3JAZ3ZRtxtYtwcAcZ6Ue7e4NYhRtfT
5f11Og2gc4FUdR0qHVXtRcySmGCUTGAEbJWH3d4xkgHDAZHIGc4rmoPFV/qV5py2iWflm/a2uGhu
fMjcCEuNjbORjntyuOhJEj+M2XVmsvtfhbifytp13E33sY8vyvvf7OevGa0hF1FdHPVpSpW5upp6
f4Vs9OuYJYrm6dbeKeCCORlKxRSsjbFwoO1dgC5PA454xBL4K02bS7fT2nuhFBpkmlqQy7jE4QEn
5fvfuxz05PFOmg1DQbefUYpbjVdgYtbPKVIQys7FeuWVWwBxkKBkVUbxjc3ENlPpulxXMGo3ZtrC
R7kxiVRG7+a3yEqpKEDGSR83sXK17J3M03Y6xV2qFHYYrNn09YNQuNWj+0SStbiJraMpiTaSV+9j
5vmI+8BzzWFY+L729ktFuNJjtYLqaezEi3Zd1uIhJuwuwAx/umw2QemVFO8LWV7f6DoWpzatdsz2
VpJJGzkhysbbiSTzuLjP+6OvZcierdilJx1QweHLkeGbe0WN1me9hmdQ4DRRrIuFznGUjUDjrt75
rVPhiEwEG+vDd+d532wlPM3bdvTbsxt4xtx3680y9v8AU4vFdvaW8cL2rWUsrK0m0l1ZAP4T6gdf
4iewzHdeKvJ0tbyKzaQ/YXvJELY8vaB8hODzk4/A+lZPlW51uVeVuXrr95tWVktnarD5ssxGSZJm
yzEnJJ7fgAAOgAFWAABXNXPimXT4Z/7QtIYJgI2izcDyyrttG9iBswfvcHA6bulVm8aKdJa6WbRI
3jufs7tc6qI7djt3DZKEO44I42jofTnSL5nyowqUaiTnJFp/BluYlWHVNRt2iv5L+3eMxEwSSB94
UNGQVPmOfmDEZ4I4p0fhBbWyS2sdb1e0KyTSNKkkbtIZW3MGEiMp+bkHGRyAcEgw2VzP4rsvMi1S
xhMEjqW0jUDdK26NlAZgqYILBgOfuiqthrmtWieJ2uoba4i0y5WK2L3gj+Xyo2JkZkAVQG3lssRl
gAdo3XKPKtXqYq71NH/hC9KWzntIzcRxS2UFmuxxmJYSxjdCRkOC2cnPIHHrr3dgl7pxsp5JGjZQ
rtxlwMZzxjnoeO56Vx8PxF87Sbi7W30xmgvhaPcJqm6xUGMSB2uBH8q8heU+8QO+ajuvGRg1LRtQ
n+VLrT7rZaWt2s0dxKJYQhRwQrAjcQ5xtUktt5xKugsdnJpVjLqMd/LbJLdRLtikkG4xdQdmfukg
4JGM8ZzgVcrFTTb+4uob+5vJLZ8RNJaQTM8Sld+4BiFyDvGTtH3Bx6UbfUdRj0uTWYTBcWcsss7p
PMYysAPyNGxyo+Rc7TtBLZLLznTk5loxI6iiqWk6nDrGmw30CuscoyA+M/gQSGHoykg9QSOau1m0
07MYUUUUgCvM5tCvNb+JGstZ37WRs7yzneaPaZAv2WVPkDoyk5YdR0z3xXplcl4f/wCSheMf+3L/
ANFGsqnxQ9f0Z3YT+DiP8H/t8DR03wrY6ZdWVzFNcyTWsc6b5XBMrTOryO/H3iy54wBk8YxhbTw4
lleyTW+qagls0kkyWQdPJjkfJZh8u48sx2sxUE/d4GNuitThOUk8DRS2Oo2763qbNqT7r2Yx2u6d
dmzay+TsxjuFDHuTgYsN4LsFErW13e207XKXUU8bqzwusQh+XerAgoCDuDZ3E+mOjooAwrHwpY2F
xaXEc1y81vFcIXkdSZWndXkduPvFlzxgDJAGMYrweC7WA6NH/aN9Ja6QE+zWz+Vt3KpUOWEYfODy
AwB6YxkHpaKdw3MjWdCXVZILiG+ubC9gV0juLYRltj43IRIjLglVPTPAwa562+HiyeHbSwu9Uu7a
f+y0029+wtHsuEUHjLxkjBZsFdp55ruKKS0/r1/zHdmfpuj2+l3F9NA8rNeyrLIHIIBWNYxjAHGE
HrzmsHRPBclncm51PUZ7kR311d29mpTyIjK74bhA7NscjDMQCxx2NddRRcXSxz1v4QtodOuNNm1D
UbrTpLZ7SO1mlXZBEwwVXaoLYGAC5YjHB5OYYfBNqI78XmqalfSXtrHavLO0avGiFihTy0XDAsSG
65Arp6KAuYdz4XglukntL++079wltKlm6KJolztUllJXG5gGQq3PXgYS48KWNwL4PLcj7bewXsmG
Xh4vL2gcdP3S5zk8nkVu0U7vf+u4GZa6JHZa3ealBd3Ki8Iae1+QxNIFVQ/3d4O1QMBtvtnmqHjf
/kXof+wpp3/pZDXRVzvjf/kXof8AsKad/wClkNIGc7J/rG+pptOk/wBY31NNrYyOwrD8Lf8AI9eL
v+3P/wBFNW5WH4W/5Hrxd/25/wDopq5qvxQ9f0Z6GC/hV/8AAv8A0uB2VFFFWcghAPWsj/hGNMRr
X7ND9ljtpmnSGDCxhmRkPy9Bw5PGMnk5qXXdbt9A043tyjum4LhSqjJ9XdlRR7swGcDqQDj317qq
3WhSXhhg8+8cNBazMylBbykBnwN3IB+6ADjrjNWoytfoVBNyVi2ng/T0024sRNc+VPp0WnMSy7hG
gcAjj73znJ6dOKnfw1aMZnWa4jlkvEvRIhXdHIqKny5HQquCDnIZvWsFPGdzDpSTWukiS3ttKt9Q
mM16xdY3DkqCVJdwE6kjd3I7z6fr8w8RappkIN1cvqA2xyzFUgh8iIk5wcck4UDkkngBmGfQ15al
mzpbvT4ry4s55GcNaymVApGCSjJz7YY1TtPDtpZ3QnR5WYLOu1yCCJZBI3b1GB7etV/Ed1d215o4
swWeS6ZTH5hRX/cyEBiM8ZAPQ9OlQ2/iia5mtYUskDukz3BaY7YxFIEfaQp3cnjgZ74pXWpUadXk
Ti9H/wAEmXwrbizuLR7++kt5YGt0jZ1xEhGMLheTgDBfceOvJzurGqqBjpXCXnjaW+0bUFsTZic2
MlxCYL0SPGoxneAvyOAwIAyMgjI61LJ4qk0Vhp73XhpHhVQy33iJlmBIBO4NET34JPIweOlVSXPd
QCvCpGPNUZ20il4mRXaMkEB1xlfcZBH5iqV7pYv7Zra4u52heNUdMJh8EEk/L3xgjpgnAHWq9rpt
x/aH29tSmeKR2kEActGAyIoA55AKkjj+I1oXl1FY2NxdzuEhgjaSRj2VRkn8hTkkjmRDeaXDfXen
3MryB7GYzxhSMFjGyfNx0w56Y5xWPd+C7W8v7q5bUtRjiubmK7ltY3jEbTR7NrZ2b/8Almvy7tvt
msG50R/O8Mvd3+spc6jdN9tRNXuo15glkKBVkAUBlGNuPu1f1TxePDOq2ukmC0a38yCBPtOrg3ko
kYJvSJgzSKCeSzAna3Bxkoeprf8ACLxvqkd5capqFzFDK80FrM6NHC7BlJU7N54dgAzEDPA4GEt/
CVlaQ2kdvdXsQt9P/s4tHKEaWIABSxAB3LyQVxgs3rVC18YyX3iCfShbWUe15oyn9oKLyMJnEj25
UEI2AQVZjhlOME4peFfFs914Tt54bWbUksdLjkupxKWmmn8sHYi4Jc8HLEgZ4G4htr6B0Nu18Jwx
XZvLvUb7ULovExmuRECVj3FEwkajAZy2cZzjnAxVwaBYNHq0UyNPDqshe5ilwVOY1jIHHTag/Ems
G18ZS6joOqXMa6aZYVWO3l07UVvI3lk+VEJ2oytuK8FcfMME8456e40u11DXLfWNS8TGW3uYrW2l
trm+EYzBCFBaM+UGLsfvHq3PBpeQdGdh/wAIiqJD5OuatDItuttPMkkfmXMak7Q7FMgjcw3Jtbnr
kAin4k8Jy3W65024uw8t3aTT2ayIIpTHLHmRtw3bgi9AwB2jgms++8fSeGrW0stWbTm1K30+K5vx
c6gls7sQQwhXaRI+UbjKjlRnnjSufGNytzO9npIudOtrmC0muGuCknmS+Wcqmw5QCVcncDnPHGaA
Rah8HWkWpRXf26+aGK6lu4rNmTyY5JFcPj5NxB8xjgscHpgcUR+DrcadcabLqmpz6fJavaRWzyoE
t4mGMLtUFiAAAXLkY68nKQ+LFkSwdrTYt1qFzZE+ZnYIfO+fpznyenbd1OOeWuvie9/oepNpLaYL
s6bLe2bQaik7xhAM+cgT924DAhfmUkEFh1LdxdDrpvC3mvHKmtapBOYFt7maFole6Rc43ny/lPzN
80ew/N14GHXnhiO+vhNNqmom086OdrEujQs8ZBU5ZS45VThWAJHI5OcXXPiCnh+Zba8TS0uYbRLq
6im1NYWIbd8sAZB5rfI3B2DleeeLUnjVh4lj0uK2stjyRoonvxDczK6g+ZFCy4kQZ5IcHKuACRgl
gNKfwzbS6baWsV1dW0tpKZoLuEp5qOd25uVKncGbIKkfN0zgh9r4dgt7q1upLu8up4IJoDJcyBzI
JWVmLcAdUGAuFA4AxjGU+u3MOoXD2kf2ye8vvsNlBLOYocRIWkcsA2MMJASFJJVRjuLL+ItSiv8A
TbCbR4orm5immuA13lIUidFYqVQ78hwVyFzwDtPRIEPtvCNtDaS2M+oahd6e1u1rHZzSKI4YiMbV
2KrNgAAM5ZhjgjJy4eF1ktzFfaxqd8fOglV53jG3ypBIoCoiryRycbiOM8DHP2HxT026SeaX7CYF
sZL6MWeoJcSqiYJWZMDynww4ywyGBYY5fb/EdJ7a6EVvpt5dwvbKqadqYuYmE0nlrmQICrA9Rt6Y
wTzgXkPqddYaVBp32wxtJI93cNcTPKQSWbAx06BQqgegHXrWdZ+ENOsprCRHuH+wxSwwKzgKqOeB
gAZ2AlVPUBj1JzXKRi8v9e1s3ukeI72SK6jQDStbMMEP+jxMUUG4hz8zMc7BnP4Dor7xDLoLWtid
Mmb7RAiaeJbku80/QwyNhtpAwxfLZAc/w8gnoyCP4eWC2Qs5dU1SeFLGXT4VkeMCGBwoKqFQZI2j
5myfUmtS+8L2WoT3c8ktwktxFBGHjYAxGF2eN04+8GbPOQcAYxnObL4vv4L6/V9Gj+w6dcxW91cC
7+bLpG2UTZ8wUyc5K8DIyTgVrb4i2dz4hXTlOntHJcy2sapqCtdB492S8G3KoSjYIYnlcgZOBdkP
W5sN4XEloiy6zqkl7HP9ojv3eMyxttKfKuzywNpI27Mck43c0S+GA6WrxazqcN9AHX7crRvLIrkM
6sHRkwSFOAo24AXA4rE0fxRr2seINDdrC0tdL1DTpbvy/tZeTAMW1iPKGCN+NobBDEk5AB3df8Q/
8I80M11aM+nyBkaeNiWSX+BNmOd5+UHP3sDHOaGItSaSz6ebKPUr+KMweQHWQNIP9vewLb8cZJ9+
vNZ58Gaar4t3uLa2JtnNrCVEW+B1ZHwVJ3YRVJzyoHcA1n6j4y1TTftYl0GFmsLCO/vQL4/IjGTc
qfu/ncCPjO0HnkY5h1XxFqE0b2c9t/Z91DeadIDBcl98M1yFwx2rhiFYMvIwepzTS10Gkb03hmzm
+17pZx9qvob98MOJIvL2gcfd/dLnvyeR2u6XpkOk2j20DSMjTyzkyEE7pJGdugHGWOPaoNN0ueyu
Xml1G4uVYOAkjEgZkZx37Bgv0UfSuettU1OLXNSYwLPPJe/ZLaM3jiNVEQcll24XjnIBJLY6c0pt
Rdk7l0qcqqb7HU3umw381pLKzg20hkQDGCSjJz7YY1lJ4PsxbS273d5LE1q1pErsv+jxNjKphefu
ry24/KOeuY4vE9xcXFvbxWKiYrM1wHlwI/KcI+CFO7k5HTI9KgtvFOp3UdsY9KgD3Vn9shDXRA2D
buDHZwfnGMA574qG4m8adeKsvzRr3egWt59v8ySYfbbZbaTaRwo3YI46/Oeue1R3/hu1v5ZpXnnj
kkWEboyvyGJi6kAgjOW75HTis3VPGQsLK1vUitfs01qLkfaLtYnkBGdsa4JZgMcHA5AyecNg8Q38
Ntrl3dNpscNrdrHA15eeRGFKocM/lnH3sjrksR0AJpWk7IOWtGPPeyRfi8K20TpIL28M63QujKWU
sz7PLIPy4wV4wAPbFbu1fQVyumavL4oDwR6jpCGCSKYtpOqfamIDglXGxNqsBjvnJoutbuvDJt9M
nt5L6SaMJYztMc3U+eY34OzAw27n5Qx/h5tw5NOpzTqyqaydze1XTItXsWsp5ZUgdh5qxEDzUB5R
sg/K3Q4wSOM1nxeFbKC/juY57lY4rxryK2BXyo5GjZG2jbkBt7MRn7xzxkg5d54y1C1urxRokctv
Z3sNlLIt587SSrHt2KUwQGlAOSuByM9Kil1y+1DVNKtZk+w3MOrSWl1FbXLSRv8A6JJIuGKqWHzI
eVGCPbNJLURtx+F7KJLRVluMWt5Pepll5eXzNwPHQea2O/A5Pe/pWnQ6RpNnptuztDawpCjSEFiq
gAZwAM8elQaTplxpkLLNqE94xjjUNMScFUCk8k/eILH3NZWi65qDWsD6lDEfPvp7fzI5M7NrPtyN
o4+Ur/3ye5wSaTtcuNOU02uhs3OmRzapb6kJZklgR49qEbZFbBIOR6qDxjpXPNod1P4e19ltXjut
QWUQ2zsu5FIOFJBK5Ls7df4varbeJb2a8S2sdNSRpFmdGlnMalY3Vcn5ScHdkcHt65FS98d29sIn
VbZF+zrcSpc3SxSYOfljXB3sNp4yB0wTnjJuLZ0whXjol2NNfDEDwy+feXcszhAkzsu6EIdyhcKB
weeQc98jitDT9OFhA0bXM907NuaScgknpwFAUDA6AD16kmud1Txn9g1GW2W78MIqbSFvNb8iUZAP
zJ5TbevqeMGmeJk1XSvD2r69p+pu08dvNcxRNITEmY0HGQQQuxmA24Jbtkmt/Zcur0OadacrxbOx
AA6DFc/e+ELW9fUib6+iF9PDcssZjxFNFs2um5Dz+7TIbcpx061m+JvGt14XsoJruz0tT9lM8gn1
ZYTIw+9HACm6Vh7hByvcnE03jN18SppKWlmA0kaBbjUFhuZQ6g+ZFCy4kQZwSHzlXABIAMNEalqL
wkLeK4MOuavHd3FwtzJdiSMuzhAn3SmwgqB8pXAOCACBh9r4P023EQdprgLBcwSiYqROJ3V5WcBQ
Mkr2wBkjHTGR4X8Qz38k2kwlrqaO8vPtU8s5H2dBcSKirkEu2NvyjAVcZIyobQuLO60rTEszqt1c
XF68Foju5DjCgSMpzwdqu+fWtIwvpcTdjZttO+zaMmm/a7mYJD5IuJWUykYxknGCffFNbRNOlWzW
a1jlSyCi3SQbljK42sF6bhjhsZHOCMms+bXrjStVgsdThhdLuQpay20oLt/vRMd3GQMpv7sQgroK
T5ooQdKKKKgYUUUUAFcl4f8A+SheMf8Aty/9FGutry7Uru6h8aeJbawS/a6nvdKINpDIwEalfM3u
owo2k/eIyM9cGs56zgvP9Gd2E/g1/wDAv/S4HqNFcZoDamviSQ3a6mdIkMn9mecZCyHPz+eCMgH/
AJZ7yeMjgkCqnimDWp/EVw1o2qi3iSwEQtZJUjJe4ZZ/uEBiI8ZznaMHg4NaK7t5nD38jvqia5gS
5S2aaNZ5FZ0iLAMyjGSB1IGRn6ivOwupRWVlDq//AAkP9lwz38ZNm1y1wWE2Lcs0eZWXy9+CSVPy
7u1STWF//aXhLVNcTVRcx6bJBcy2YmcpcN5RG9IcjHD5yNhwM9qPP+uv+X4oduh6LRXJ+A2uF066
tpk1GRYZFVb2++0q10doywjuCXjweMAlSeQeoGNo9v4hbxs0l7qF+ri7mMsH2K48g2/zeXiRpvs+
MeX9xPMz1/jNO2thdLnoEFzBdIXt5o5kV2QtGwYBlOGHHcEEEdiKlrkPAdgulx6rZyRajHci/nkf
7SZ2jKNK7IY2fKHKkE7DnP3uaxLCHXj4suJtR1DU1C3FwZ7eKxujEbbDbAsnneT93y8eWnm56/xG
l/kNrfyZ6VRXlOoXOs2Xh26OrS6zFvntBayRSTbxZtcIuxjGARcYJDDliCME81fgt9WvHs4LaTXo
tHk1krG07zpP9l+zNu3s581VMu7BcgjIxj5aaV/69P8AP8GLpc9Horzi9s/EH/CbMi6jqMEUc8As
kjtLmeNrcKu/fIJlhznzNxlUv3GTsqJ0uzHrdr9q8QbPOSY6j9n1DLfvifIWEEMBt48yAgYxkDA3
Lt/X9f56bg9D0NNQtZNTm05Zc3cMSTPHtPCMWCnOMclW/KrNeZKdfkgvbiG01u0gm0+wZ7drmeZ4
181hOI2f5vM8oA8APyDgOanhttTvHs7eB9eTRpNYIjM0txHP9m+zNu3sxEqr52cFyD0xxtp2/r5/
19zHbr/W1z0aud8b/wDIvQ/9hTTv/SyGuUH9rWselvP/AG7dy217cQxWQ+2L50f2jEbvOny/KgGP
OyrjqRktXV+N/wDkXof+wpp3/pZDR5iejaOdk/1jfU02iUzea+23Z1yfmEkYz+BYGgZxyMHuMg4/
LitTI7CsPwt/yPXi7/tz/wDRTVuVh+Fv+R68Xf8Abn/6Kauar8UPX9Gehgv4Vf8AwL/0uB2VFc/H
r8+o6zPpumQwqbVwLmW6lAZR22xA7znBGX2AjDKXFVJdcu4NSke1hF2bu++wWySTmOJfLjZnYkBs
fMHU4GflHpWzptK7OVK7sjqiAetZH/CMaYjWv2aH7LHbTNOkMGFjDMjIfl6DhyeMZPJzWLF47trr
Vzp6my2yTS28YjvVa4V0DZLw4yqnY2DuJ5XIGTil/wAJlPoPhLRbm5W0m36ZFcSSXuorDJOwQFlj
UhjI/c5wPmHJycRzWRoqc1qjfTwfp6abcWImufKn06LTmJZdwjQOARx975zk9OnFTv4atGMzrNcR
yyXiXokQrujkVFT5cjoVXBBzkM3rWLH4qvLGLxBd6itsLa2v47e0LXAQDekeA7FAFX5wxbLEZYYO
BmWy8aPqUAisLayutQNybcLDfB7Y4TzCwmCE42nGNmd3GMc0m0tCnGornR3enxXlxZzyM4a1lMqB
SMElGTn2wxqnaeHbSzuhOjyswWddrkEESyCRu3qMD29ayvD+uRLooi1O/ig1Ge6u1ignuQZDtnkA
VcnLYwAMegrN0vxPNZaLZO1vPeXZ0/TdzSXTfvWnYpnByAQcknq2RnoKdug0qiVkzfXwrbizuLR7
++kt5YGt0jZ1xEhGMLhRk4AwX3Hjryc7qxqqgY6VxF/4pmiuLGTUF+wmz1R7a6jt5mlST/RXkUD5
VL53Jxt+8Poavaj4su9Ns7KW4srC2e6R5A15qHlQoBjahlCEGQg52jj5WwxxkpWS0FNVJfEdTIpe
JkV2jJBAdcZX3GQR+Yqle6WL+2a2uLudoXjVHTCYfBBJPy98YI6YJwB1rO1DXbzTbGLVpba2OnGF
XmR7lIpYSfRmbynySBy6gYOC2QK2rW4S7tYriNXVJVDqJEKMAfUHkGrcHa/Qw20ILzS4b670+5la
QPYzGeMKRgsY2T5uOmHPTHOKx7vwXa3l/dXLalqMcV1cxXctrG8YjaaPZtbOzf8A8s1+Xdt9s10t
FSBg/wDCLxvqkd5capqFzFDK80FrM6NHC7BlJU7N54dgAzEDPA4GEt/CVlaw2kdvdXsQt9P/ALOL
RyhGliAAUsQAdy8kFcYLN61v0UAc/a+E4Yrs3l3qN9qF0XiYzXIiBKx7iiYSNRgM5bOM5xzgYq4N
AsGj1aKZGnh1WQvcxS4KnMaxkDjptQfiTWpRQBzn/CIqiQ+TrmrQyLbrbTzJJH5lzGpO0OxTII3M
NybW565AIp+JPCct1uudNuLsPLd2k09msiCKUxyx5kbcN24IvQMAdo4Jrr6KAOch8HWkWpRXf26+
aGK6lu4rNmTyY5JFcPj5NxB8xjgscHpgcUR+DrcadcabLqmpz6fJavaRWzyoEt4mGMLtUFiAAAXL
kY68nPR0UAYE3hbzXjlTWtUgnMC29zNC0SvdIucbz5fyn5m+aPYfm68DDrzwxHfXwmm1TUTaedHO
1iXRoWeMgqcspccqpwrAEjkcnO7RQBiT+GbaXTbS1iurq2ltJTNBdwlPNRzu3NypU7gzZBUj5umc
EPtfDsFvdWt1Jd3l3PBBNAZLmQOZBKysxbgDqgwFwoHAGMY2KKAOetvCNtDaS2M+oahd6e1u1rHZ
zSKI4YiMbV2KrNgAAM5ZhjgjJy4eF1ktzFfaxqd8fOglV53jG3ypBIoCoirgkcnG4jjPAxv0UbBc
56TwvMNRvbyy8RarYfbJRNLDAlsybwipkeZCzDhF70668J22oLI2oX17dzm3EEc8hjV4CCG8yPag
CuWCtnHVF4wMVv0UAcZZ+D5p9Y1ebUL2+FrPexS+SJI9l2qQxAM4C5X51bIUpnHIIwK2Lfw1Ha3r
SxanqC2hkkmWwDoIVd8ljwocglmO1mKgnpwMbdFA763MO18LWtk+itb3V2h0m2NpHyh86IhQVkyv
qinK7TkenFSXfh211KSA6lNNfRxRyIIZwnlsXBBcqqjLbSVHYAnjJzWxRQI53/hDrRrG+tbi/v7g
3tgmnzTTOhkMa78HIUfN+8PJBzgd85sXnhiyvr2S7lluBJJ9lyFYY/0eUyJ27sxz7dMda2qKd2O4
DgVjT+G7aYyyJc3ME73X2tZoyu6N/LEZ25BGCoxgg9T7Y2aKlq+44zlD4WY9p4ctLOWORJJmdIZY
izMDvMjh3Y8feLDPGByeOmH22gWtr9k2STH7LZmyTcRyh2cnjr8g/XitWimU6s31Obl8F2UkCwC8
vY4fsaWciIyfvI0BC5O3IPzHoQD3FadhpEWn3N1NFNMy3LK7RuQVDBQuRxnkKM8447Vo0UlFLYcq
1SS5W9BAoHQVjan4YstXuLie7muGkkhEMLBgDa4IbfFx8r7grbjnlF7DFbVFMyMM+FrR4bhJLm6k
a4vYL2R2KgmSLy9vRQMHylyMdzjHGHDwzZjVP7Q82fzvtxvtu4bfM8jyMdPu7efXPfHFbVFO47hX
Najoslvo1xY2AuZ3urkyxsxTFq7Nv384JVW+bHzH8OnS0VLimVCpKDujmrnw9LJq9gLeae0traxk
hE0DLuUlo8Lhgc5Ct2PT1xVh/C9sDELa7vLRUiWF1hcfvUXOMlgSDyfmUhuevAxu0UuVXuW8RU2u
NEagAY6VW1PToNW0q70653CC6haGTYcHawwcH15q3RVPUxOXvvBEGoeb52saqPtFktldlGiU3Ma7
sbj5eVPzt9zaD3Bqzc+FY7u6jebVdRa0WSKZrFnjMLvHtKnlC68qpwrBSR05Od+igDEg8L2dtJZy
Qz3KS2tzPcK4Zct5zM0kbccoSwOOvyrzkVpTWUdxeW1y5bdb7ii8YyRjPTOcZH4mrNFO7Ap2ml2N
jPPcW9si3Fw26aYjMknXG5jyQMkAE4A4GBVyiihtvcAooopAFFFFABXDaZqBtPiV4phW0uLhpvsh
Ji24iVYuWYsw45HAyeeBwa7muP0GNW+I3jBzzhbNcdsGL/61ZVPij6/ozuwn8Gv/AIV/6XA0Lbxb
aXsOnPbW10z6jYSX1uhVQdqbPlb5sBjvXvjryKwNG8dXF3FpV/q8N1psEmkTX06+TE0MwXyyXUrI
0i7QThSOd3PIra0jwXa6Re2twuo6hcR2lvJa2tvO0eyGJypKjagY42KAWJPvUdv4E02KGO3nu726
tYrSayigmZAscEoQFAURWOAgwSS3JyT2203/AK6/8A41bqOfxtbQW073mlala3ELQf6LKsRkdZn8
uNhtcrgtkEFgRg5HTOpoutx6yl0BaXNncWk3kT29zs3o21WHKMykFWU5BPX1rNHgu1kjl+2alqN7
PI9uTcTtGHCwSeZGgCIq7d2cnG47jk9Ma9jpUGn3uo3UTyM9/MJ5Q5BAYIqfLx0wg655zRpr/Xb/
AIJJg2vxE0G88Tf2FDNmczPbpIJoSGlTO5dgcyj7rfMyBTjg8jNvwlr97r9neS3mnSWhgvJoEYlN
sipIyjG12OQFAOcDPTIqxZeHUsNQaeDUb8WpleZbDeohSR8liMKHIJZjtZioJyAMDE2k6JHo8t39
nu7l7e4maYW0mwpE7MWcqQobliT8zHHbFJbajfl/W/8AwDlI/iHa6PpgbWZ/Oupr+9ihTzYIP3UU
zKPmleNOBtHXcfQ4JG5p3jGx1jU7az062ublJ7RLz7QpiVEjfO0lWcOeRj5VIBIyaafB1vHObix1
TULGfzppUkg8olBKQ0iAPGwKlwG+YEg9CBxVi48MRXWoabczajfSQ6cyvBbO0bLvVSocuUMpOCc/
Pg9wQSC10v8A1/X5+QS3dvMNY1ezh1bT9Fn0yW/mvMzIg8nagjZTvPmOuSpIbChmGM4qOLxdaS6k
tr9jvVt5J5LaG9ZU8mWaMMXRcNvBGx+SoU7TgnjNjXfD8fiBYIrm/u4rWN1ke2hEW2UqwZcsyF1w
QOUZT71BB4StINUS7+13j28dxJdQ2LsnkxTSBt7jC7zne/BYqNxwBxhLb7w/r+vn+BXl8daXFpVr
qDQXfk3Omy6mgCLuEUYUsD833vnGB0681Yk8UqsdsI9I1GW6ut7W9ovkiWSJcZl+aQKq/MvDMG56
VnJ8O7AW5tpNU1OW2Wxm0+CJ2ixBDJtyFIjBJG0YLFj9a2tR0FL5rSaG+urG7tVaOK6thGX2Njcp
EiMpB2qemflGCOabt0/rf/gfiGn9f16mRr3xF0Tw5dQ21+XSZ4FuJI2lhjaGM5wSskiljw3yoGbj
pyM6mm+I4NV1m90+1tLgrZ7RLclohHuZQwG3f5nIbglADg80y68MpcXaXMWq6laSmBbe4a3kQG5R
c4DllJB+ZvmQq3zHngYkHh6NvEketT393PLDG8dvA4iEcIfG7BVA5ztHDMw74yBgXn5ifkbFc743
/wCReh/7Cmnf+lkNdFXO+N/+Reh/7Cmnf+lkNIDmZot0zn7JJJz94XWwH8PMGPypQMKBtK4H3S27
HtnJz+Zp8n+sb6mm1sZHYVyccmv6J4s1u9stA/tG3v8AyNj/AGyOHGxMHg5PUn06V1lFY1KfPbW1
jqw2JdBy91SUlZp37p9Gnul1OXvNV1y/khlufAUbzQEtDL/akQeInrtYDK5xg4PI4PFVlu9fRdOA
8HS5sZnnQ/2rD87srqxb5ec+Yx4xzXY0UvZztbnf4f5G/wBdpb+wh98//kziYJvEtveNLH4avhbF
3kWzGrwCJXfO48JvIyzHazFQTwOBihLp2uSWy2yeGtQigNjHYSpHrFv++iQMF3Exkg/MfukA9wa9
FoqfYv8Amf4f5F/2jD/nxH75/wDyZwzf8JA324f8IrdgXckcxA1aD91KgULInydfkXg5XjpgnKSN
4nlt4g+gai15FN50d6dXt/MRtu0gL5flhdvGNmO/Xmu6oo9i/wCZ/h/kL+0Yf8+I/fP/AOTOS0vU
PEWk6Z9gi8HzSoXkcyTatCzku5c5IUd2NZ8VvrMMUEa+ELkiGK0iXOrwci2cumfk6knn9MV3tFP2
Uv53+H+Qf2hD/nxH75//ACZxfna9/aP27/hDpvM+2G9x/a0O3eYfJx93pt5+vfHFQ58URWcVtZ6D
qVpHCXEYi1e2IVGOfL2vGy7V4CnG4DjOM13VFL2L/mf4f5B/aEP+fEPvn/8AJnH2lxqtmbNo/h+j
PZQrDbPJqsbmFQMfJkfKSDgkYJ4znArU/wCEp8U/9CV/5VYv8K3KKbpyf23+H+RH12l/z4h98/8A
5Mw/+Ep8U/8AQlf+VWL/AAo/4SnxT/0JX/lVi/wrcopeyl/O/wAP8g+u0v8AnxD75/8AyZh/8JT4
p/6Er/yqxf4Uf8JT4p/6Er/yqxf4VuUUeyl/O/w/yD67S/58Q++f/wAmYf8AwlPin/oSv/KrF/hR
/wAJT4p/6Er/AMqsX+FblFHspfzv8P8AIPrtL/nxD75//JmH/wAJT4p/6Er/AMqsX+FH/CU+Kf8A
oSv/ACqxf4VuUUeyl/O/w/yD67S/58Q++f8A8mYf/CU+Kf8AoSv/ACqxf4Uf8JT4p/6Er/yqxf4V
uUUeyl/O/wAP8g+u0v8AnxD75/8AyZh/8JT4p/6Er/yqxf4Uf8JT4p/6Er/yqxf4VuUUeyl/O/w/
yD67S/58Q++f/wAmczqPjrX9JsJL298H+VbxY3v/AGnG2MkAcBSepFR6L8QtZ8Qwyy6V4UW4WJgs
gGqRqyk9MhlBwfXpwfQ1o+KtJn1zw3d6dbPGk02za0pIUYdWOcAnoPSuY8E+EofDXjWOPVJPMvHt
POsJUJWItysq84LOAeAM/KSSAcY56irRqJJvlfXT/I9jCPLq2CqVJ04qrG9kud3SS6c/rrfRK9nY
6n/hIPF//Qj/APlWi/wo/wCEg8X/APQj/wDlWi/wrraK29nL+Z/h/keV9bo/8+IffP8A+TOS/wCE
g8X/APQj/wDlWi/wo/4SDxf/ANCP/wCVaL/Cutrn9e8ceGvDGo2dhrOrwWd1d8xI4Y8ZxuYgEIuf
4mwODzwcHs5fzP8AD/IPrdH/AJ8Q++f/AMmUv+Eg8X/9CP8A+VaL/Cs8+OvEo1b+zP8AhAr/AM/O
N/nHyemf9b5fl/8Aj3XjrXe1k6Prkep6Zc30qLax29xcQuXkyAIpGQsTgYB259qPZy/nf4f5D+t0
rfwIffP/AOTOcs/Gnie+ubi3h8B3avbttczXXkqTkj5WdArjjqpI/Oq118Q9etNYTSZPBN296yI5
SC5MwRWJVSzJGVUEqeWI6Gu40/UrDVrUXWnXtteW5JUS28qyISOoypIqquqaCLu6nW/00XMUJNzI
Jo96RIzA7znIVW3DngHPvR7OXWT/AA/yF9bo/wDPiP3z/wDkzlbnx14ltdQSyk8BX7Sttw0UzSR8
nAzIsZQe+Tx3pbXx14lvNQlsYvAV+s0WdzSzGKM4ODiRowje2Cc9q61Nd0eXSm1WPVbF9OXO67W4
QwjBwcvnHXjrWZe+NNHsNQ06Oa/sU0++tpZ01B7tFi+RkAAJ4Od/XPbvR7OV7cz/AA/yD63R/wCf
EPvn/wDJmPH428TSxzuvgO9AgQu+642kgFh8oMeXPynhckjBHBGYl8e+JG05L4eAdR8l5PLCmRhJ
n3j8veB/tEY967G71zSLBrVbzVLK3a7OLYTXCIZun3Mn5uo6eoqQarpxv/sAv7U3mSPs/nL5mQAx
G3OeAyn6EHvR7OX8z/D/ACD63R/58Q++f/yZx0vjfxNDDbyt4DvSs8nloEuCzA5x8wEZKDj7zYHv
TZfHXiWEWZbwFfn7Xjy9kzNtzj7+Iz5fX+Pb39DW5qXjLSbXSJdRsr2yv4obqG3nMN0hWIvIqEsw
zjG7OD6dq0F8Q6I+lNqq6xp7acp2tdi5Qwg5xgvnHU460KnK1+d/h/kP63S/58Q++f8A8mc2/i/x
Snm58CXB8qRYmxeqclsYIwnzL8wywyBzkjBxJB4o8WXHmbPA0o8tzG3maiiZI9NyjI9xkH1rrba6
t722jubWeKe3lUNHLE4ZXB6EEcEVSTxFokjXaprOns1mcXQW6QmDnHz8/Lzxzij2cv5n+H+QvrdH
/nxD75//ACZif8JB4v8A+hH/APKtF/hR/wAJB4v/AOhH/wDKtF/hW5fa/o2mK7ahq1haKjhHNxcp
GFYjIByeCRyB6UXOv6NZafDqF1q1hBZT48q5luUWOTIyNrE4ORzxR7OX87/D/IPrdH/nxD75/wDy
Zh/8JB4v/wChH/8AKtF/hR/wkHi//oR//KtF/hXQSaxpkNzFby6jaJPLsEcTTqGfdnbgZyc7Wx64
PpVXQPE2leJYrl9Nuo5TbTvDKgkVmUqxXJCk4DbSRnqKPZy/mf4f5B9bo/8APiH3z/8AkzJ/4SDx
f/0I/wD5Vov8KP8AhIPF/wD0I/8A5Vov8K6W9vrTTbSS7vrqC1to8b5p5AiLk4GWPA5IFQ2mtaVq
CRPZanZ3KzKzxNDOrh1UgMVweQCQDjpmj2cv53+H+QfW6P8Az4h98/8A5MwP+Eg8X/8AQj/+VaL/
AAo/4SDxf/0I/wD5Vov8K19P1621PV7mzs5bS4ght4phPBdpISX3HBQHKjaFIY8Nu46VKdf0Yat/
ZJ1awGpZx9j+0p53TP3M7unPTpT9nL+Z/h/kH1uj/wA+IffP/wCTMP8A4SDxf/0I/wD5Vov8KP8A
hIPF/wD0I/8A5Vov8K311nSn1STTE1OzbUI13yWonUyouAclM5AwR271CfE2giCSc63pohjCl5Pt
ce1dy7lyc4GV5HqOaXs5fzv8P8g+t0f+fEPvn/8AJmN/wkHi/wD6Ef8A8q0X+FH/AAkHi/8A6Ef/
AMq0X+Fb0WuaRPFdSw6pZSR2gzculwhEIxn5yD8vHPNUdQ8Y6Dp2hJrTalbT6e86QLcQToyFmcL9
7djAySeeAD6Uezl/O/w/yD63R/58Q++f/wAmZ/8AwkHi/wD6Ef8A8q0X+FH/AAkHi/8A6Ef/AMq0
X+FdMby1Fj9uNzCLQR+b5/mDy9mM7t3TGOc9Kw9N8aaPqMWrXf2+xj03T7lYPt32tDDJlEbO77o5
fbjJ5H4Uezl/M/w/yD63R/58Q++f/wAmVf8AhIPF/wD0I/8A5Vov8KP+Eg8X/wDQj/8AlWi/wrqL
a6t721jubWeKe3lUNHLE4ZHB7gjgisKx8c+G76wub3+2LK3gtrhraVri5jTawZlGfmwA20lc9RzR
7OX87/D/ACD63R39hD75/wDyZU/4SDxf/wBCP/5Vov8ACj/hIPF//Qj/APlWi/wrbuPEWh2l3BaX
Os6fDc3AVoIZLpFeUMcKVUnJyemOtSzazpdvqcWmTalZxX8w3RWrzqsrjnlUJyeh6DsaPZy/mf4f
5B9bo/8APiH3z/8Akzn/APhIPF//AEI//lWi/wAKP+Eg8X/9CP8A+VaL/Cuit9V067untba/tZrh
AWeKOZWdQGKkkA5GGBH1BFQXfiHRLCaSG81jT7eWNS7pNcojKoxkkE8Dkc+4o5Jfzv8AD/IPrdH/
AJ8Q++f/AMmYn/CQeL/+hH/8q0X+FHhS01j/AISHX9V1XS/7P+3/AGfy4vtCS/cRlPK/geg61vPr
mkx3VravqlktxdqHtoTcIHmU9Cgzlh7imw6/o1xftYQatYS3qhi1ulyjSAKSG+UHPBBB9MUezd03
Ju3p/kEsbH2coU6UY8ySbXNe10+smt0uho0VWi1Kxn8jyb23k+0RmaHZKp8xBjLLzyoyORxyKyLz
xfpi6T/aGl3Vpqka3cFq/wBluVcI0kipyVzyN2cd6162OE6CisC08W6a2lSahqlzaaXCt5PaK11c
qis0cjJwzYGTtJx/OtC51zSbKWOO61SygkkXdGstwilxgnIBPIwCfwNAW1sX6KzJvEWh22mw6lPr
OnRWEx2xXT3SLFIeeFcnB6Hoexp134g0WwmjhvNXsLeWXb5aTXKIz7s7cAnnODj1waANGishfE2l
N4ol8Om6jXUY4UmEbSKC4bdwozkkBckY4BB71H4o8Uad4V0ee9vbq1SZYZJLe3muFia4ZRnYuep6
DgHqKBpNuxt0Vn/25paXltYzajZw39ygeK0edRK4I/hUnJ6HoOxp9nrGmajc3FtZajaXM9s22eKG
dXaI5IwwBypyD19KBX0uXaKKKACiiigArnfG/wDyL0P/AGFNO/8ASyGuirnfG/8AyL0P/YU07/0s
hoA52T/WN9TTadJ/rG+pptbGR2FFFFSMKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAo
oooAKKKKACiiigAooooAKyPF1rMuh2ms2ibrrR5xeYUhWkiGfNTf/CCuSeuduMGtetG2/wCPdfx/
nWdSPNGxvhazo1VUSvbp3XVfNaCWt1De2cF3bvvgnjWSNsEblYZBweehqauS8I/8SjVNX8Ln5YLO
QXFju+UmCXLFVB5YI2QWyck9uldbUQlzRuzXFUVRquMXdbp909V+G/mFcX4v+F3hzxvrNjqmrrd+
faoIysM21Zow24I/BOMluVKn5jz0x2lFWc4VxllpHimx0zVNLtxpsCXE13Nb38d45ljaV3dMxmHH
BYA/MfXnpXZ1wj+LNcj8Pajq/wBntJRHfPYWtvHGQxb7T5KyMzSBcYx8vy5I+8ueDyH0+f8An/wT
V8H6BfaF/af2wpi8nSdVF7LdMp8tUYNJKAzfcBz74wMDNGTwZcSeEb/SvNiW5n1KS/UxyyRq/wDp
HmqrOuGXICqSvK9RnHLLfxL4ia0js7uztrTU5tQFkk0kaMiAxebueKOd9pwNoXzMnKtwDil0PxZq
l3fWdpfLZEuNQEkkMTRhmt5ljUqC7YBBJIyfrQ31/rRJ/wCQJOyX9df+CJB4Rvra0iuoYbZdRi1B
b77NLqVxcRykR+UA88oZyQDuBCADCjHG6tP+xb+61zTdUuo7KEw2d1DNDC7MA8rIRtJUbhhTkkDJ
PSuI1LxHq/iG00u4i0iK4e20yHVZWDokau+7DKXuI/L27D+8xJjceOobe1DWtX0vxTr1/wCcstjY
6LFdnTyrElv33Cvv2qcry205GPTJGt7+f5W/Qav08vzX+ZRHw6v0srGBjBcj+yodOuV/tO6to49m
7LBYsecp3n5G2dPvDccdDH4Scw+KYGmSFdZwkUsRJeNPIWMZz3BDHGT161m2mv8AjO4sryM6VbC9
jWCWJikQPluxDHyVun3YCkgmRN3IA456GPU7u+8IHUdIaC/vXti0B8poUlkAxjY7ZXkH5WYEdCR1
py1Tv1/4cSlqrf1/Whm3eiazq2hJZXdppVpJFPaMnkXDyho4pVdskxrjgHC4Iz35qlqvgq+vLy+v
IpImZ9VS/hhW8mtd6i3EJDSxDcjZyQRu6YPU4zL3xRdW96mpyfYby8stJ1Bm/wBEltmimiaMtGVM
rDBygPX7uVbDVoWni3WxrcVpeHT5Iftxsn8m3dGJNsZ1YEyHAHCkYOeuR0ovpf5/ivzsgSsrL+tN
fuudN4f0f+ydCFkyrFI7SSSCO4lm2s7Fj+8kJZjzyxxk84GcDltD8E6jo0G1beymntbN7O2kuNTu
50lDbQWMT5SIYUEoobJwAygc5l94k1jUvBFympvp839q+Hbm+jW0geJoNqrlWDO+8HzPvfLjb0Oe
NVvFevrrb2tlpcb6bZT29rM8hiXcZFQ7t7TqU/1gwvlPuIwD83A43du//BX/AAA1Sv8A10/zK0vh
vWvDyaDY6bBFqcdrqhmimmkaNirQShvOZI2CgE4VgDkFVwMZM0vgfUxDp9yGhmu4nu3mtodSuLGN
TcSiU7JYhuIUjbgrhuvy4xW/oWralcavfWGsNbw3KZlgtY7ZlPkbyqv5vmMsgOB0CkHqoyKoah4n
1O31W9eL7CNPsdQtrCW3kRjPMZvL+dX3ALjzRhSrZ2HkZ4F71l3/AOG/4AeS6f8ABf6lnQPCp0XW
vtQFv5CaXb2MQjLkqUZy2N5J2ncuMsTxzUenWWu6Cr2UMNnNBNqbzJKGdmaKWRpJNy7QIyoPB3MG
I6AkCo7XxZezNpavHbBrrWrrT5AFbIji87aRz9792ue3J4Fams6jqKatYaTpjW8E91HLMbm6haWN
Fj2grsV0JY7x/EMAHrRd6P8AruElun/Vrof4h028vl0+4sPJe5sLoXCQzymOOX5GQhmCsRw+Qdp5
A+tcjoeh+IFjtdTjsrSO9iuNSimtbqeSNds0+4Oj+WSwGwYyo3A54rT1zxPq1i16bR9MCaZpaajc
+ajsLoEv8kbBhsH7s/MQ/wB4ccc17vxZrja9JZWf9nwwm+FjGZ7d5GVjbefvOJFBA5Xbx1zkYwVb
R/P/AC/HYev9el/1uX/CHhe+0CaF7uW3cJpNrYnymY/vIjIWPIHy/OMd+vFZh0XWtS8Q65bC0t4N
Nl1e1uzdzu4kIiSFv3abNrZKbd28Y54OOYD441ufT31OA6ZBbWuiQarPDPA5aVn37o1cSAJ9zAJV
uvQ02XXdR0rVdbXS7EzXuoazFDGGVWCf6HG5O1pIwxwuMb1655xg278zb3/+2X6i/r8P8i/p/gi5
tNdaaUJLbJeT3kVw+p3TMWk3nH2fIiUjzCN+TkA/KC2RYs/B91a6D4T0/dah9IkD3BBO1z5MiErx
ydzg8471UuPGWs2GlWF1e2lmk1xLLayxfeMLq5Xz28t5FWNcfOu4lScb6fc+K/EK+JJ7W10yKXT7
K5gtbiVhEgdpAhLB2uFZP9YNq+W+7AAPzcQlf3fT8P8Ah1/Vwu7t/wBf1uU4/h9qX9i/Y5bq33pp
1hABHPIgeW3kaQgsoDKpyAGHI644wdAeELz/AIRy8gjjt4NQnvYLzY9/cXSsYmjIV5pcsciPGQgw
CBtOMm/pWv3cWoajb+IrmzsnhzLFCYTGFg8wqrmYyMrg/L2QgnlRkVp+IJ9Wt9JeTRYI5rwOg2yJ
vAQsNzBd6biBk43DP6F8z+Lv/n/X3Be7/rsQa7pl7rfhr7KRbwXu6GYx+YzxF0dXKFtoJU7dudvQ
5welczc+Dta1A3V9dpaR3b6ot9Ha22pzxoyi3EODOiK6nq2Qp9O+Qt547uo59KfT5IdQtX+zC+kW
xaFV86XygQZJgyHIb5NkhG3BIzmp7PxTrkt7ZySrp72l3qV3pyQJC6yKYvN2OZC5BB8oAjaOuc9q
O7X9bf8AABXt/XZ/pc6Pw5pP9jaMlq0aRyGR5ZFSeWYBnYsf3khLOeeWOMnJwM4HNy+GPEKWUunW
8tsLP+0ZbomLUJraS4jlZ3KMyR7o9rMp+Vju24JUGtrwrqt/qFtcQ6w8K6pbsouLaK1aHyNyggZM
jhx1wytg9MAgiqdhd32o6ndWWumKK5tJftltaQWxVjErsEfzC7LIDxwAjA9QMilK19RX00/p6/5n
MQ+FfEUf2rQI7ayeGXQLbTpr6aWQRqA0yloxsPmMFIO0suCRyetbNx4IuJPElxcnbcWdzcwXLySa
ndRmMxhBt+zoRHJ/qwQxIwTyG24Ofa+O/Er6Jd6tcaVbxW76XNf2m8xDaUAIX5bh2lHzAFtkeOMj
5sDTl8V6xp0mo214llczxxWktvJBC8SL9olaMBwXYkKQCSCMjsKq8r3e/wDwf8xv8P8Ahl/kbvhn
RpNEsLqGYxGSe+uLktGSQRJIzLnIHIUgH6VjzeEb6TxFJqKy2wjbVhe43Nu8sWhhx93ru59Md88V
bv8AUtb0+CwsWu9Ll1G9vfsq3QtnWGIeW0mWi8wkthMAbxnIPtWDfeOtZg05ZIYtPM0FvfzXDmN2
SX7JKEOwBgVD5PUtt/2scza/5fr+g1e/r+t/+CMk8D+IWsNGtDewSR6fbWgVPt00caSwyBm+RVxI
GCqAz/dxkLWtbeEbyEaaGlts22sXd/IVY5McomAA4+9+8XPbg8msW/1TWNW1PS7Uz2Md/Z66Io5x
auYirWbSDMfmZJAcj746A+1a1p4o1rUtS03Trb+z0kmF4s9y0Luha3mSMsi7wcNluCTgnqcfNTu9
+v8AwGJ7f15r/Mz4PA2t3FhbaZfS2EFraaPc6XHPbzyPJJ5mwK5Uou3hOVDHr1qePwTftpt2zQ28
N+zWpiDardXiv5EvmANJMMopOQAqHbknLZwJdP8AFviC91050qNNIa8ntEdzErAx7xu3eeWYkxk7
PKBAJ5O3J3PCGpanrXh2z1XUjaKbyCOVIbeJl8vK85Ysd2eo4GOnPWkm/i/rdsHfZ/1/Vjmp/A+q
LcR3EfkzGC4vGjiTVbmz3JcSCTJkhXIZSNu3DBhg5B4qWXwHdIVS1ezSKO306FBuk4+zzmR8btxw
QeMsTnqe9V73VdR1XxBod67Wy6fDrlxbRWqQMZ90UM6Fmffg5KsQoQdRzUmj+LfFurWrTpo1uPtl
jJdWCu0K/MNu1eLhmlHzAFtsWDjON3BF6Jrpr+F/8xyvdp9f8/8AgCz+B9TBtrhHjuJoLi+byV1O
4sh5c83mAiSIbsjABUgg568DM8vgW4XTtVs7ZrNUudCi0yAFpMK6+ZknduYJ8645Y8Vv6PqVzqXh
+eX7XA+oQmSKRvsbwrFKv8LRmRjxxnD4bqDgg1x/hW61O18PeH7SwfSbfUNVs5dSub2azYrIV8vO
5RIC8h8wEuW/hPy88K9l/Xn+l2Cbbv5/rf8AM6uHSdRtPFn9pxi2mtriyitbjfMyyRGMuQyjaQ+S
+OSuMd6zPFfhvWNRn1STSxYzDUtM/s9xd3DxeRy53rtR92d/I+X7o5OeE0bxTq2vX9uLeKztrVtL
ttRlDo0jnzDJlFIZR/CMNj8DnjIsvHevTR2lzOum+TLHYXDxpbvu8u5lMewMZMblILbsYOcYGMmm
m5W8/wA7r/MSvHVeX6W/T+rmhL4HuX8QTXDiOe0ubiC5kd9Tuo/LaNUG37OhEcnMYIZiMZ5DbcHY
8P6Vqum6pfGVbe20p8tBaRXT3H7xnZmky6KYwcj5AWXPTHOc+PxXfTxaejxWwa71i7051CtkJEJt
pHP3v3a57cngVz2keLL7R/D/AIVtbOJZ7dbSxW9VrcfuxM4jU+YZV564VY3+7ztzmkrv8Px/pCcb
K39aOx6pRXnXh7WNW+02ekWUemwNc3GpSTzGCVl3RXIBZUMufm3Nxu4JyOBg29P8WeIr/XSqaTEu
lveT2cZkaJCGj3jO/wA8sxJjJKeSCAScnbkobVm/I7qiua8Oa/cT2zw6/dWkGqpKkUlsIDb+W7rl
UBMjiQnnDK2D0wCCK6WgVwrnfG//ACL0P/YU07/0shroq53xv/yL0P8A2FNO/wDSyGgDnZP9Y31N
Np0n+sb6mm1sZHYUUUVIwooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKK
KKACiiigArRtv+Pdfx/nWdWjbf8AHuv4/wA6mQ47nNeL4pNNmsvFNpGzS6c227SMZaa1bhxgfeK8
MMkKMEmuniljnhSaGRZIpFDI6HKsDyCCOoolijnheGaNZIpFKujjKsDwQQeorlfBl1/Zul32h6hc
Yn0OQxyTSvw0By8chPRRt425O0LzisPhn5P8/wDhvyPSt7fDf3qf/pLf6S0/7eR1tFMiljnhSaGR
ZIpFDI6HKsDyCCOop9anA1bRhXCad4nS8vE0u48O2UWlajqF3YL5c4kMkiFy7SRGNV2tsck7m5PI
5zXd153afDy807Uhq1i9lDqUt5di7kTI860ncsPm258xPkI7cEZwc0uvy/yH08/+HOhhbwXPYXeh
QNoElnaAtc6ehhMcOGyS8Y4XDdcjrWfYWPgGKwt9FFxod7CL2Y21tO8EmyYsWaONegK7wMAZAIrC
s/hpex6BcWFwts13Dpk1hZ3bandzBy67dxif5IQQBlVD89CNozpXvgW+n/tAQvZItw2mmMZYbfsz
AvnC8cDC/riq6/d+Ynt9/wDX4s3JD4MuZhbyf2DLLoqlxG3ks1gq45x/yyAwOeMYFLdav4NmaPV7
vUdBdrSVreO9lmhJhkI+ZA5PysR1Gc4rjrv4f+Jb67vbi6v7eeWeyv7PzZb6Zw4mIMZEZTbEBgKV
T0zljXQ6n4b1CDUdH1XSobGeawspLRrW4laFMMqDejKjEMNgXG3kHqMVN/du/wCt/wDgfePrb+un
/B+4uQ2fgh9HntoLbw8dLZBeTRIkPklOcSsB8uPlPzH+714q5cXnhmJIPD9zc6Qi3ESxw6dI8YEs
Z4VViPVeMAAY4rzjSfBviaXwZGlnb2UUuoaCumzxahLJA9uwaQ7tojbdxJ0O3pW0vw7um1m5N55V
7p93PDcSM2pXURiKKg2iCMiOTmMFWJBGeQdoBq2tnt/wWvy1E9rr+tF+tzrpNM8Oaba29rLZaVa2
77rSCFoo0RvMOWjUYwdxGSo64qj4j1DRfDkmnzXmnQ7Ly98trhIlzA/lMPNJx2VdpbsuecCtLWrO
6vDp32W202fybyOWX7dGW2IM5aLHSQZGCeOtRa5o8uq32iyoYvKsrwzzLJn5kMUiYAwcnLjrjjNL
fca0+78dTD8NReGPDNnrFolpp+m2umyRWdxfTmJDdAxowaVtqgn95jnOT9cVoyv4J07+z9Umbw/a
7IALG7cwptiHA8pz0X5gPlOPm96yYfBF7pU0lxps8FyYtUW+tbe7kZF2C38ny2cKxG0HKthj8oB9
asaV4SvbPUbG8uHtCY4r8zRxlsJJcyrIFTI5VcMMnBPXAzgNvr/W3+YWX9f16f0jVnPh3wlpGo69
DaWFlAY/tFxNbxxxmfqRlhjcSTxk8lveqdtf+HrltJ1rWU8PW+rXS4sphcxyu6ngCKVlVm+90UdW
xz3F8N3o+GH/AAjJlg+2/wBl/Yt+4+Xv8vbnOM7fw/Cq2veGNUvZL5bIWEkWp6Ymm3DXLsptwpf5
0AU+Z/rD8pKcqOeeHZKVv66ho1r/AFt/wfuNFh4Og8ShmGhR6/JJgE+SLpn2/wDfZO0j8D71Z1Bv
Des3n9hakdKvrpMTfYLkxyuvHDeW2T0PXHesW58I3sq6qEmt913qtnexMzNkJD5Od3H3v3bYxnqO
RWho+lanpV9PbGGxm057ua7F007GfdIS23y9mBjdt3bzwOnPE20S/rp/wfuF5/1/X+ZlReIfCXiO
/wBKht7TR764gvZLaOO4lg861Ee795GhJJBKLgLg4IPatyO88L3Fxeyx3Ojyz2Uhmu3WSJmgcKUL
yHqp2grk4OARWJbeFdWivbOJzZ/Y7TV579JlmfzHWVZsqU2YUqZQPvHIBPHSqJ8EazPop02U6bEL
TRrjSrSWKRybjzAgDyDYPLx5YJUF+WPPHLW39dv8/wCtCrLmtfT/AIL/AENOLTvAlzqL66s2iXIs
khs1JaB4rMozFAvH7tstjqOi4FaNzP4P1LSbnVbqXQ7rTZgsdxdytC8LhW+VXc8HDHgE8E1l6t4P
vb7UJ5oZLVYpItOTazMObedpHyAv904Hv6VDq3gu+vLu+u4pImLaqt/DAt5Na7x9nEJDSxDcjdSC
A2cYPXg/r8v+D9wl3/rb+ka0N3ov9saXp+n6fYS217p0piubcIUECFAI1wMFD5mcA446c1B4nu/C
3hO0Gs3lno8eoWds4sFm8qKVwinEcTEZHXGF6bunNM0nwrc6XqGj3kSW6+Qt0t1F9qllx5zq+5ZJ
NzSMCgBLbc5LfL92ovFfhvWNRn1STSxYzDUtM/s9xd3DxeRy53rtR92d/I+X7o5OeB9P67jja+pc
js/CUk11pVuuk2l9fIs15aW3lJNMn3jvUDcQcnJI/iOCM1an1Pwnr9lc21xfaLqVrAgmuIpJYpkj
TqHcEkAd8msO48J65P4otdRe7ilt7W4WSEPeygLH5JjZBCF2ZyzNvOWOdvyimw+CryHTNGtpYrK6
Flo02nzwmd4lld/KIw6oSF/dn5sZHBAo0f8AXr/wESvPc34LDwvq1jBfWdlo9/bwwmG3mhiikRY1
42IwBAUYxgcVT0jWPDmpaZozXMelWd1qMf2y3sJHj375AdxQEAsTuYFgOcn1NaOgWmq2+jtBrNwk
twXfaEkMnlxk/KnmFVLkD+IqCe+TyeMPgfxEbPSrM3ds0GnR2ywqL+aNA0Mu7cY1QBy6qv3s7COA
3Uml9fL9b/19wdPM7nT7LRtEYadpttYWBlDTi2to0i34wGfauM4yoJx3FUdPn8I6bqIi02XRLW+1
MCYJbNEkl2OSHwvL/wARzz3qTxJoUmtW9ubadbe7hfCzEHiJxslXjuUJI/2gp7Vz83gST/hIZpYo
on06e4guPm1K6i8nylQBBboRHJ/qxhiRjPIbbgi1ev8AX9fp6B0Ncy+CbH+0mMnh+389SdQOYU8w
byh831G8svzd8jrSxaroV/f6muNIlsY7CJri8FzC4eJt52SL1EYX5gW+UhzjvVOLwtc2vhu8sha2
t1dTalLeoPtklsAWmLo3mIhYMo29BjjHSqUnhDXbtJri/vrO4vntLIFjkLJNBO0pVsKBtOVXcB6n
aOlJba/1oV1f9dUa4bwRH4YWMHw8vh+ZztUGEWsjDLHj7hI2kn/d9q0IbPQrzSoZbS0065sRbNFA
Yo0eIwkDKLgY2HaOBwcD0rBg8LanLqtvql39himOr/2hPbwyM6IotjAArFFLMSFYkqvUjtzs+H9H
uNJ0i5s5niZpLu5mTyySoWSV3Ucgc4bn3z1ols7b/wDAFomv67/5L7zK0K78JeOdDjnay0S6eRY7
m7sz5VwYJCu0bxj7wA25IBwMVabXfClhoE+t2M2mXFnpEDIHsGifyVwCY1IOFzhflyM8Vg2XgnWr
rQoNK1SSxtEtdHm0yOWzneZpTIEBdsom0DZ90E53dRgZtWngu6k0XW7e5SK1utQsfsSuNSub7Aw2
CWmIwMvwoHHPzHOA5buw0ldXNe0vvB0uq2+oW0+h/wBp6nHiKZHh8+5TpgMPmcfLjjP3fat63t4b
S3jt7aGOGCNQqRxqFVQOgAHAFcJqvhjxPrM9nLO9pEtuLd0t49Tn8qOSKXeTtWNRJvAUZcfIRwD1
rtbH+0P9I+3/AGb/AF7eR9n3f6rjbuz/ABdc44o0/rsQm+pAdA0Y6t/ax0mwOpZz9s+zJ53TH38b
unHXpSL4e0RBehNH09ft3/H3i2QfaOp/ecfP1PXPWtKikMrWWn2Wm2aWdjaW9rapnbBBGERcnJwo
GBkkn8agutB0e9sIbC70mxuLKDHlW8tsjxx4GBtUjAwOOK0KKAIVtLZJ3nW3iWZ0EbSBAGZBnCk+
gycD3NV10bSkRUXTbMKqxoqiBcBYzuQDjop5A7HpV6igDOXQNGXVDqa6RYDUGbcbsWyeaTjGd+M5
xx1pjeGtBZ1dtE00uoYBjapkBjubt3JJPqTmtSigCtFptjBMs0Nlbxyrv2ukSgjedz4IH8RAJ9Ty
aiGi6UuozaiNMshfTp5ctyIF8yRcAbWbGSOBwfQVeooAzrTw/othbrb2ekWFtCkwnWOG2RFWQDAc
ADG7HfrWjRRQAVzvjf8A5F6H/sKad/6WQ10Vc743/wCReh/7Cmnf+lkNAHOyf6xvqabTpP8AWN9T
Ta2MjsKKKKkYUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQB
Fc3EVnazXM77IYUaSRsE4UDJOBz0rJg+JXhFIVVtWwRn/l2l/wDian8Sf8itq/8A15Tf+gGtHwj/
AMidov8A15Q/+gCsKkp83LF/196PRw9PDrDutWTbvbRpdL9YyMv/AIWZ4Q/6C/8A5LS//EV434j8
W6nrmryXbzxROIDZs1iZI0mi3E8hjkg56HHbIr0u3+ITaOmtzayl7fhNfk02yhsrdXkwI1ZUCjG7
JyM8nJHbpmeL/iYt/wCDIzo9n4gtLi61FdOuVitdt1anKl1AzxIyn5MHqexFc9WjUqxV5dtl3t5+
aPSy/NMLgKjnCg2/OSe19rQXb8Db0D4h+FrLw5pdpcapsngtIo5F+zynayoARkLjqK0f+FmeEP8A
oL/+S0v/AMRWS3xF0bwusejvbeJNRTT4YhfX5tzP9l3DP+kSZGGAOTgH06jFazfEGwbxY/h200vV
r25jaIST2turwRrIoZXZ93C4PfnjgGtlColZSX3f8E4J18FOTm6ctdfjX/yAf8LM8If9Bf8A8lpf
/iKP+FmeEP8AoL/+S0v/AMRWPH8ZNFmaFYdD8STG5jL2nl6cW+1MuN6RYb5iuST2+U89M6Vx8SLC
LwvZ+ILfRddvrS5MgdLSzDyWxQkN5o3DbggjOSOKGqqV7r7v+CLnwV7ezn/4Gv8A5Am/4WZ4Q/6C
/wD5LS//ABFH/CzPCH/QX/8AJaX/AOIrMuPiWP8AhM9F0ux0i/vtN1KxW6W5t7VmPzsoVuowigne
SMjIplj8RrWz0zVr7UG1a7kGsvY2unjT0S53bVIiRFY7wBltzEE/ll8tXuuvR9Hbv3F7TA/8+5f+
Brtf/n2a3/CzPCH/AEF//JaX/wCIo/4WZ4Q/6C//AJLS/wDxFU3+KmjJoyag2m6yJjefYX042mLq
OYqXVTHu/iAGME9R05xu+F/FNl4s0+a6tLe8tXgna3ntr2HypoZBg4ZcnsQevf1yKOWr3X3f8HzD
2mB/59z/APA1/wDKzO/4WZ4Q/wCgv/5LS/8AxFH/AAszwh/0F/8AyWl/+IpkHxG0q78RHSraw1aa
FZnt31RLQ/Y0kUEspkz2xjOMe+Oag0j4o6LrGqwWcVhq8EF0zrZ39zZmO2uyuTiNyeSQCRkDp68U
rVLX5l93/BB1MCv+Xc//AANf/Ky1/wALM8If9Bf/AMlpf/iKP+FmeEP+gv8A+S0v/wARVLQviro2
valaWcWm6zareo7Wtzd2myGdkGWRHDHJGD7cHnpk0L4q6Lr2pWlomn6xZR3iO1td3tr5cExRdzKr
hjkgA57fKeemXy1e6+7/AIIe0wP/AD7n/wCBr/5WXf8AhZnhD/oL/wDktL/8RR/wszwh/wBBf/yW
l/8AiKraZ8T9H1XVoLGHT9Ziiuyy2V9cWZjtrxgM7Y3J5JAJGQOlW9O+IGlanqEWn29tei+zJ9rt
nRVaxCHBaf5sKOmMFs54yKVqvdfd/wAEHUwK/wCXc/8AwNf/ACsb/wALM8If9Bf/AMlpf/iKP+Fm
eEP+gv8A+S0v/wARUGk/E7RtX1m2sIrHV4IbxmWy1C5sjHbXbAZxG5OTkAkZA6V2lPlq73X3f8EP
aYG9vZz/APA1/wDKzkv+FmeEP+gv/wCS0v8A8RR/wszwh/0F/wDyWl/+IrraKVqvdfd/wQ9pgf8A
n3P/AMDX/wArOS/4WZ4Q/wCgv/5LS/8AxFH/AAszwh/0F/8AyWl/+IrraKLVe6+7/gh7TA/8+5/+
Br/5Wcl/wszwh/0F/wDyWl/+Io/4WZ4Q/wCgv/5LS/8AxFdbRRar3X3f8EPaYH/n3P8A8DX/AMrM
nRPE2j+I/P8A7KvPtHkbfM/dum3dnH3gM9DWtXJeH/8AkoXjH/ty/wDRRrradOTlG78/wZGNpQpV
eWnezUXrq/einvZd+wUUUVocgUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUU
UAFFFFABRRRQAVzvjf8A5F6H/sKad/6WQ10Vc743/wCReh/7Cmnf+lkNAHOyf6xvqabTpP8AWN9T
Ta2MjsKKKKkYUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQB
l+JP+RW1f/rym/8AQDWj4R/5E7Rf+vKH/wBAFZ3iT/kVtX/68pv/AEA1o+Ef+RO0X/ryh/8AQBWE
v4vyPQj/ALj/ANv/AKGEPh9i++0/2p/zH/7a2/Z/9jb5Wd347v0p934B+1XNxN/ae3ztcg1fHkZx
5aqPL+932/e7Z6V0Gl6obrT7m6uzFEsFxPGWHChEcjJyfQc03/hI9M8h5TJOoQqCj2sqyNuOF2oV
3MCeAQDWqjJOy6W/S35I4XOL1b7/AK3/ADZyuvfDe81TU9Taw8UXGnaVrDK2p2C2qSGYgBW2SNym
VAHQ8+3FdBovhePRdd1jUYrndHqC26pBsx5Iij2D5sndnr0H41si5RrP7UqybNm/a0bK2MZ+6RuB
9sZrm7bxnHcHTJmtp47e7t5JJFFrK7qy7MbcLll+Y/MBjjrRGm2mkv6/pBKpFat7/wDA/wCAVNH+
H39kx+Fk/tPzf7Be4fP2fb5/mhh/eO3G73zjtWa/wpD2dlayapb3MEBut8V3YebGfPk370UuAsig
kBzu+ldde+IbOK2gkt7hX85VlEghklRIieXbYPlGM4LEDjrwakn8R6Xb3L27zyNKp2lY7eSTnbuw
CqkE7ecDnGfSh05S1a7/APBD2se/9anKxfDvU7I+HJtO8UG0u9Is/sMsosEdbmHcpxtZjsPy4Jyf
wp938OJJY72az1ySz1J9XfVbS7S2VxbsyBChRiQ42g+nUenPVnXLBRaN5kpjuwhhlEEhjO7hcvt2
qTkcEjrWZc+KkW6vLRI2hltruK3Ek1vM0bBtucsq4U/MQMnGcHoaahOT2/q6f52E6kIrf+rP9DGs
vhvLB9kub3Xpb3U11dNUu7t7ZUFwyIUVFRThAFI9eh9gOl0XQv7Hv9ZuvtPnf2lefatuzb5fyKm3
OTn7uc8dambXtOTUFsjLJ5zOYwRBIYy4BJXzNu3IAPGe1PTW9Okjt5BdKEuIGuI2ZSoMa4yxJHGM
jrilaS6f1p/l+A+aLe/9a/5/icrp3gLUtK1eRbTxVcr4ckuJLh9HNqhJL5LKJs7gu45wB0496raR
8M7yw1DThe+KLm/0fSWZtN09rVIzCSCql5F5k2qT2HPtwet/4SPTPIeUyTqEKgo9rKsjbjhdqFdz
AngEA1pQyrPCkqBwrjcA6FG/FWAI+hFJwaWq/r+tuw+dSej/AK/rfucfp3gL7BpXhix/tLzP7Dlk
k3+Rjz96OuMbvlxvz36Ulj8P0tNH8NadJqPmposkrM3k7fPDo6kfe+X7/v0rtKKTd736j2POPCvw
qHhbWBdRajp13awo62kc2iQCeFj91jOuHcjoTxnJ6Ve074ey6bq39rJrs8uoXm9dXeWNmjvUbooT
f+6KDhCCcDIOa7migDzrwl8K4/CuuJd/b7C9soAwtoZNGgS4i5+VjcKN7MBxk9c9q9Foop3DzCii
ikAUUUUAFFFFAHJeH/8AkoXjH/ty/wDRRrra5Lw//wAlC8Y/9uX/AKKNdbWVH4fm/wA2d2Y/xl/g
p/8ApEQooorU4QooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiii
gArnfG//ACL0P/YU07/0shroq53xv/yL0P8A2FNO/wDSyGgDnZP9Y31NNp0n+sb6mm1sZHYUUUVI
wooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigDL8Sf8itq/8A
15Tf+gGtHwj/AMidov8A15Q/+gCs7xJ/yK2r/wDXlN/6Aa0fCP8AyJ2i/wDXlD/6AKwl/F+R6Ef9
x/7f/Qrx+Hrr7Le6fNfW8mnXbTM8YtWEo8wk4D+YRwT/AHe1MtvCotrG4hVNGEkwRTt0pVjIU5yy
h8s2e+4AYGAO8mman9k8P6jqF5JLKltc3THks21ZGwoz7DAFQReKL6SzuJTodwJYthUbJ1QhmwSS
0IbK9TtVuP06v3nTyPLfslq/P/gm5p1nJZ6ZDaTXUlzIibWmkJ3MfxJP5kn1J61l6b4dmsZbIyXs
csdlBJbwqsBUlG243HcckbeoAznoK0G1SOLQm1SQxPGkBmb7NJ5qkAZO1sDd9cCsu48SXlpDOlzp
kS3aCBkjS6LIyyvsGX2Aggg5G09sE9pSm27df+G/UtuCSfRepWPgeDy7QF7KZ4rVLaR7qwWYlVzh
kyfkb5j13DpxxzePhsf2gbpbkKv2tbkRiLpiHytvX8c/hioLvxRNaW8kUtgRqK3IthDCzyoSY/MD
BljLEbf9jOe2OaSx1262adZQ6bMbieOXP2yV0I8sqCxLJuIO7IO0duB2t+1e/wCnqZr2Ken6+hXk
8Eb0sl+3QsbWGKNHltd5Ro23Bk+b5N3AbHJAHIq/d+HZri6u2S9RLe6nhuHRoCzh4ynRtwGCEAxj
qc57UkHiRrnWbnTo7eNtqStDOjuUdkIBUkxhc5PO0tjBzWbZ+K9Qi0TSjc2S3V/dwmUeUZWUoAuW
by4WKklhwFI96P3r1/rXX9A/cxv/AMHpp+pbn0G+h1SxNvLFLp6373LxmPEke9Hyd5fBG5ugXPPX
imxeEJGijtbvUEls4bOWzjjjt9j7H28sxYgkBR2A9qst4nK213KdPljNtp63pjlJR8nd8hBHBGzr
79KX/hILyRtR+zaV5y2KjdiY7pCYw4CqFOTzg/mM9KV6m3b09P1Kapt37+vqRW3hUW1jcQqmjCSY
Ip26UqxkKc5ZQ+WbPfcAMDAHfa020ksdOgtprmS6kjXDTSE5Y/iSfzJPqT1qLTr5tQ0z7Q3kBzuD
LBKZApHYkqpDDuCAQeK57TfEV3B4ftGW2N41vp6Xd3LLcFW2nP3eDvb5GPJUdOeaT553TCPs42ce
3+R2FFcvceLJP7X/ALOtbOCR2k8oLJdGOY/u9/meWEP7vtuz17VBb+JZ7fw/BJa2hung05byf7Vd
kMEIOPmCHex2t1C/rU+yla5XtoN2TOvorBfxJshu5Psmfs9zBb48z73mbOenGN/TviorbxTJdao1
vDpdy9sJXhE6xy/eTIJOYwgXKkZ3k9OOuF7OW9h+1h3OjorL0PVZdVtGlnght5lIDQLKzvHxnDhk
Uq3tjpggkGtSplFxdmVGSkroKKKKRQUUUUAFFFFAHJeH/wDkoXjH/ty/9FGutrkvD/8AyULxj/25
f+ijXW1lR+H5v82d2Y/xl/gp/wDpEQooorU4QooooAKKKKACiiigAooooAKKKKACiiigAooooAKK
KKACiiigAooooAKKKKACiiigArnfG/8AyL0P/YU07/0shroq53xv/wAi9D/2FNO/9LIaAOdk/wBY
31NNp0n+sb6mm1sZHYUUUVIwooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAoooo
AKKKKACiiigDL8Sf8itq/wD15Tf+gGtHwj/yJ2i/9eUP/oArO8Sf8itq/wD15Tf+gGtHwj/yJ2i/
9eUP/oArCX8X5HoR/wBx/wC3/wBCWLw/p0M0siJPiUu0kTXUrRMXzuzGW2c5Palj0Gwht5IY/tSi
TaGcXk3mYXoofduCjJ4BxyeOa06K155dzh5I9itBp9pb6eLCOBfsoQp5bfMCD1znrnJyT1zzWXde
FbGXTpbS3aWEyvEzyvNJI+2NgwUMzbgODjBGMkit0kAEk4A71DaXltf2sd1Z3ENxbyDKSwuHRh04
I4NCnJO6YOEWrNFIeH9NWzNqIZNpl84yefJ5vmdN3mbt+ccZz046VNBpNlbSQSRQkSQK6IxdmOHI
LZJPzEkAknJq7RRzS7hyR7GbBoOnW999sigdZtzsCZnKrv5YBScAE8kAYzz1qMeG9MEKRJHcIsbF
oyl3KrR54KqQ2VXgfKMDgcVrUUc8u4ckexlXnhvSr5VSa3cIsPkbYpniDR/3GCMAw9jnrVldLtI0
uVjR4/tJBlaOV1YkKFBBByvAHTFXKKOaW1w5I3vYrWOn22nQGG2RlVmLsXkZ2Zj1LMxJJ+p7CqL+
GdJeNIzbPsRSm0TyAMhOdjAN8yZJwpyozgDFa9FHNK97hyRtaxgv4enbXjfx3/kwNIJHhi80F8KF
w373yznA/wCWece/NO1Hwrp97pX2GLzbbbbm3ieKaQbVI4DAMN4Ho2e/rW5RT9pLTXYXs4a6bmTL
4b024mWaeKRpB5ZbbPIiOyY2sUDbSRgckdhUyaLYJevdrFIJWYvgTPsDEYLBM7QxyfmAB5PPJrQo
pc8u41CK6FOw0u003zTbrKXlIMkk0zyu2BgZZyTgdhnHJ9auUUUm29WNJJWQUUUUhhRRRQAUUUUA
cl4f/wCSheMf+3L/ANFGutrkvD//ACULxj/25f8Aoo11tZUfh+b/ADZ3Zj/GX+Cn/wCkRCiiitTh
CiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACud8b/8AIvQ/
9hTTv/SyGuirnfG//IvQ/wDYU07/ANLIaAOdk/1jfU02nSf6xvqabWxkdhRRRUjCiiigAooooAKK
KKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKAMvxJ/yK2r/wDXlN/6Aa0fCP8A
yJ2i/wDXlD/6AKzvEn/Irav/ANeU3/oBrR8I/wDInaL/ANeUP/oArCX8X5HoR/3H/t/9DzXVfhf4
Ok+KWm2DaPm1vLG5up0+0zfPKHTDZ35H3jwMDmna7qzaB8Q9PSxhtLrTre5tdPZo2vPPtdwCiPzO
YAvKkoTluCRkBh6pLpFjNrNvq8kGb63heCKXe3yoxBYYzg5KjqO1ZV74F8O6hd3FzcWUpkuJkuJF
S7mRDKu3bJsVwof5R8wGTzzyauHu8q6L/P8AyOOWvM+r/wAv8zn9J8VeKfEOpS3tta6LD4ZS7msm
WWZ/thKZXd/cGWAO084/OuW+H/ifxJoGieFoNQtNMfw9frNFbvbs/wBqRlDvl8/Lg7W4Htz6+ij4
e+FF8THxGmjQpqpYv5yu4G4jBbYDtycnnGc89eauQeEtDtrXSraGx2w6U7SWa+a58piCCeT83DN9
7PWkrqPnp/wf+AN7+Rwfhj4i+Ldc1WwnfQIZNG1Dd5Qt7W7WS3GCVaSZ4xEwyMEqe+e1dD4E8R6/
rNzqFr4li0+0vYAjpZW8E8csaksCXMg2uMjAaMleDzyKvaT8PPCuhazPq2l6Stpezq6O0U0gUqxy
QE3bQPYAY7Yqbw14H8OeEHuH0LTFtHuMCV/NeRmA6DLsSBz2qlb+v6/El+RgzeKvFOo+KtRtdCtd
FTStIuY7e9bUJnWeXIDMYwvCgAkAtnOO/Sst/iH4mEz62LDSB4WTVf7N8tpH+2t+88suP4PvfNjr
gY9667VPh94V1nX4dcv9Hhl1KJkZZg7pkqcqWVSAxHH3geAB0prfDvwk3if/AISM6JAdV8zzvO3N
t3/3tmdm7vnGc89eaUdLX+f4f8H0uOXW39b/APA9Tk4/Hvi7+0mvXsNGbw/FrZ0iQK0guiTLsVxk
lcDcuR3wemeCPx74u/tJr17DRm8Pxa2dIkCtILoky7FcZJXA3Lkd8Hpnjuh4U0QWklqLL9zJff2g
y+a/NxuD785z94A46e1A8KaILSS1Fl+5kvv7QZfNfm43B9+c5+8AcdPanHS1/wCtr/8At33oJa3t
/W//AADgIviV4ovtfaTTtBjudEjv2s3ijs7t7khX2NJ5qp5IA+9jOQBj3rVbxvrC+Pf+EL/4lP8A
aDS+et1k+WLXbu2mPfu872zjHzdOK3V+H3hWPxQPEkWkpFqwcyefFLIg3EYJ2BgpJyc8c5JNTt4K
8PvbtEbA5a7+2mbz5PO8/wDv+bu3g4469OOnFKPS/wA/w/4f8PQlre3y/H+vxOGi+JXii+19pNO0
GO50SO/azeKOzu3uSFfY0nmqnkgD72M5AGPeuh8PeJfEV341v9K12DTrG3AlNlbrFOJ5VVlAfzGH
lONpBIQkjIyBg1op8PfCsfigeJItJSLVg5k8+KWRBuIwSUDBSSCc8c5JNSaV4F8NaJr91rmn6YsW
p3Rcy3DSyOSWOWwGYgZPoBRHS1/MJa3t5HRUUUUAFFFFABRRRQAUUUUAFFFFAHJeH/8AkoXjH/ty
/wDRRrra5Lw//wAlC8Y/9uX/AKKNdbWVH4fm/wA2d2Y/xl/gp/8ApEQooorU4QooooAKKKKACiii
gAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigArnfG//ACL0P/YU07/0shroq53x
v/yL0P8A2FNO/wDSyGgDnZP9Y31NNp0n+sb6mm1sZHYUUUVIwooooAKKKKACiiigAooooAKKKKAC
iiigAooooAKKKKACiiigAooooAKKKKACiiigDL8Sf8itq/8A15Tf+gGtHwj/AMidov8A15Q/+gCs
7xJ/yK2r/wDXlN/6Aa0fCP8AyJ2i/wDXlD/6AKwl/F+R6Ef9x/7f/Qx9HmIbUNQu01HFtcXLC6n1
BhbYV2AUp5hwAOPuY4+lPi8SS6jcWG61ltyl8YZFSaRAf3Jdcq8allIPQheQCMitSKfw6/n6NHe2
LvO8gltRchnZmJLjGc5znjtT00TR7KaJipWV5g6Ga5dmeQIy5+ZiWbaSO/A9hjqcl1XoeXyyv7rV
tbmf/wAJXcDRrTUG0zDXzKttCkjyMflLMWCRkgAKcYDZ4yB22NL1B9Q00XUtpLbSZYNFIrKcg9Ru
VTg9QSB9KG0awbTYNP8AJZbeDb5QSVlaPHQq4O4HtnPc1ZtbWGzt1ggUrGuTyxYkk5JJPJJPJJ5N
RNwafKjSKmmuZ6GBJ4s2aZa3n2LPn6fLe7PN+7sCnbnHOd3X26Us3imWzjuxeaeFmijhkiSCVpfM
ErFVBwgIORyAG9s9Ktp4V0dN+LaQq8Tw7WuJGVUf7yqC2FBwPu4q3No9hcGUy24YyxLC53N91SSu
OeCCSQRz71TlT7f1f/Inlq9yLRdUm1S3leexltZI324dJFVxjOV8xEYjt90cjvWe3ieVLC7vn0/9
xDO1tGFkZ3lkEnljChD8p65GT1AB77VlY29hE0duHwzbmaSRpHY9MlmJJ4AHJ6ACo/7JsTYzWZgH
2eZ2kddx5Zm3Eg5yDnkY6dsVN4X20KtPlSvqZUHiW4ltU3aZJHeS3At4Y5fMjjclS2dzxq20AHJ2
dRgZ61Hf32rx63pgitovOa2uGltjdssRKlMHcEOfbKjr2rV/sOw+xm1McpQuJDIbiQy7x0bzN2/O
OM56cdKWOw063urZAf8ASY4pFhEk7M5ViC5+YktztyTmnzQvou/5E8s7Wk+35mJJ40Zo7ZrPSri4
aS1S5kRUlYoGzhR5cbgt8p+8VHTnri9/wkTibUmey2WenDdNK0h3keWHG1NvXnBBIx79BYbw5pbR
QR/Z3VIIxCqpPIoaMfwPhvnX2bI5PqauR6faxtdMsK/6UczA8h/lC9Dx0AGKJSp9F/X/AAwRjUv7
z/r/AIcwtY1DVf7AM72yWshntzF5N0W3BpVyrHaNvHBxkc9TRP4rmtYpYptO/wBPS6FsIYXeVGJj
8zduWMtjb/sdfbmtBtH0q0tGjmLiBpIzm4u5GwysCgBZjj5sYA49qmn0XT7jzzJC26aVZndJXRg4
UKGVgQVOBjjHf1NNSh1Wn/Df8EOWp0ev/D+XoLpmoSahpgupLOaCT5gYXVlJIPbcFOD2JA+grDTX
ri9k0p5rdbdmuykkMN42+M+UzBZUaMH1+Xj+EgkV0lvZw2lqLaFWWMZ/jJYk8klickkknJOc1Th8
P6bA6yLDK8qyCUSTXEkj7gpUZZmJIAY4GccmpTgm9PQbjNpK/qY1v4xnmWGRtMjSGRbeQn7SSyxy
vsU42ckEHIz079qt2/iK5mnAlsI47WW6ltIpkuCz703csmwAA7D0Y9vwur4d0pI1jW1wqpFGB5jc
LG25B17Hn371Dpvhq0sLl7qRpLi4M8syM8j7I97E/KhYqDg43AAnn1qm6TTsv6+8SVVW1/r7jDsf
Fdxa6TpsCWVzqFwLKOedwsrsd2cAFI3yx2n7xUdOeuO0Rt8avhl3AHDDBH1rLPhrSisaiCRVRSgV
biRQUJzsYBvmTk4U5UZIAxWmksTO8aOhePAdVIyuRkZHbilUlCWsUOnGcdJPQfRRRWRqFFFFAHJe
H/8AkoXjH/ty/wDRRrra5Lw//wAlC8Y/9uX/AKKNdbWVH4fm/wA2d2Y/xl/gp/8ApEQooorU4Qoo
ooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigArnfG//ACL0P/YU
07/0shroq53xv/yL0P8A2FNO/wDSyGgDnZP9Y31NNp0n+sb6mm1sZHYUUUVIwooooAKKKKACiiig
AooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigDL8Sf8itq/8A15Tf+gGtHwj/AMid
ov8A15Q/+gCs7xJ/yK2r/wDXlN/6Aa0fCP8AyJ2i/wDXlD/6AKwl/F+R6Ef9x/7f/QytJnvbHR9X
vWmR7SKe8dYYYP3wIkbkOWKnvxtrO0/WL68urJbi9huTFqGxWUxTBkaBmBDiNeQwYblA/iHOK6qy
1ttQuXSHS73yEmeE3LGIJlCQeN+7GR/dq9Pc+RJbp5M0nnSbN0aZCcE5b0HGM+pFdXNa91qzzOS+
z0VzkG1TWY/Cmm6g2or5l6Y/PnmMcMduu0nIby2C5IUEsGGTxjPHQ6FcXdzoqS3U8M8pLbZYW3K6
gnac7VB47hQD1HBrVoqJzUk0lYuMHFp3ucEfFd3JpkAh1GN72PSria6VVQtHOgXG4Y+UgluOPpVq
81TV9PXUIo7s3TLbW86yzqieQHdlc5VMbQBnJVsYyciuzoqnUj/L/V7k+zl/MYfhi7vLuyme6vLe
8RZcRTwSiUMMDOXEaK2Dn7o9jyDWW+pawuhajqKXe+RLqS3RGVVSKMTbTISEJyq555GBkg857Cip
51e9iuR8qVzjYNY1EaQJJ9UtmtmuxE+owyrIIY9uSd5jSM/Nhc7SBnByRT7gPe6xo5tdZlf/AES6
K3sSxFpAGj9VKH6gc44rr6qyX8UWp29gyv5s8byKQBtAUqDnn/aFPnu9F3/In2bS959vzOJm8Ra1
Nb6c4vbSzMtjHMrSyCMXEpzlQpicvjC/KpVvm46jG1He6s9xrkyzGU2PEFoiLtkYwq2CcbiNx4wQ
eefSumoolUT2iEabT1lc4q/ukvfDknk67/aDm4tdzKIj5DGVeBsUD8GyRjmkvtX1eyivLVb9WWG/
WBr65ZIjFGYg+WYRlB8xC5KY5x15rrNQv4tNtRcTK7IZEjwgBOXYKOp9SKtU1UXbT/hv6+YvZvbm
1/4f+vkZeg3N1PoqT3c0VxJltssB3CRQTgg7VDHHcKAeo4NcppviXUp5J7j7Z5ttAkd20RaOR/Ky
wkRtka4ZQVYqMkEAEnOK7+ipU0m3bcp05NJKWxw2o6/qlhd2Sy3fly/u554pWjRWjkkIKqvllm2L
ncdygYBOat2mpan9stJ3vpJY59SuLRrYxxhAi+ZtIIXdkbR3x7d666in7SNrcovZSvdyOTstYu5N
MvLqPUBd6qlrJI+l7UP2eQdFwo3jB4wxJPas611fVotH1G5t72xvP9UxnimEnlMzYdmZYVUYXnBV
iuMnIwK72oLW8gvY3kt33qkjRscEYZSQRz7g01UWvug6b094yvDF3eXdlM91eW94iy4inglEoYYG
cuI0VsHP3R7HkGtyiis5NN3SNIRcVZu4UUUVJRyXh/8A5KF4x/7cv/RRrra5Lw//AMlC8Y/9uX/o
o11tZUfh+b/NndmP8Zf4Kf8A6REKKKK1OEKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiig
AooooAKKKKACiiigAooooAK5nx9PFbeFhcXEqRQxajp7ySSMFVFF5CSSTwAB3rpq5L4lQS3PgiaC
3CGaW9sUjEjFV3G7hAyQCQM98H6UAcW/jPw0ZGI1zTyMn/l5T/Gk/wCEy8N/9BzT/wDwJT/GkGme
IFGDFofHH/IRm/8Akej+zfEH/PLQ/wDwYzf/ACPWtzOx6bRXj3/C19d/59NO/wC/b/8AxdH/AAtf
Xf8An007/v2//wAXXT9SqnD/AGhQ8z2GivHv+Fr67/z6ad/37f8A+Lo/4Wvrv/Ppp3/ft/8A4uj6
lVD+0KHmew0V49/wtfXf+fTTv+/b/wDxdH/C19d/59NO/wC/b/8AxdH1KqH9oUPM9horx7/ha+u/
8+mnf9+3/wDi6P8Aha+u/wDPpp3/AH7f/wCLo+pVQ/tCh5nsNFePf8LX13/n007/AL9v/wDF0f8A
C19d/wCfTTv+/b//ABdH1KqH9oUPM9horx7/AIWvrv8Az6ad/wB+3/8Ai6P+Fr67/wA+mnf9+3/+
Lo+pVQ/tCh5nsNFePf8AC19d/wCfTTv+/b//ABdH/C19d/59NO/79v8A/F0fUqof2hQ8z2GivHv+
Fr67/wA+mnf9+3/+Lo/4Wvrv/Ppp3/ft/wD4uj6lVD+0KHmew0V49/wtfXf+fTTv+/b/APxdH/C1
9d/59NO/79v/APF0fUqof2hQ8z2GivHv+Fr67/z6ad/37f8A+Lo/4Wvrv/Ppp3/ft/8A4uj6lVD+
0KHmew0V49/wtfXf+fTTv+/b/wDxdH/C19d/59NO/wC/b/8AxdH1KqH9oUPM9horx7/ha+u/8+mn
f9+3/wDi6P8Aha+u/wDPpp3/AH7f/wCLo+pVQ/tCh5nsNFePf8LX13/n007/AL9v/wDF0f8AC19d
/wCfTTv+/b//ABdH1KqH9oUPM9N8Sf8AIrav/wBeU3/oBrR8I/8AInaL/wBeUP8A6AK8ZvviZrV/
YXNnLbWAjuImiYrG+QGBBx8/XmptO+Kuu6ZptrYQ2mnNFbRLEheNyxCjAzh+tc1XC1oVL8renQ9b
C4vDV8I6ftFFqV/edtLHqVnol1aaXqkscbnUJpLkxRTXDPCwZ2K5j3bORjsDzz3rK0zw5fW89sTY
OkUN958Zk8hWjRoCrDEWFX5wOF9QeTnHGf8AC4/EX/Pnpf8A36k/+Lo/4XH4i/589L/79Sf/ABdV
+/19x6+Rm8Phm0/bw6/a7/I7lvC86eFNNtltWEymNr+KEQtJOApABMgKNtJBAbjA46Cuh0LT3sNF
S1YTJyxCTMhZASSF+QBRgdl4HQEjmvJf+Fx+Iv8Anz0v/v1J/wDF0f8AC4/EX/Pnpf8A36k/+LpT
9vNNOD18hxoYaLTVeGn97/gHZHRtYm0yCyOmSRta6VcWnmNLHtldgoXbhicHaeoFWrzw1dIuoQ6b
bi2guLa33rAUXzXV2Mgwcjcy8ZYYOcHiuD/4XH4i/wCfPS/+/Un/AMXR/wALj8Rf8+el/wDfqT/4
uqcsR/z7f3ed+5P1fDf8/wCH/gXy7HqfhjTG0yymTyriBJJdyQzmEFBgDhYVCLkg8DOep5JFZb+G
7k6FqKpB5d/PdSOWUoXkgM2/YGOQAy9jxk8jk1wH/C4/EX/Pnpf/AH6k/wDi6P8AhcfiL/nz0v8A
79Sf/F1P7+9+R/cV7DDcqj7eH/gX/AO9g0CeDSBGllcvbfaxLLp0xtwZYwuCu2MLEPmw23ODjJOT
irUugRX93pvm6LFHYQ29wptZRGyxMzKVG0EjsTxkCvOP+Fx+Iv8Anz0v/v1J/wDF0f8AC4/EX/Pn
pf8A36k/+Lpv27+w/u8rCWHwy09vD7/O/Y6+bwxqdxb6ct5FdzGOxjhVYntybeUZ3MWlDFc5X5o8
t8vQ4FbUegTm41ycKEvJvlsrpyGZP3KoWBHKnIOehOPpXm3/AAuPxF/z56X/AN+pP/i6P+Fx+Iv+
fPS/+/Un/wAXTk8Q/wDl2/u+Yo4fCxd/bw/8C7adj0CTRftGhSWlt4f+xM0tuZVZoh522QFmO1iD
wDyeT6VBfeGboRXlva2rR6cb9ZltLYQ4kj8oAhUkBj+/zhgM4z1xXDf8Lj8Rf8+el/8AfqT/AOLo
/wCFx+Iv+fPS/wDv1J/8XQniE/4b+708/IPq+Gat7eH3+vl5nrWhWEmn6KlsfOjOWKrMyM0YJJA+
QBRj+6vA6Akc1zOleG7mzjuGutPurqY27RzrI9ssd25I5yqh2GQTukII7ZJNcX/wuPxF/wA+el/9
+pP/AIuj/hcfiL/nz0v/AL9Sf/F1K9um37N6+Q3QwzSXt4af3v8AgHX3mmT2Uem2mqWH9qSHUAWk
+RvtY8p8AiRuq9PmOOARySKmufDt/Np9gk9rO1rG87Gwg+zyGIO+YxiYGMhVyvHTOBkVxX/C4/EX
/Pnpf/fqT/4uj/hcfiL/AJ89L/79Sf8AxdXzV/8An2/uJ+rYbb28P/Av+Aek6Z4faLWIp72AzJBY
wRxPO6ykSqzknOB8wBGGwOvHep/DWl/2S1/CdNW3Z7iSQXCCMLMrOxUcHd8oOPmAx2zXl/8AwuPx
F/z56X/36k/+Lo/4XH4i/wCfPS/+/Un/AMXUP27veD+4tUMMrP28Pv8AK3Y9vorxD/hcfiL/AJ89
L/79Sf8AxdH/AAuPxF/z56X/AN+pP/i6z9lW/kf3GnLQ/wCf8P8AwL/gHt9FeIf8Lj8Rf8+el/8A
fqT/AOLo/wCFx+Iv+fPS/wDv1J/8XR7Kt/I/uDlof8/4f+Bf8A9C8P8A/JQvGP8A25f+ijXW18/2
fxK1my1nUtUjtrAz6h5Xmq0b7V8tdo2/Nnoeck1o/wDC4/EP/Pnpf/fqT/4utKGBrOF2rav82Y5l
mWG9vaMua0YK62uoRT/FHt9FeIf8Lj8Q/wDPnpf/AH6k/wDi6P8AhcfiH/nz0v8A79Sf/F1t9RrH
D/aVDz+49vorxD/hcfiH/nz0v/v1J/8AF0f8Lj8Q/wDPnpf/AH6k/wDi6PqNYP7Soef3Ht9FeIf8
Lj8Q/wDPnpf/AH6k/wDi6P8AhcfiH/nz0v8A79Sf/F0fUawf2lQ8/uPb6K8Q/wCFx+If+fPS/wDv
1J/8XR/wuPxD/wA+el/9+pP/AIuj6jWD+0qHn9x7fRXiH/C4/EP/AD56X/36k/8Ai6P+Fx+If+fP
S/8Av1J/8XR9RrB/aVDz+49vorxD/hcfiH/nz0v/AL9Sf/F0f8Lj8Q/8+el/9+pP/i6PqNYP7Soe
f3Ht9FeIf8Lj8Q/8+el/9+pP/i6P+Fx+If8Anz0v/v1J/wDF0fUawf2lQ8/uPb6K8Q/4XH4h/wCf
PS/+/Un/AMXR/wALj8Q/8+el/wDfqT/4uj6jWD+0qHn9x7fRXiH/AAuPxD/z56X/AN+pP/i6P+Fx
+If+fPS/+/Un/wAXR9RrB/aVDz+49vorxD/hcfiH/nz0v/v1J/8AF0f8Lj8Q/wDPnpf/AH6k/wDi
6PqNYP7Soef3Ht9FeIf8Lj8Q/wDPnpf/AH6k/wDi6P8AhcfiH/nz0v8A79Sf/F0fUawf2lQ8/uPb
6K8Q/wCFx+If+fPS/wDv1J/8XR/wuPxD/wA+el/9+pP/AIuj6jWD+0qHn9x7fRXiH/C4/EP/AD56
X/36k/8Ai6ntfjNq6S5u9NsZY/SLfGfzJb+VH1Gt2BZlQ7/ge0Vzvjf/AJF6H/sKad/6WQ1gaf8A
F7QbnAu4LmzY9yu9fzHP6VwniP4maxrlnPYJHa28H2iOaGaKM+ahjlWRD8xKk5Rc5XHXiojhKzdr
Fzx9CKvzXK/ivwd4jvfEMdxofiK/tbO5lP2mJryTFv1JZBu5B6bexI6Kfl6SLwxZRwojXmrysqgG
R9VuNzn1OHAyfYAV50dc18kk67dkn/pnD/8AEUn9t69/0HLv/v1D/wDEVt9SqdjH+0aPcp0UUV65
4AUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFA
BRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAF
FFFABRRRQAUUUUAFFFFABRRRQAV0vg7w7DrlzeXN87Jp2nw+fcFDgt1wo+uD+Vc1XU+FdZsbLRdf
0u9na3Oowosc2wsqld3DAZODu7VnV5uR8u5rQ5faLn2JbS90LW4L6yn06CxnbaNNa3jYsXzgK55y
Dxz9a1PGNnaeHtS+yWHhyGa3ihTzLiWJ2Bc+4IHp+JqloN74V0efTRO/2m5S5FxPerG+2JVGVRFO
CcsBkkdzUV/qGmX/AIuOrz6wHtpLxZGhEMmRGD7jHQAVhZ8+l7fM6rr2erXN8v6+41fENpo/hvUd
G0pdGtriaW3ja7MhbcWb5eCDx0JrRk8E6Xo1z4mna0a8gtII2tI3BYiRgTtO3rzt/A1k6hrugXnj
aXxHc3stxFEytb2cULBmKgBQzNgAZGeM03VPHKXnhO5SK4mj1e+vfOmEYKiOMcKA3fgKPzrPlqNR
Sv5/eac1FOTdtL227W/E1P8AhCdL1SLS2ljXTrpbc3Opwwk/u48ZHBztY+/vWZ4bi0nxXq95pA0e
3tbPyHaCeMHzo9vRmb+LPfir8njXRpry+Q3EipqGlJbPc+UxKTAEfN3Yc9RmsPRNZ0zwvpt4LW7+
16lfL5HmpEyx28ZPJ+YAse+MdqEqji73v0CTpKSta3Xb+tfIu3nh3TYvh3cTxwA6pZtE00ueSJDk
DH0YU6Lw9pemfD3Ub6+thLqasqKzHiN2xhfqByajs/GdhbL4m8yP7Ql35f2OJ0O1ihwpb0Awpx3x
VDVvENpP4F0/SbeeSW7a4e5vSykZck9+/WrSqt2d9/8AgkOVFLmVtmvxt95Jp2hmPwZHrNjp0eqX
TzMs6upcW6L0+Qc5PXPpWhYaT4d1h7mG2tXhl1MONPMhx5UkaKWHuCxYDP8AdrN03UtI0nW7DUtO
1Oazt44Ua5tlVzI7gfMvTaQT3J71R1fxF52sWV/YfuTbnzwqjAWRnLsB+Jx+FVyzk3YlSpxir2/r
r/XU0fCegWd3Lbf2lb7l86aSYEkERRJ8wx/vEflXHzMrzSMi7ELEqvoM9K7/AFLxXorvq9xYbonu
bHyoYwjf6yVszHPavPa0pczblLQxrqEUox1CiiitjnCiiigAooooAKKKKACiiigAooooAKKKKACi
iigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKK
KACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAoooo
AKKKKACiiigAooooAKKKKACiiigAooooAKKKKAP/2aBGHfAgTwAA7DAIU0bz6YUlJ/zypFCM+v//
2P/gABBKRklGAAEBAQBgAGAAAP/bAEMACAYGBwYFCAcHBwkJCAoMFA0MCwsMGRITDxQdGh8eHRoc
HCAkLicgIiwjHBwoNyksMDE0NDQfJzk9ODI8LjM0Mv/bAEMBCQkJDAsMGA0NGDIhHCEyMjIyMjIy
MjIyMjIyMjIyMjIyMjIyMjIyMjIyMjIyMjIyMjIyMjIyMjIyMjIyMjIyMv/AABEIATUBTQMBIgAC
EQEDEQH/xAAfAAABBQEBAQEBAQAAAAAAAAAAAQIDBAUGBwgJCgv/xAC1EAACAQMDAgQDBQUEBAAA
AX0BAgMABBEFEiExQQYTUWEHInEUMoGRoQgjQrHBFVLR8CQzYnKCCQoWFxgZGiUmJygpKjQ1Njc4
OTpDREVGR0hJSlNUVVZXWFlaY2RlZmdoaWpzdHV2d3h5eoOEhYaHiImKkpOUlZaXmJmaoqOkpaan
qKmqsrO0tba3uLm6wsPExcbHyMnK0tPU1dbX2Nna4eLj5OXm5+jp6vHy8/T19vf4+fr/xAAfAQAD
AQEBAQEBAQEBAAAAAAAAAQIDBAUGBwgJCgv/xAC1EQACAQIEBAMEBwUEBAABAncAAQIDEQQFITEG
EkFRB2FxEyIygQgUQpGhscEJIzNS8BVictEKFiQ04SXxFxgZGiYnKCkqNTY3ODk6Q0RFRkdISUpT
VFVWV1hZWmNkZWZnaGlqc3R1dnd4eXqCg4SFhoeIiYqSk5SVlpeYmZqio6Slpqeoqaqys7S1tre4
ubrCw8TFxsfIycrS09TV1tfY2dri4+Tl5ufo6ery8/T19vf4+fr/2gAMAwEAAhEDEQA/AOgUM7BV
BZmOAAMkmtQeG9XIyLNiP99f8a0fBVrDPeXMsiBniC7Ce2c5ruq9XEYuVOfLFHnUcMpx5meaf8I3
q/8Az5N/30v+NKPDer/8+Tf99L/jXY3l7qE+rtp2mtbxNFCs0008ZkHzEhVChl5O1jnPGOhzxM+u
2EN6tlPKVucqr7Y3aNHbopfG0E5GASCcjjkVzf2hPyN/qMTif+Ec1f8A58m/76X/ABpf+Ed1b/nz
b/vpf8a7O38RaZdXgtYZpDKzvGpMDqjMmdyhyNpI2ngHtVWw8WWV1Yy3M0VxBsuHgCfZ5GZyGYDa
NuWOFJIAO3nPSj+0Z+Q/qC8zl/8AhHdW/wCfNv8Avpf8aX/hHtW/582/76X/ABrr5PE2lRRwuZpm
85XZEjtpHfCkBsqqkggkAggEVKdf0wQzTfagY4bdbp2CsQImzhuBznaenNH9oTfYPqK8zi/+Ee1b
/nzb/vpf8ahutJvrOLzbi3ZEzjOQf5V6WrB1DLyCMimzQxzxNHIoZWGCCKpY6d9UQ8HG2jPLre2m
u5RFBGXfGcD0q5/Yepf8+3/j6/411kGnQaaXihXGWyT1J9PyqarljZX91aERwqt7xxv9h6l/z7f+
Pr/jR/Yepf8APt/4+v8AjXZVi+IdWl0pbHy57S3W4uPKea6UlEG1mz95e4A696zlj5xV2XDBRm7I
x/7D1L/n2/8AH1/xpj6DqZHFt/4+v+NbNh4hjbSba5vwVmm37Vt4Xk8xVYjzFVQWCkYOenzDnkVZ
/wCEg0stCqXXmeagkUxRs4VDwGYgEIPdsdD6ULMJeRTwFnbU5Y+HdVz/AMev/kRf8aP+Ed1X/n1/
8iL/AI1vaR4kgvZZLa6byrn7TNEg8p1RgjHo5G0ttGSAfXirI8SaVtkY3LKscTTbmhdVdF6shK4c
dPu5601mUmr6A8vs7anMf8I7qv8Az6/+RF/xpP8AhHdV/wCfT/yIv+NdQfEemAJ+9nLOSEQWspdg
ACWC7clcEfNjHPWqtr4mt21a8s7lwipOkVvIkTlGDIrDL8qCSTjkdqP7SltoCwHqYP8Awjurf8+n
/kRf8aP+Ed1X/n0/8iL/AI11q63p73q2gnbzGcxqxicRs4zlQ+NpPB4BzwfStCqWPm9rEPBxjucI
vh7VQf8Aj1/8iL/jSz6Xe2kPmzwFUHBO4HH5Gu6pGVXUqwDKRggjgimsbO+qE8LG2h50ahc1ua1o
zWLGeEFrZj9Sh9D7e/8Ak4Mh5r0ac1NXRxzg4uzGliO9ezV4sTXtNcGY/Z+f6HXgvtfIKKKK8w7w
ooooAKKKKACiiigAooooAKKKKACiiigDi/A3+uvfon9a7Sud0vTYtIMptpJCZMZ3kHpn2960ftM3
9/8AQVviJKpUckYUVyQSZHe6XdNqH2/TruK2uGjEUvnQGVHUEkcBlIIJPOe54PGKb+G7iS5ctqKm
1mmiuLhDB87yRhMFWzhQTGpI2nvgjPGh9pm/v/oKPtM39/8AQVz+zR0Kq0UoPDnk/Yv9Kz9mvZrv
/V/e8zzPl68Y8zr7dOaqXHg9ri3MD3NpLFHdPcwJcWfmKC5YsHBbDj5zjG0jA699j7TN/f8A0FH2
mb+/+godNMftpFKz8NJZzWkiSQoIIJojHDbrGhMjKxIA6AbcY5PqSeTnv4NuV082ltqccayaeljO
0lsXLKoYBlw42n5j1z2rd+0zf3/0FH2mb+/+go9mgVaRfjTy41TOdoAzTqzvtM39/wDQUfaZv7/6
Cq5TPmC5/wCPhvw/lUVKzF2LMck0lUSFUNR0xdRnsZGkCrazGUoU3BwUZcdePvVfopSipKzHGTi7
o5RvBa4t8XNvMLYPHCl5aeeiwschcFh8y9A2Rxxir8Hh+SwvGn0y7htklijjmRrYEHZnBXaVCnk9
iPatyipVKJo6831MD/hGFaCCF7olY7ya6OEwWEgcbevGN/X26VUt/BcMGnXNoHswXtmt45o7FUkA
Ixuds5Y49Nuec+3VUUvZQ7B7ep3Mi50ec31tfWV3HBcxW5tmMsJkV0JB6BlwcjrmoJfDjTR3ga8y
1zdQ3Jbyuhj2cde+z8M1vUU/ZxEq011Od03wnb6dqHngWkkayNKhazXzwWJPMpJJAJOMAHpz69FR
RVRioqyJnNzd5BRRRVElXUv+QXd/9cX/AJGvOXPNenSRpNE8UgyjqVYeoNZp8OaUetr/AORG/wAa
68NiI0k7nNWpOb0PP69qrlP+Eb0n/n0/8iP/AI11dTjK8avLy9C8NSdO9woooriOoKKKKACiiigA
ooooAKKKKACiiigAooooAyaxtR1e8i1NdM0qwiu7sQ+fL59wYY40JIX5gjksSDgYx8pyRxnZrnNT
jubLXm1PTJdOkmlgW3uba8ujCMKWZGDBXwRvYEFecjkY5pyS3ISuS2PiuwuNZvNKuprazvYZ1hig
luV8ybMaPlV9t2OM9OtaK6vpj6lJpy6jaNfRrue2E6mVRgHJXOQOR271yc2jSXMOpGW/0zz7zUrS
9ys3ygRCHcOmQf3bY69Rz1qOw8OxWutNLLdWktul3NdxTtqs7MWk3nH2fPlKRvI3ZOQD8oLZC9pH
uVyHWjXtHa1nul1axNvAFaaUXKbYwwypY5wAQQRnrWfeeMNJsb/T45r2ySwvbeWdL57pFi+QoAAT
wc7/AF7d6yrfSPsPhbw/ZwXenPe6QySmJrnZDM4RlbLbSR94sDtPIHHpc+zG51rT9SubjS4jDaXM
UsUU+4B5WQjaSBuGFOSQOT0o9pG+4uU27rWdKsmtlu9Ts4GuuLcSzqpm6fcyfm6jp6ipBqenm++w
i+tjd5I8jzl8zIAYjbnPAYH6EeteeDwgUs7KBryxuB/ZkOn3C/2rcW6Js3ZIWIjzlO8/K23p1G44
6vRbW10vU9ZumvLMrezxvGVmywRYkQBs+6t69afPHuDizTutc0ixvorK71Syt7uXHlwTXCJI+TgY
UnJyeKfJqunQ6jFp0uoWqX0q7o7ZplErjnkLnJHB7djXFa7Dd6n4k1q0szp/2S/0qG1kurmcqseW
lBKAKRIwDZ27l7c81au9Jlk1C5iivdMaxu722vZLiS4PnxGHy/kVNpDZ8oYbcMbjwccpTj3G4HXD
UbFghF5bkSSNCmJV+Z1zuUc8sNrZHUYPpSWep2Go7/sN9bXWwKX8iVX2hhlc4PGRyPUVxkWkXkeo
WkX2vSf7PtdTuL5ZvtZ81xKJflKbMAgyddxyB2rf8MRWuh+GdO0yW8szLbQLHIYpQVLAckZweTnt
RzxtuJxZsw3MFz5nkTRy+W5jfYwbaw6qcdCPSpayNMnhtvtnny6XF5ly8ifZWC7lOMM+ernufpV/
+0LL/n7t/wDv4P8AGjnj3FyssUVX/tCy/wCfu3/7+D/Gj+0LL/n7t/8Av4P8aOePcOVliiq/9oWX
/P3b/wDfwf40f2hZf8/dv/38H+NHPHuHKyxRVf8AtCy/5+7f/v4P8asU1JPZiswoooo5kFmFFFFH
MgswoqNpoluEt2lQTOrOsZYbmVSAxA6kAsuT23D1qSmtQCtasmtalIqIUUUVJQUUUUAFFFFABRRR
QAUUUUAFFFFABRRRQBk1ytloWj618Q/EH9raVY3/AJNlY+X9qt0l2ZM+cbgcZwOnoK6quF1OzfUP
EHie2SB596aNujRSSVFzIW6dgASfYGnLoKG52H/CC+EP+hV0P/wXxf8AxNH/AAgvhD/oVND/APBd
F/8AE1xPiLRLxNdvoobWKIbIk0eSDQZLqS3UIFCwzLIiW5Dhj820cgk46bc1hajxjdz6vot7e30k
9udNu4LdmEUQRQQJQcRAP5hZSw3BsYbOKRRe0zwx4J1WCWaDwloyrFPLbsH06EHdG5RiMA8ZU49q
u/8ACC+EP+hV0P8A8F8X/wATXNafoD2uo6fqUWmPHfvr1751yYTv+zt9oIyeojJ2ED7uSD1Oao+E
9L1O31zT2uYxFqEbSHUpYdDlhaf5WB826aTZMCxVhtDHODhQDgB6HZ/8IL4Q/wChV0P/AMF8X/xN
Uk8MeCZNan0oeEtH8+GCO4Zjp0O0q7OoA4znKHt6VzVpoFnZeH/C39reH5bjTVtHa+tVsWnb7UUQ
I8kSqWYhQ65KnbkdOMT614dTUF1af+xbpjD4eiFglyplkinUzFQpy2ZVyvIJYZ688lgsa0GjeAbn
X59Fj8J6Z9rgQSPu0ZQgBJH3imMfKcHoexODjV/4QTwh/wBCrof/AILov/ia1LSzt1KXRtolu2X5
5fLAckhd2T152Ln/AHR6CrlAjn/+EE8If9Crof8A4Lov/iaP+EE8If8AQq6H/wCC6L/4mugooA5/
/hBPCH/Qq6H/AOC6L/4mj/hBPCH/AEKuh/8Agui/+JroKKAOf/4QTwh/0Kuh/wDgui/+Jo/4QTwh
/wBCrof/AILov/ia6CigDn/+EE8If9Crof8A4Lov/iaP+EE8If8AQq6H/wCC6L/4mugooA55vBnh
a1U3Fv4a0eGeIb45I7GJWRhyCCFyCDzmp7j/AFL/AOe9at1/x6Tf7h/lWVcf6l/896znsxrdFGsO
68Tw29xcrFp9/dQWh23VzbopjhOMkYLBmIBBOxWx9eK3K5G2uptAh1PTpdNvrmeW6mmtTBbNIk4l
YsAXA2oQSVO8rjGehrhjqzosbM3iLToGuPNlKwwWiXjTYyjRuWC7ccknaeMc5GM5q9ZXL3dnFcPa
z2rOM+TPt3r9dpI/WuDTwhfC4tYllkW503SbQW7EH7PJcRvIcNxyB09g+cZwR3Om3p1DTobo289u
0i5aGeMo6N3BB9D36HqMiqkkloLqZ6f8lJsP+wRdf+jreusrk0/5KTYf9gi6/wDR1vXWV24b+Gjn
q/EFa1ZNa1ayJiFFFFSUFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAZNU7PTxZa3f6pFITNexQxOrD
Kqse/bj3zI2fw/G5XPX+v6jDrtxp1hpMN2lrax3UzNdmNyGZxtRdhDN8h6so5HI61UkmRG/Q6f7X
P6x/98H/ABo+1z+sf/fB/wAaxrHxFo+ovBHbalatcTQLcLbmVRL5bKGDFM5AwR2pYPEOiXSztb6x
p8ot4/NmMdyjeUmM7mweBjuaXIh8zNj7XP6x/wDfB/xo+1z+sf8A3wf8ao2V9Z6lardWN1BdW75C
ywSB0ODg4I460+3uYLuBZ7aaOaFs7ZI3DKcHHBHvRyIOZlv7XP6x/wDfB/xo+1z+sf8A3wf8ahoo
5EHMyb7XP6x/98n/ABo+1z+sf/fJ/wAahoo5EHMyb7XP6x/98n/Gj7XP6x/98n/GoaKORBzMm+1z
+sf/AHyf8aPtc/rH/wB8n/GoaKORBzMm+1z+sf8A3yf8aPtc/rH/AN8n/GoaKORBzMm+1z+sf/fJ
/wAaPtc/rH/3yf8AGoaKORBzMkkuJpI2QlMMCDhT/jWbq51L7FjSre0muCwBF1O0SBe5yqMSenGB
168YN6il7NbMOZnJ7PGn/QO0D/wYTf8AxijZ40/6B2gf+DCb/wCMV1lFZ/VqfYr2sjk9njT/AKB2
gf8Agwm/+MUbPGn/AEDtA/8ABhN/8YrrKKPq1PsHtZHK6VpWvN4ri1bVodNhihsZrZVtLmSVmLvE
wJDRrgDyz3PUV1VFFbQgoqyIbbd2Fa1ZNa1EhxCiiipKCiiigAooooAKKKKACiiigAooooAKKKKA
MmuZv9L1xfEl5f6Yun+VeWcVqZLiZw0BVpCWCBCH4fpuXOOo6101FWZpnCReC9TtdX094bpJLHT5
EFsJLyUbYhAYinlBdm7LFt/JOccCpYfB13Fp2kW8sdnciz0iWwnhM7xLK7eWRh1UkL8h5xkcYFQ6
l4ulDLcy+INK8P6bNevZ2M11btcveMp2uxUMnlIjgqWPHc7RtLdnZtfLZA6pHbxXa7vNS2kaSMcn
GGKgn5cHoOtSp3KaaKmg2+p2umeXq06S3HmMVCSGTy48/KhcqpcgfxFQT3yeTNo9tPaaVBBcw2UM
y7t0dkhWEZYn5QeenX3zU1je2+pWEF7aSeZbzoJIn2kblIyDg8j8asVZAUVE91BHMsDzRrMyM6xl
huZVxkgdSBkZ+oqCz1Ww1CG1ltrqN1u4vPgBO1pE4+YKcHHzDtxkUDLlFFFABRRRQAUUjMFUsegG
TUFje2+pWEF7aSeZbzoJIn2kblIyDg8j8aALFFFFABRRUcdxDNJLHFNG7wtskVWBKNgHBHY4IPPY
igCSiiigAooooAKKpagZ2m022gupLb7Td+W8kaIzbRDK+BvVh1Re1Q3Igs9QjsZ/FGpLcSbQB9mt
yoLEhQzCDapJBAyRntWUqqTtY66eElUimmtVe1m9L26JmnRTP7Cuv+hg1H/vza//ABmj+wrr/oYN
R/782v8A8Zp877fl/mT7CH/Pxf8Ak3+Q+tasb+wrr/oYNR/782v/AMZqGytpdRgM9r4o1SSMO0ZP
k24+ZSVYcw9iDUud3a35f5lRw6s5c6t6S/8AkTforClsp4JooZPE+piWXcY0EVsS20ZOAIe3+FVp
3W1geafxVqsapb/aXV7eAMsfqV8jI+hGevpU+08vy/zLjhXK3LJO/lL/AOROmorIGk3pAI8Sapg/
9M7b/wCM0v8AZF9/0Meqf9+7b/4zVcz7fl/mR7GH/Pxf+Tf5GtRWT/ZF9/0Meqf9+7b/AOM0f2Rf
f9DHqn/fu2/+M0cz7fl/mHsYf8/F/wCTf5GtRWDZ2s1/b+fa+J9Ukj3sm7ybcfMrFWHMPqDToFvb
LxHa2kuq3V5BPaTyFZ0iG1keIAgoino7dc0ufrYp4azceZXV9Nem+6NyiiirOYKKKKACiiigDJoo
oqzM55/BOg3VpDaalp0Oo29teyXlrHPx5DO25lBHLIWJYqxIJPPAULvyhpUkyQXcHJxgdKwpvEdx
NfXVpo2h32qvZyeVdNEY4kjcqGChpWUMcHJ25xxnGRnW0+9TUbKO6jhuIVfP7u5haKQYJHKMAR07
is0otlts8vS08Qrp2k2guNTsEt9OjhgSCwuZD9pUsr7vLkjUchMGXMZHION2es043UHje4jc6leL
MhLyyLcRQW2FQbQrfuZNxyQU+Yc5zyR1tFakN3OO8T6as3izSb2aPUzbi1ntzJYyXA2yM0ZTd5Jy
oOGyxwOBk8Csq2sbsTeENS1OLV2mj0x4ZnQ3DOs58sqJVTnBw2S4xwN3QV6NRSWg7nnL2OuReB9G
kN3qi3M5ibVHcXM8yKIzgCON1kX5tgPlkMepz81OZNTtLfRJprjWdQlR3CWqwXdv5qtKNjO6u23a
vacncPvbTk16JRT63E3ocx42Eo062lik1AmKUv8AZrJLnNz8pwhe3+aMZx8xyM9Qaw7iLxDceLBJ
JdahZ5lgNtBHazzRiHapcNIsogznzAfMUt/dz8leh0UuoXOBgudXa/sdNdNWM0er3TXEjQzeUbdl
mMeZMbGXmPAycHAwMViJaeIV07SbQXGp2CW+nRwwJBYXMh+0qWV93lyRqOQmDLmMjkHG7PrNFMfM
efXdlrNz4hl82XV/s7aiICYZpoo/I+ybiRsIAHmgfMOQeM8kHOuU8UXVrpJuLzU7VzpkPleVZXMr
m553+Z5cqKrfc/12U69Pmr1KigLnBXdprIvtRvll1Vp4NVtFt1SSURNCRCJcRg7GXmTJwcc8jFaW
g2QsfGXiFpYr9ZbqZZoWYzNA0flxgkHmMNuBGPvAD0rq6KFoK4UUUUAFFFFAFS6/5Ceh/wDX+3/p
NPVfWLLVG8RR3emWdxFN+5RruO5TyZYw53rLG3OQC20qCfm6jGKdrSQGxSWeK5lMU8ZiW1mMUnmO
fKXDBlx/rCOSBgmqP2C6/wCgP4l/8HH/AN01zVF734/1oz18JNKEZ9k462s9b9ZRvv1Vivp/hrU7
fW5LqWG4a7WaeT7X5sCRyqwbYpKr5x6qNpIA25B4Aqla+FtX+w30bac8IulsmaLfCo8xJt0uNh6B
ejMSxHUk8Vq/YLr/AKA/iX/wcf8A3TR9guv+gP4l/wDBx/8AdNYqklby9f8AI9D69O97rp/L0d1/
y87ks3h/7P4gaSHRI7i1xALNoZEgWy2uxkxghhnO75Qd3Q1Dpnhq6s7jTbv7Ekd0mpXElxKrLu8h
vNKgkHlclDt9e3Wl+wXX/QH8S/8Ag4/+6asfY/8AqB+KP/Bz/wDdVPkSd7fn3T7eRl9Yk48vP0t0
7Nf8/Ldde71Za1/SGvNc0y9j05Lnyo5o3kwm6MsBsPzEHAOemSM1zs3hS+GnBF0hHu30JbQygxZS
YDBBJbPIwMjI98VsfY/+oH4o/wDBz/8AdVH2P/qB+KP/AAc//dVJwTbdt/Xtbt5jo4iVGMYxktP8
Pdv/AJ+eZSm8NahL4oku5orqTdcxSQXUUkCrDGoGVLMplGCD8qfK27nGSal0zQtQtPGsl+LDbbvJ
KZJpmjY4bJGyRSHYH5PkkUhdpw3SrH2P/qB+KP8Awc//AHVR9j/6gfij/wAHP/3VTUEne35/5DeJ
k4uHMrcvL9nb/wAD3I/EeiXt9qN7IunfbWntFisZ/MQfYZQWy/zEEclW3ICflxjpVZvC96ZL26e0
SW//ALTtpoLncofy18oSMpz8udrZHBPvxV37H/1A/FH/AIOf/uqj7H/1A/FH/g5/+6qXIr3t+f8A
kKGJlCKjGS0/w+X/AE88te+vUxLzSp7YafYEIl9qU11ZzQ+aNxtpJWkMmBngKD9N9dhLGsXivS40
UKi6fdKoHYB7esr7H/1A/FH/AIOf/uqprSM2V4LuLw5rzziNow0+oRzbVYgkAPcEDJVenpVQXLpb
t36fL+rkV6qqpNvVKXWOrlf+9sr+Z09FZP8Aa99/0Lmqf9/Lb/49R/a99/0Lmqf9/Lb/AOPVvzr+
kzyvq8+6/wDAo/5mtRWT/a99/wBC5qn/AH8tv/j1H9r33/Quap/38tv/AI9Rzr+kw+rz7r/wKP8A
ma1FZP8Aa99/0Lmqf9/Lb/49VvTb9dTshcpDLD+8kjaOXbuVkdkYHaSOqnoTQpJuxM6M4R5na3k0
/wAmVKKKK1OYoeE7WTQ9Hk0+6wQl3PJFImT5iSStJkgD5SC5GMngA55IGg7eZI7427jnB7cY/pSU
VChYpyOB0fVteh05Inv7Sae+1m5tIJp4HYQBXmY7h5mXGI9qqCuMjk4rR0zxTe3d9ZWs8dqN8d8J
ZIwdryW8qx7kyeFOScHJHTPGTuzaBo1wbozaTYSG7Km532yHztv3d+R82O2elFxoWkXdpb2lzpVj
NbW+PIhkt0ZIsDA2qRgcelWJtXOV07V9Y1jWfCd2l3BBFe6XJc3MAidkc5iJwN4wfm4Jzjnrniz4
p1BtI8SWupiAzfZdIvpRGDjcVMJxnt9a6STR9LmhtYZNNs3itGDWyNApWEjoUGPlI7Yqea0triSK
Se3ileFi0TOgYoSCCVJ6HBI47Gn6BfUwfDGra3fXFzb6zZxwlIo5o3URoSGLDGxJ5Tj5eGJGeRji
pY9S1K8129hgks7ezsJ44ZVniZpJyyq2VYMAg+YAZVskHpWpp+ladpMLw6bYWtnE7b2S2hWNWb1I
UDnikm0nTbnUIdQn0+0lvYRiK4khVpIxzwrEZHU9PWgRzkHibUn1CCRxZGxur+4sI7dUYTRtEJPn
Z92Gz5R+XaMBhyccw6J4j1rUBpwvHsANU0uS8hMEDqYHXZw2XO8HfnjbjGOetdSmk6bHqMmopp9o
t9KuyS5EKiV144LYyRwPyFSRWFnAYDDaQRmCMxQ7IwPLQ4yq4HA4HA9BSHdHn+meIfE0Hhzw5a26
pqN/fWRuTOYAxCKEGCJLhN7ZfJbd2+7zkXLvxdrv2W6uoItOgWz0mHUpYpAZ/MLeZuRZEkCgYQYY
buvQ11EnhrQZbd7eTRNNeB5TO8bWqFWkPBcjGC3v1q3Jp9lN5vm2du/nRCGXdEp3xjOFbjleTweO
TTC6OaufFd3DHqbLFbj7NqVpaRBgclJvJyTz1/eNjHHA4NddWfPoOj3V6l7caTYy3cYUJPJbozqF
ORhiMjB6VoUdBBRRRQAUUUUAFFFFAFHV/wDjxi/6/bP/ANKYqyvEMtnbeMre5dre6uB9nQWcheO4
jy5AkgYfeHJ3qOMLye1bV/aveWZhjmWGQSRSo7R7wGjkWQZXIyDtx1HWjzNd/wCgnp3/AILX/wDj
9c1WDcrpdv1PUwWIp0oLml301Wj5eqT7dLMwdP8AEOsza3Is93brsmnWXT875EjQNtIjWIMOinc0
m1s8YJAFK18V6tPY3zxamkuVspIJcRuUEs2xgQEABxwV+YqeNxNdX5mu/wDQT07/AMFr/wDx+jzN
d/6Cenf+C1//AI/Wap1FbV/18zs+t4S9+SHTv0d39jrt6dzOm1G7svEDafda7JAsQg+ziaCN2vS7
sHyqqCccL8mMdTmqPh+5vLL+zjHdube81a7t3tmRdoG6VtwON27K+uMdq3/M13/oJ6d/4LX/APj9
Wfs/iH/oKaX/AOC2T/4/T5JKXNr/AE0+/lYzWJo+zcPd130fZq/wd3ff0scp40Zkv9YSTUJFV9Fd
orZigVjk7gBjJ6AnBz+HFS6jrGs6Sl/bQ3ZuBHBayiaVEX7OsjsrnKrjaAuclWx1OcV032fxD/0F
NL/8Fsn/AMfo+z+If+gppf8A4LZP/j9T7OSbav8A1fz8/wAC44uioRhLlaXr5f3PL531Knhy61DU
dKvPO1GCc+YyW91Awkx8o53eWiPg55VcdjyDXOnxRrXkeb9oTzGQaYIxGpA1DA+bpnqcY6YHSut+
z+If+gppf/gtk/8Aj9H2fxD/ANBTS/8AwWyf/H6pxk0lr/Xz/r5GcK2HjOUmotPprp/5KcpDNf6b
eaxdxX75TV7eGWMxptm3rCjFuMg85G0j8amXXtQluVjN95t1Lczw3Wl7EH2WFQ+2Tgbx0Q7iSDv4
HSul+z+If+gppf8A4LZP/j9H2fxD/wBBTS//AAWyf/H6n2crW1/r5mjxdGWslFvvr2t/J8+/S5w8
WuavaadpVpbXttYxJpdvJb+e+PtDkYIA8p2kx8o2oVbnryMdb4i1G5sjpaNejTra4lZbm9GzEWIy
VGXBAywxkj+dW/s/iH/oKaX/AOC2T/4/R9n8Q/8AQU0v/wAFsn/x+r5Z2e+v+fqTVxFCpOM7RVr3
31v/ANu9N9b6nM6h4hvokdhrHkulhHPYr9mEf9pSndkbHBbqFG1SD8+c9Kc+s6z5l9dtfPELbU7a
2Fp5UZTbJ5W5Sdu7jecEEfjXSfZ/EP8A0FNL/wDBbJ/8fo+z+If+gppf/gtk/wDj9Lkne+v9fMax
OHS+GP3Py/udbP79LLQ45tV1DTYLqODVcs+ryRXNxcyRp9nTB2kt5bBN2AMspHYYzmr1pqetX1zp
1q2rCNZrS5mM9rGreZsdQjAvGAeDyQoB6jqMdH9n8Q/9BTS//BbJ/wDH6Ps/iH/oKaX/AOC2T/4/
UqnNK13/AEvUcsXQkvhjfvZ9rfydP0+Zz3h6/uL/AF/Tbq81F/MutHjlFv8AIqOxPzbRjPYMcH9M
Cuh8Of8AIMm/6/7z/wBKZaPs/iH/AKCml/8Agtk/+P1Y0iwk07T/ACJp1mlaaWZ3SPYpMkjOcKSc
AbsdT0rSnFp6+f4u5zYutTqQfI0tVor7Lm8l3RRuzOtpIbbyxMB8pkyVHuQOv04z6jrVXQ7qW78P
2F1cvullt0eR8AZJGSeOKvsodCp6EYqCysorDT4LKMs0UMYjUuckgDHNdFne55ia5bMwv+EmDanF
MyzQaX9jmuDJIqYlClMOuCWAwTwQM5HFPi8ZadPbTSokjNEyAxrLCxO84U7g5Qc+rA/mMzReF7RC
FkubqaBbd7aOCRl2xxtjIBChuNowSSeKtrpcq20kR1W+d3wPNfyiQo7Bdm3ucnbk+vArJKZs3SsJ
Lq4jnSBbG6ln8sSyxR7CYVJwN2Wweh4Uk8VS1TX/AC7XVUtobsPZKRJcRxxsIjtDBgGYbuDnHsfb
M8Ph6C1SBbO7urbyoVhYxlMyoCSA2VOMZb7u3r9MTy6LbTW+pQM8oXUSTKQRlcoE+Xj0A65qrTaJ
TppkA8QQrdPA1rdeXFKkEl1hPLDuFKjG7dzuUZ24yaoT6/d/abyBreeCOC/ht1uI0jYbW2cMC+ed
2MgcAjuDVmHw6x1G7nuLuU20lyk6WyFdrFFQAv8ALuyGXOA2OBVifQIJ7maU3NwiTSxzvCpXaZEK
kNypP8AGM49u9K02VekmLHr1vJdCL7PcLE0jxR3BVfLkdM7lHO7+FuSADtOD0ymm6/DqUsKLa3MH
nwfaIWmCYkTjONrEjG4cHHWlj0G3juhL9ouGiWR5Y7csvlxu+dzDjd/E3BJA3HA6YktNFtrJ7Fo3
lJs7c20e4jlTt5PHX5R6d6qPNfUiXs7aEV5q09rr9pYpaPLBLBJK7rtypUqM8sOBnngnkY70yHxF
FPY293FY3jC6ZVto8IGmJUscfNgYAOSxHTjPGbd5piXd3BdCeaGaFWQNHt+ZGwSp3A8HaOmD71F/
YkA02ys4p54jZbfInQrvUhSueQVOQSDkY5pWlqCdOyuFvrlrcywxJHMryxyvtZQNhjYK6tz1BOOM
jjrUNr4ls7u2WZIrhC7RBY3UBmDruDdcYA3E8/wtSnw7AEt/Ju7qGWESAzIULyeYdz7tykckZ4Ax
2xUtroVnaGzKB3Nrb/Z0LnO5emW7EgZ/76PrR74/3Rm2XjDTLq5upPtZW3jgMqLmNgUX7zYViwPI
4YKfbOav6P4hstbeZLbKyRAMymSN+DnByjMOx4zn26UsOhQx2slpJdXc9q0RhSGRxtjQ9htAJ6DB
YkjHB5ObVlZPaBvMvbm6ZgBunK8AdAAoA7nnGT3PAwRU09Qm6bTsW6KKK1MAooooAKKKKACiiigA
ooooAK1qya1qmRUQoooqSgooooAKKKKACiiigAooooAKKKKACiiigDAvr2PT7YTyq7KZEjwgBOWY
KP1NWay/EFvPc6UUtoWmlWaKQRqygkLIrHBYgdAe9ZWtWV5rJtZZNPvFt4t6va/6M7ljt2vhyyED
DDqCM/Wt4xTRzyk4vY6miuXi0i4tdV06ZLKSeWOJIpbi5aKRY1AOdrcOH5xwu0+ncaGo6WL/AFyx
lmt1mtIoZRIHwV3EptBU9ehP4UcqvuJTbWxsVBe3cdjYz3coYxwxtIwUckAZ4rmrLQrqPxC13Mty
ZfPkk+1AwBGQ52rkL5pwCBtJxx14ApY9InGjX9r/AGUV1CS1kie8LR/6U575Dbjk8/MBinyLuHO+
x1KOJI1cZwwBGadXJXXh24jW9i0+AW0E1vBuSEovmsrkyDB43FeMsMHODxSW/h2TybOI2swthe+b
JBOYRtTy2U/LGAgBJ5AznOT1NHJHuJVJbWOuqtZXsd/C8kSuAkrxHcBnKsVP4ZFZP9m+VrbSSaUL
pN0f2WdfLAtUUAbRkhl5BPyg5zVS30CaG6trtLRI7oahPJLMu3f5LeZtyc5I5X5f0o5Y9xuUux1V
FcVp/hueKG5W6gvmke2eKdke3X7QxxypABbucyEYz3ya6LQIJ7bTBDNZxWm12EcaIiHbngsEJUMe
p2nH06BSglswjNt6o06KKKg1CiiigAooooAKKKKACiiigCtqM8ttprS2/lee09vCjSqWVfMlVCSA
QTgNnqKzr7ULjTrxrW61jT0kRFkcjR7hkjViQGZxMVUZB5JHSr+rf8gxP+v+y/8ASmOqetWGpyar
q/2bTXuItQ05LRJfMjCI+ZMlwWDYAcHgGuWs5KXu/r2f/APXwMKbprnstXvy/wB3rJPo2zRGna2R
kalpeP8AsHyf/H6P7N1z/oI6X/4L5f8A4/XO/wDCK348QmWZLqfE0LQXcckCiONVUFSzKZRyp+Vf
lbdzjJNSWvh/VIPFV1dwWnkpMZ83UzRuV3BtrI6kOwzs+SRSF2nDdKnnl/K/vZu6FO11Vhtf4Y/d
6/I3v7N1z/oI6X/4L5f/AI/TlXX2neEanp25AGJOlShec9G87BPHQHjv1rm4/Dl23htrGPQza3BF
ms7/AGlf9JdJVMj7VbHQE7iQxzjHApniXRvsD3TwWMUVhLLp8cMcW1FYidiygDp94c470OTSvZ/e
xwoQlPkVSN72Xuw/u66N93p5M6Wc63beX52saUnmyCNAdOk+Zj0A/f06Fdfnj3pqenAZK/PpUqHg
46GYHHHXv1Fc6/huV9k66CiWqanHPFYHyS0Ueza5A3bBlsHaD2z1pV8P3scdsb/R/wC0rZGu82W+
M7XkmLJJhmCn5cjrkbunWpUpa3i/vfkDpUuVWqRv/hh2b/yW9vM6X7P4h/6Cml/+C2T/AOP0fZ/E
P/QU0v8A8Fsn/wAfrkW8IanLY6gt9bx3t7/ZMUNvOzqxNwu/lSxyCMr8xx9etXLnQdSPjG31GKxL
4kiLzTPG6hQqglWDLKhA3jb86MTk45quZ3+F7933f+X4g6NO7Sqx0T+zHsvzvb5bdte6udYsri2g
m1fTvNuWKxImkzOTjqflmOAMjJOAKt/Z/EP/AEFNL/8ABbJ/8fqtq+itfeIdMvUtoiYIplNwyqTG
xA2Hnng5Ix0rmf8AhFdTm0x7aDThYzf2bLb3chkQi/nIG18qSTyGO58Eb/rSlKSvo3832/r/AIJN
KNKpCLdSMX1vGPd/PZLvv0R1/wBn8Q/9BTS//BbJ/wDH6Ps/iH/oKaX/AOC2T/4/XMahouratdSz
NpUkMbrYpslmj3ERzM0n3WI4Bz15+vFSS+G7i3vJgmkpPpCaj540+MxhJIzAFyEYheJMnBx0z6U+
Z9n977/0xqjC2tWN/wDDDstL331t20epq2uq6i15p5N/YXdrc3cto/lWUkLKyRyMcFpG6NHjpz61
0lcbpen3Gm2+g291b/Z5P7YuZBHvD7VaK5ZeR14Irsquk246+X5I48fGEaiUNVrqra+81fTTYKKK
K1OEKKKKAMmioL2Lz7OWPzJIwV5aNtrY9j1Hpkc+mK5NobeTwFp80iI0tvYpKHLfPCoUEyRju4wM
dPr2LcrBCmpK52dFZPiKaaPwvqE9rKYpFtmdJBkEcZ4wQQf5Vjaje3FvqmntJtuZYTCs7pEUEfmP
tBBMvBI6gK2cckDGFKdnYcKXMrnX0VjWt9eXxnmZ7aO0EssAhZD5uUJGd27HO0nG3p34rD0rWb3S
NCshMkFxD/ZTXMSxoUZdgX5WJYg53dcDGKXtENUW/U7WiuZh1TxDJb3CGyh+0II3Q7UzsYkE+Wsz
ZwASDuGeeOOdm3ujeaMtzBOkjPESsoiZVLY67ScjnsTmmppq5MqTT1LtFcno2oau9rolobi3ke6s
zO08kTFgF2YB+f5idxycj1xxg24davXuonYWxtp7qa1SFVbzEMe/5i2cHOw8YGNw5OOT2iG6LOho
rlh4i1CS00yWGG3d57E3cyBWydpTcF544ZsZzyBTL/WL++CWtnaxzw3gleMhQ26Fdq9DKgO4knIP
CkcHOQnUSGqEup1lFcnP4h1XEYs9PhAis47mYb42TDZ4DmVQqjafmAYc9OOdW2v7z+2ntb3yoYpA
TbRiIkyAAEnzAxGRk/KVB9MjmmqibsKVGSVzXooorQyCiiigAooooAKKKKAGTQxXNu9vcQxTwSY3
xyoHVsHIyCMdeao/8I/of/QE0v8A8Aov/iafqM12s+n21nJBFJd3BiMk0RkCgRSP90MvPyAde9UL
a9vbrUDYxarD9pGCyPoF0gUHOCSZAADg4JODisZyhzWau/kd+HpYj2fNTm0t9Ob0u7J9i5/wj+h/
9ATS/wDwCi/+Jo/4R/Q/+gJpf/gFF/8AE1Y/srXf+gtp3/guf/49Ve5h1Szltop9a05HuZPKhH9m
SHc2CccTccA9aXuL7P5FRlXk7Ktf5z/yD/hH9D/6Aml/+AUX/wATWj/wi3h7/oA6X/4Bx/4VW/sr
Xf8AoLad/wCC5/8A49S3sutadZyXV1rGmJDGBuYaZKx5OBgCYknJ6ClLlSvy/kOEq0nyqtdvzl/k
WP8AhFvD3/QB0v8A8A4/8KP+EW8Pf9AHS/8AwDj/AMKZFH4gmhSVNT04K6hgH0uVGwfUGYEH2NP+
z+If+gppf/gtk/8Aj9Ky/l/IbqVVo6/4y/yD/hFvD3/QB0v/AMA4/wDCj/hFvD3/AEAdL/8AAOP/
AAo+z+If+gppf/gtk/8Aj9ZmpalrNhb6kV1TS5bmxtDdvD/Zsq5XDEfN52OShHfHpSfKt4/kVT9t
UfLCtf5y/wAjT/4Rbw9/0AdL/wDAOP8Awo/4Rbw9/wBAHS//AADj/wAK1qK05I9jl+tV/wCd/ezJ
/wCEW8Pf9AHS/wDwDj/wo/4Rbw9/0AdL/wDAOP8AwrWoo5I9g+tV/wCd/ezOtdA0ayuEuLTSLCCd
M7ZIrZEZcjBwQM9CRWjRRTSS2M51Jzd5u/qFFFFMgKKKKAMkgEEEZBqq+m2EqQJJZWzpbkGFWiUi
PHTbxx0HSpbq4jtLWW5lOI4kLsfYDNZVl4hjfTYZr+KSC6aRoXt44mlZZBkkAKCTxzn0Nacl1cy9
pyu1zZZVdSrAMpGCCMgiqS6LpSBAumWQCKVXECjaM5wOOBnmlXV7J7ieESODACZXaFxGmACcuRtz
gg4zmmQ63p80E0wnZEhUM4lieNgD0O1gCQexA57Ucl+gKpbZk40+yF414LO3F042tP5S7yMYwWxn
oKelpbR+Xst4l8pDHHtQDYpxlR6Dgce1UH1mOSaxWBignnMbLcW8qNwpOBlRg9D82ARnFPXX9NKy
v57hIo2lLtC4VkXqyEjDgf7Oeo9aPZ+Qe18yQaNpa2jWq6bZi2Zt7QiBdhb1IxjPvVyOOOGJIokV
I0AVUUYCgdAB2FRW15DeQGaEuYwcbmjZc+4yBke44NVm1vTlt45zcYilga4RtjcxrjJ6e4460KHZ
Dc77sng06xtZDJb2VvDISxLRxKpJOM8gd8DP0FKlhZx3j3iWkC3TjDzLGA7D0LYyeg/Kq0euafLH
O4mdRAFLiSF0bDcKQCAWyRgYzk9Ks2d9BfRs8DP8jbWWSNo2U9eVYAjg55FHJboJVL9Rlvpen2k7
T21jawzNndJHCqsc9ckDvTrjTrG7t0t7myt5oY8bI5IlZVwMDAIwOKgXXNPZZ2WZysBKyMIn2hg2
0rnGC2eijk5GBzSjWrE2rXHmSKquIyjQuJNx6L5ZG7JHIGORzRyeQe013J57CyupIZLi0gleE5ia
SMMYz/skjjoOnpRHp9lDdyXcVpAlzIMPMsYDsPdsZPQVmXPiCK3vrIbZTa3EUrti2kaQFSoxsA3D
qc5HarUmu6dHHFIZ2dJYxKrRRO4CHozFQdo68nA4PoaPZ9bB7VbXNGiqK6vYtdS2yzEyRf6whG2o
Nu7LNjaBg9SeapX3iGKPTHu7QO2yWJW823kXKu4XKggFuCcEZFPlYueJt0VnLrunvbPOJZMJJ5TR
mCQSb8Z2+Xt3Zxz06c9Kt2t1DeQCaBiyEkcqVII4IIPII9DzQ4tApJ7E1FZ+maiLzzYnb/SIWO9f
Iki+Uk7ThwD0HUZGQeakk1Syi87fNjyJUhk+U/K7Y2jp33D86OV3sCkrXLlFZ0WuafPeLaxzOZGd
o1JhcKXXO5QxG0kYPGe1SWur2V7OYYJHL4LKWidVcDqUYgBxyOVJ6ijlYc0e4l3/AMhnQf8Ar9f/
ANJpqspY3kfiHV7xIhsntIY4GZ8BnXzMg4OR95effim3djaX8QivLWC5jDbgk0YcA+uD35NUv+Eb
0L/oC6d/4Cp/hWEqbb0/rSx6FLEU1Dlbe1tr/a5u6MKx8M6otjqcc2mTxpd29uWgjmgjzIrkyBcZ
UjGMeZksOGbk4mg8N642kaZapGllJBqLS+bHGimOMxMC5jDsgYsTwhxyDjqK1/8AhG9C/wCgLp3/
AICp/hR/wjehf9AXTv8AwFT/AArFYa3/AA/nfsejLOOZt93f4fLl6z7f8EydV8OX93oemW40g+da
iRHjjaKWNmyMuUkYbg4BO4OrqW781u6zpFxqfg+GyntIJrxVgLR53KGUruwXPpu5Jzj1qD/hG9C/
6Aunf+Aqf4Vqf8It4e/6AOl/+Acf+FP2LV/P9PkZPMIy5Hd+6+ZadW7/AM+xz154evW1O48jT1+0
PdwyWmpqyAWsC7cxgZ3DhXG1QQd/PemRaLq6fZLM6e/l22o3NwbjzY9jpIsu3A3bv4wDkD8a6T/h
FvD3/QB0v/wDj/wo/wCEW8Pf9AHS/wDwDj/wqXQ/q/p5eRazKPLyt3/7d8rfz9um3kclH4R1K30q
zjsbZLS8bR5Le6kSRVLTfu9oZgcnowB5xUk+lSWeneKbpNG/suzl0cxxw7oz8yrLu4RiB1H169c1
1P8Awi3h7/oA6X/4Bx/4Uf8ACLeHv+gDpf8A4Bx/4Uexd7r+t/LzK/tRP4m3r280/wCbysr3sjWo
oorpPECiiigAooooAKKKKACiiigDndU08anaC1eVo4mdTKFyC6g52gggjOByKyp/DJ23CWd0qJMy
vm6WS4eOQAjejmQMGxtwc8ba0ddubiz0G+ubUgTxQM6E9iB16H+VYcmsapZ31zcyW0Uqw6fHNNCL
pgqjc+SnycsQB2Xp1rohzW0OWpy31L0nh157iUzXgEMsDQyCKLZJNlQu6RtxDkckfKMfTILm0Ga4
Sdr29SW4dI0jeOHYqeWxZSV3HJ3HnkZHAxVe58QNJq8dvBZXckMEqCRollyWZQf4UKkAMCQXHToc
DLZ/FU8XnsmnRskYnYFrkgsIWw/Gw46jHr3xVWmyU6ZpSaZc3X2Rr27ike3nMv7qAorDYV2gFiR9
7Ocms238Hw29pc2yNZor2728csVkqSAMMZds5c49Nuec+1tvEKjXIdPWFXilITzUZyUYoWAb5No4
HTdnkHFZ1pquozTWZvVURHUZoleG5IOF8zCsuwBlAHrngGhKYN0zqY4hHAsXUKoX07YrnB4VuGt1
t5NRjaGK0ltIQtsQyq+OWO87iNo6AZpzeKJki+0NYR/ZpLSW6gYXB3sqY4ZdmFJyOhOKs33iJbF5
1a2ZzHBDIgUkl2kYqFwAT1HUZPtSSminKDWvQS/8OR37TmWZSJIIYwrRBlDRsWBIJ+YEnkenermk
aWml27oqWqtI25ha2wgTpjhQSfzJ/Lik0jUpdSgkaazktnjfbhkcK3GcrvRSfT7o5rRqHKWzHGMH
7yMWTw9FNo9xp8kiuJbhrgM0QKhjJvAKk/MM4B9R6UyLw6ILVBC1nBdRz+ejQWYjiDbSuCgbJGCe
rZyeuOK3aKOdlezje5mjTZnvbW7uLpHlhhljbZFtDbypyBk4xt6c/WspvB0Oy1Be0laK3S3drmyW
UkLnDJk/IeT13DpxxXT0UKbQnTi9zLXRIdmpxyPmK/4ZVXaUXYEwD+GaZJpN5dWH2W7vonCyRMhi
tymAjBuQXOScYzx9K16KOdj5ImDfeGY72S4leSF3kuVuEWe3EkYIjCEMpI3DGT1GDj0rS0/T00/T
1tUES9SfIiES5J/hUdP1PqTVyihzb0YKEU7owtD8O/2LcyTefDIZIljfZBsLlSSHY7iWY5OSevHT
uXmgT3N1O0V9HFb3E8U8kbQFm3Jt6NuAAO0djW7RRzyvcXs42sYyaCFW3U3GRFeSXR+TG7fv+Xrx
jf19qj0bw3Do84dFsyI0McbRWaxyEf7b5JY4HbbnnIPbdoo55B7ON7hRRRUmgUUUUAFa1ZNa1TIq
IUUUVJQUUUUAFFFFABRRRQAUUUUAFFFFABRRRQBjTQx3ELwzIHjkUqysOCD1FUU0PT0imi8qR1mh
8iQyTu5ZOeMsxP8AEa0GYIpZiAoGST2qtp2oW+q2EN7asWhlGVJ+uP6Vqr20MXa+pG2j2L3S3Jib
zBtyBK4Riv3Syg7WIwMEgngegpjaHprqytbZDLKrfO3IkOX79z+XbFaNFHNIXLEzzoenm7W68lhK
rq4IlcAMBgNtzjOBgnHI4NKui2CXQuFicOJfOA819qvggsFztGdxzgc5qzPceTJAnkyyea+zMa5C
cE5b0HGM+pFTU7yDliY48OWaaityhcQ+TLE9u7u6EORnaC2FHB4A7+1SReHtMhSZBDI4mRY3Ms8k
h2qcqAWYkYJyMYxWpRRzSDkj2K9pZQWMTRwB8MdzNJI0jMfUsxJPAA5PQVYooqXcpWWiCiiigLhR
VaS9jj1CCyKv5k0byKQBgBcZz/30Ks0WYXQUUVWvr2PT7YTyq7KZEjwgBOWYKP1NFguizRRRRYLh
RUVvObiLeYZYiGKlJBg8HHbjB6gipaLBcKKKKAuFFFFAwooooAK1qya1qmRUQoooqSgooooAKKKK
ACiiigAooooAKKKKACiiigDmNbgu7vTJLSzwJJyI2kY8RofvHGQTxkYB71z95od8sVxFNZrfgTi5
gEMUYh3lSrK8ckn3cgHg5y3GK6bVL4aZpd1fGMyCCMvsGfmwOnAOPr2rKHim3jvmW4WWK1+zJMGN
tLuUlmB38fKo2jkgfWuiDlbQ5aii3qyo2lX51C8e2sVgmubZlkun8v5H2AAROp3hcjow7ZGOhSPR
7o2t6LPTjp0MkcK/ZQ6DzWViXPyEqNy4XJIJ74FbN1rEEV7DbJKBlwJXMTsigj5RvA2qxJXGT39x
TJfEmlQtIr3En7vduK28jAbThuQvOD19O9Pml2J5YdykdK8x9NktNIWwEF2zlCIwUUxkFsKSBk7e
AecZNZVr4bvorG+Qw3P2t7OWJ3d4AlxIw4IKKGbnJzIQRnvk11ralbJfJZsZFmk+4TC4RuM4D42k
4B4znisq28Sre3FvFHG0DPdyQMJoJcMF3fdbaF3HaDgnjkdaE5dgcYaamtZWUNnYrBDEkWRl9oGW
Yjkn1PvXJnSdVl0+GzOnSIbbTZ7Xe0se2R2ChduGzg7T1xXRHxFpgeRTPIPLjeUuYJAjIn3irbcM
BnsTViXVbKFpFkmwY41lYbSflYkLjjkkjAA5pJyTvYpqLW5z114fuUS+isIBbwz28G5Ydi+a6uTI
MHI3FeMkYOeeK1PDunNp1pMpinhR5NyxTGIFRgD7sQCLk54GfXqcVo2d9BfRs8DP8jbWWSNo2U9e
VYAjg55FWKTm9mONON+ZHKt4fuDot+qQ7L2e5kYspQu8Jl3bATkAMvY8ZPPemw6HPDpYjW0uHt/t
QlksJTADIm3G3am2MfNhsZwcZJycV1lFHtGDpK9zm5NEivbrT/N0iKOyignU28oRhGzMpUYBI7Hp
kCsubw7qM8Fgt1FdTGOzSFVjeAmCQZyxaQMRnK/MmT8vQ4FdxRQqjB0kzno9EmM+sT7Ql1L8tpcu
QzJ+6VSwI5U5Bz0ziq8mkefo0lrb6H9jZpYDKrNGPO2uCzHaxB4zyeTXU0Uc7H7NHIXnh65EV3Bb
WzJYG9WVbW3EWJI/KAIVXyn3+cMBnGeuK3dFspLDSEgxIrAsVSZkJQEkgfIAo+i8DoCa0qKHNtWB
U0ndHL+GNNv7C+uZLm1MCTxKXCrCqeaCd21Y+x3DBOScc9qTULDUDdX0MNjJLHdXdvcLMsiBVVNm
4EFg2fkPQGupoo9prcXs1a1zlrbQZ4Lm2uktUjuhfzvJMNu7yW8zGTnkcqcfpSeG9DudPvhNcJcr
MsZWaV2gCTsSPmGxd7dCcuQRnvk11VFDqMPZK9woooqDUKKKKACtasmtapkVEKKKKkoKKKKACiii
gAooooAKKKKACiiigAooooAwb60W/wBPuLR2KrPG0ZZeoBGKym0CeaK8FzextLc2YtC0cBUKBuw2
Cx/vdM9q3SQASTgDqar2l9aX8Rls7qC5jB2loZA4B9MjvWyk0tDCUYt6mO3haA6obvFmwdkdzLZr
JKGUAfI5Pyg7Rxg98Edkl8L+ZHKn2zHmJdJnyunnMD69sfj7V0NMEsZmaESIZVUMU3DcAehx6cH8
qfPIXs4owj4Z/wCJ1HqP2mItHIsil7fdIAE2FA+7hcZOAOCc89Kkj0CVLmMm7Q28V290kfknflg+
4Ft2Dy/HA6d+tblFHtJAqUTlj4cuvtMFpJMkmnJZT2yMke14w20AMSx3HA6gDp71NJ4YmvEuPt97
BO0kUUahbXag8tiwLKWbdknkcceldHRR7SQvZRM/SNLTS7d0VLVWkbcwtbYQJ0xwoJP5k/lxWhRR
UN3LUVFWQUUUxJo5HkRJEZoztdVYEqcZwfTgg0DH0UUUDCimGWNZViMiCRgWVCwyQOpA9sj86fQI
KKKKBhRRRQAUUUUAFFFFABRRRQAVrVk1rVMiohRRRUlBRRRQAUUUUAFFFFABRRRQAUUUUAFFFFAH
K+IYnm0SdFRpFyhlRQSWjDAuAB1yueO9Ub7W7KSCJ9O1G3jhaVI7m8hKMIU2sRkkFRyAOem73FdF
RWylZGEotvQ419bm/wBAF1rf2K3kW5IutsS+eEcBG+dSOVOflAz1HFMbVNUjS5usIt09hayPvjCe
Tudg5ztLAAZbDbsc8dq697WF7uK6ZMzRKyI2TwGxnjp2FTVftF2M/Zy7nI2+o6pNDZxjUoZFnvfJ
FxAyy5Ty2Y/N5aqSCOCFwMYOcGtrWrmfTtG8+KY7oni8yVgv3N6hyeMDjOeOPatSipck3sXGDS3O
TOtXN/ftFZaiPs0moLAk0Co/yeRuO0kEH5u/NV7jWtUS1tozewwIJriOS8nlSHcUfaqkmN1BIycb
RnHGOldpRT512J9nJ9THuby8h8IzXjui3iWjSb0U43Bc5AYA/gRWZq19qdjFYp/aMcSTq0kl1PJH
CqthcRhjEwA5YgEZOOvFdXRSUkuhTg2rXOYfU7oPaJqGpx6cGtVkEiKoE8hJyoEi54GPlADfNVea
W7tNS1W8t7t0C39vG0OxSjhljU5yN3Q9iK6+imppdBOm31OStNV1SbX3ikurZAs0iNZmUF1jGdrb
BHuGQFO4vtOfcCnwahqC+HdPvbnUWQXZTz7gpGq2yFT8wyuBk7RlsjJ6Cuqoo512BU33OVnD3mq6
UbbVpX/0a4K3cSxkuAyeqlT9QO3FUZte1eWCwcXdramSzSVWkkCCeQ5yoXy3LYwvyqQfm9xjuKKF
NdhOm+jGoWMal8bsDOOmadRRWZqtAooooGFFFFABRRRQAUUUUAFa1ZNa1TIqIUUUVJQUUUUAFFFF
ABRRRQAUUUUAFFFFABRRRQBy2vahJpekvdRPCjCSNd8wJRQzhSTyOgOeoqKHWIrewF1eX8F3C7Hb
PY2zmNQOu4qzgY9SQKuanY/2jaCDzPLxLHJu25+64bH44xVHX/D41wxB5o1RUdCksPmAbsfMoJAD
jHB5xk8VvHltZnNNSvdDl162jnuluZ0CJciCJUhk3ltgbBGOSecbeCMY5qy2s2KTpC0kgZtuSYH2
oW6B2xhCcjhiDyPWqUXh4rdx3D3QZluUuCBFgErF5eOpx6/p702bwzBLrL322zYSyLK/m2ayShlA
HyOT8oO0cYPfBGeG1AV6ltjYnuobeSBJX2tO/lxjBO5sE49uAapya/p0WAZZHJMihY4JHYlDtbhV
J4Jp+p6fJfLbvBOsM9vMJY3ePeucEEFQRnhj3FU7DQHtLiGeS8Erp9oLYi2hjK4Y45OMY96SUepU
nK+hal13Too4ZDOzJLGJVaOJ3AQ9GYqDtX3OBwfQ1Zu762sbX7TcyhIcqN+CRyQB09yKwG8HQlLU
F7SVordLd2ubJZSQucMmT8h5PXcOnHFbOo6ct/YLahxGqyRvnbkYRg2McemKGo30FFz1uMl1ywhV
Gkedd678G2kyi5xucbcoODy2BwalfVbOO7W1MjtK2M+XEzquem5gCFz7kVn6r4bh1LUPthFoWaMR
P9ptFnIAJIKZPynk9QR044qymmT22oSTWlzFFBMyvNE0O5iVAX5W3AKMADoaLQC87kGmeIIbqZra
5JjuDcywx4hcI21mwA5G0tgZxn8KsLr+mlZX89wkUbSl2hcKyL1ZCRhwP9nPUetQJoIVbdTcZEV5
JdH5Mbt+/wCXrxjf19qpW/g+G3tLm2RrNA9u9vHLFZKkgDDGXbOXOPTbnnPs7QYr1Eaza3YrAk2+
ZldiqBbeRmfAySqhcsv+0AR71Tm8R29rqkkVwStoLWOdZVgdiNxbJYgHaMAcnHerV1pkryWk9pcR
w3NshjVpIi6FTjI2hl5+Ud6hutEe7+2tJd/PdWS2rN5fQjd83X/a6e3Whcg3zlqXWLGG6Fu8rbyV
BZYmZFLdAzgbVJyMAkdR6ip7q7js4fNlWYrnH7qF5T+SgmsZvC0B1Q3eLNg7I7mWzWSUMoA+Ryfl
B2jjB74I7XtZ0n+14IY/MjAjk8wpNF5kcnBGGXIz1yOeoFJqOgJzs7ofHrWnzRGSO5DKGjThWyS+
CmBjnO4cj39DTDrunrHM7ySxiFlVxJbyIw3HauAVyQTxkcVWsvDkdmbIm4LG1h8r5UC78ZCMfdQz
f99Z44FUbXwd9nVx9rhy4i3slttLmOQOGY7iWY8gk9eDxjBq0L7k81TsbK63p72r3AlkCpJ5TI0L
iTfgHbsI3E4IOMdKZd6zBFYrNEZDLKGEMZt5GbI4JKKu8AHrx/OoZtCZ7me6iuVSdrlbmItHuVCI
wmCNw3AjPcdfamaj4fbUxazXMllPdQB1JuLPzImDEE4QtkEYGDu9euaVoDbnYtya3YQRxNJcFxJG
JN8UTuoX+820HavXlsDg+hrQBBAIIIPIIrnbrwlbTSwui2R2wLA3n2KSYVScFBwEPJ7EdOOK6JVC
IFUAADAAFTJR6FQcr6i0UUVJoFFFFABWtWTWtUyKiFFFFSUFFFFABRRRQAUUUUAFFFFABRRRQAUU
UUAYlxcwWkDT3M8cMK/ekkcKo+pNMtL+zv42ks7uC5RTtLQyBwD6ZFZvikOdExGyq5uINpZcgHzV
xkZGfzrP8R6pqWl2sEa3cYvCkkgdFWKOTbjCBWEjMxyMKCCeeRW8Y3RzSnyvyOnSaOR5ESRGaM7X
VWBKnGcH04INPrj47+7e/eO2uwi3OoIhlSKMnY1vv4O3nHGCc9BnIp9zqWqx+IDZre28YjkjSOGa
UB7hCBufYIiW6tyrKBjkAA03TYvaq1zraKytav205rCZp1gtjchLiR8BQhVsZJ6fNt5rGtNTvtUu
II4tSeOKU3bCWFIySqSAJjcpGMH8f1qVBsqVRLQ66iuHm17V5YLB1u7a1MlnHKrSyBBcSnOQB5bl
sYHyrg/N7jHR65dXdro6y28ix3BlhTdt3AbnUHg9uTTcGnYSqJ3NWiuS1q/1Wwvo7SLUYolWEPHL
cyIjXDljlcCJt2MKNq7W575q9/aEp1tre71JbJkaMQ2oCf6SCASfmG48kj5cYxzR7Nh7RbG5HNHM
paKRHUMVJVgcEHBH1Bp9cfp015ZzQyRXTtDcancwtbMqbMZkbION2cqO+Paq9rrmsPY31w97bGRL
OSV4UkDvbyAcAr5S7MHIw7MTjjODT9n2F7VbNHcUwSxmZoRIhlVQxTcNwB6HHpwfyrAvLq5tEsku
9Wa2gnDPLeMIl2NgbY13LtAOWPIJ461Q1GW5jvtQvrTUJEeDSopg6xoRMQZCNwYHg+2OvWkoDdTs
jsaK5GfV9VbXvJS6tYFDxCO3klAMyMFLME8tmbqwyGAG3noc6niW+u7Gyga1kjgEkwSW4kcIsS4J
yWKsBkgDJUjn3zQ4NAqqab7G1RXIPq+pxWNq6XcdxM4cyiFRIBADjzwdq5I9htbsKRtbl/tWZIdZ
811uYI7e0Aibz42VCzcLu6MzbgcDHpTVJi9sjsKK5K01XVJtfeKS6tkCzSI1mZQXWMZ2tsEe4ZAU
7i+059wKiuTeXngm3vbvUJS8rW8zsqRhYwHXJ+70x8xJyOOw4o9n3H7VPZHZUVFauklrE8dwLhCg
ImBB3++V459uKlrN6Gid1cKKKKBhRRRQAVrVk1rVMiohRRRUlBRRRQAUUUUAFFFFABRRRQAUUUUA
FFFFAGTRRRWhkFFFFABRRRQAUUUUAFFFFAWCiiigAooooAKKKKACoYbWGCaeWJNrzsHkOSdxAA/D
gCiii7CyJqKKKACiiigYUUUUAFFFFABWtRRUyKiFFFFSUFFFFABRRRQAUUUUAFFFFABRRRQAUUUU
Af/ZoEYd8CZrAQC+SW3B2RPXp5tbBslNZGh3///Y/+AAEEpGSUYAAQEBAGAAYAAA/9sAQwAIBgYH
BgUIBwcHCQkICgwUDQwLCwwZEhMPFB0aHx4dGhwcICQuJyAiLCMcHCg3KSwwMTQ0NB8nOT04Mjwu
MzQy/9sAQwEJCQkMCwwYDQ0YMiEcITIyMjIyMjIyMjIyMjIyMjIyMjIyMjIyMjIyMjIyMjIyMjIy
MjIyMjIyMjIyMjIyMjIy/8AAEQgCYwLdAwEiAAIRAQMRAf/EAB8AAAEFAQEBAQEBAAAAAAAAAAAB
AgMEBQYHCAkKC//EALUQAAIBAwMCBAMFBQQEAAABfQECAwAEEQUSITFBBhNRYQcicRQygZGhCCNC
scEVUtHwJDNicoIJChYXGBkaJSYnKCkqNDU2Nzg5OkNERUZHSElKU1RVVldYWVpjZGVmZ2hpanN0
dXZ3eHl6g4SFhoeIiYqSk5SVlpeYmZqio6Slpqeoqaqys7S1tre4ubrCw8TFxsfIycrS09TV1tfY
2drh4uPk5ebn6Onq8fLz9PX29/j5+v/EAB8BAAMBAQEBAQEBAQEAAAAAAAABAgMEBQYHCAkKC//E
ALURAAIBAgQEAwQHBQQEAAECdwABAgMRBAUhMQYSQVEHYXETIjKBCBRCkaGxwQkjM1LwFWJy0QoW
JDThJfEXGBkaJicoKSo1Njc4OTpDREVGR0hJSlNUVVZXWFlaY2RlZmdoaWpzdHV2d3h5eoKDhIWG
h4iJipKTlJWWl5iZmqKjpKWmp6ipqrKztLW2t7i5usLDxMXGx8jJytLT1NXW19jZ2uLj5OXm5+jp
6vLz9PX29/j5+v/aAAwDAQACEQMRAD8A6TNLmmZpwNfSHgDs0UmaM0gHZpabmigB1FbxmOh6VaPb
KgvLpTI0pAYqvYDPrTorg69p92l2qNd28fmxzBQCVHUHH+eaw9q/itoaqktr6nP0qo0jqiKzOxwF
UZJNay6NAtlb3d1qCQRTKSMxlmznoAOo96fHpx07XtPAlWaGV0eORRjcM+lV7aOqX9WF7KVrsxzF
Ks3kmNxLnbsKndn0xSOrxuyOpVlOCrDBBrbeBZ/Fc6m6+zSedmJ/L35fPAxUY0qXUdU1BJLtfNhL
M0jrgNg4yfQUlWW77XKdJ3aXexjZpwbFak2jwNYzXVjfrdeTjzF8soQPXnrUdvpUZtEub69W0ikO
IgULs/vgdveq9rC1/wCvuJ9lK5SElMeTFW9R057AxOsqzW8y7opVGAw9x2NTeGTnxFbf8C/9BNDm
uRzQcr5lFmQWBNKKsyaXqRu3I0+7I3k58lvX6Vq69az33is2sCguyLyeAoxyT7UOrG6Xlcr2b18j
FFPaGXyfO8p/Kzt37Ttz6ZrSTR7a58yKw1SK5ukUkxeWVDY67WPBqQN/xRTE/wDP3j9Kh1V07opU
318/wME4pu0ZraXRbVbC2u7vU1t0nUkL5JY5B9j096q6jpj6dJGRKk0Eq7opU6MP6GrjVi3ZMh05
JXKiRipvK4pIxU9NtisVinNMYEVYOKhfrVJiaKzk1EetWWQGm+TmrTFYr0lTmCo2jINO4WGGkpxF
NNMLCGkpaSgLBQaKQ0wEpD1paQ0xCHrSGlooASm9qd3oNAhtNp1JQAlFHeigA70d6KKYwo3EdDQa
Q0APEjU7zDUYoIpWC5OkhNSBxVZDUuaTQXLSkYqZapLJg1Ok2KzcS0y0KQ0xZQaduBqbFXA0xqcT
TWoBkbVG3SnmmGqRIi0tA6Uo60AKBTwKQCngUmNC02nmm96SGJ9aaQPSnUh6UARFNzAAcmusgiEN
vHGOiqBXPafF5t/EOwO4/hXS1hWeyLprqFFFFYGgUUUUAFFFFABRRRQAUUUUAFFFFABRRRQBR1fV
rbRdPa8ut5jVguEAJJPpmseHx9oEv3riWI/7cR/pmsT4m32EstPU8kmZx+g/9mrhFsnEKzTssETf
dL9X+g6n69PeuylQjKF5HNUrSjKyPZ4PEuiXOBHqdtk9mcKf1xWjFcQT/wCpmjk/3GB/lXiA0yQW
4uDa3Hk/89JcRK30z1qss0CHiBwR3WXB/lTeFi9mL6w1uj3ytvw//wAvH/Af61w3g6Nk8MWrsZCZ
d0n7x9xAJ45+mK7Tw7IGubyPP3VjP57v8K8/ERtGS7f5nbQd5Jnn+aUU2lzXpnAPpRTM0ooAkopo
NKDSA6C5gk1bRLKa1Uyy2y+TLGgywHY4/wA/pTrC3k0jTL27u1MLzRmGGN+GYnqcdawoZ5rd98Er
xvjG5GKnH4UTTzXD755ZJXxjc7Fjj8aw9lK3LfQ2VRXUrao2dV/5F7SPo/8AMVclZUbw2zEAADJP
1WuaaeV40jeV2RPuKWJC/QdqJJ5ZURJJXdUGEDMSFHt6UvYuyV+r/G4e0X4Jfdb/ACN2eGWHxkhk
RlD3IZSR94Z6irNr/wAhTX/+uUv8zXNm6uGeN2nlLxgBGLnK/T0oF1OrSMJ5Q0gIchzls9c+tJ0W
1a/Sw1VSle3W5raF/wAg3WP+vf8AxrRlnml0mwms9Otb1FiET74fMZGHbGc4rlo55YldY5XRXGHC
sQGHofWlguri2JME8sRbr5blc/lTnR5pOX9bWFCryqxoaveXksMFtdWUVqqAuiRxlOD7Z4pvhn/k
Y7b/AIF/6Caz5ppZ3Mk0jyOerOxJ/M1Cs0tvKJIZHjcdGRiCPxFaKn+7cF1Jc/fUuxZl1bUhdOBq
F2BvIx5zev1rqWnji8a3Eb+XvntRGnmfdLEDAP1xXCEkkkkk5zmnzTy3EhkmleVzxudix/M0ToKW
2mjX5FRrNNvzR1C3usWc0kieHbKF4QxMq2pUADrhs/yqGIS3ngu4MSGSRbsyOqDkDHXHpWHJqV9L
EYpL25eMjBRpWII+mahiuJoN/kzSR7xtbYxG4ehxSVB26X0/AftlfrbU6PULS6uvDujNbW8swVHD
eWhbGT7fSm61my0XTNPnI+1IGd1zkoCeAf8APaq13q+3SNMhsruWOaFHWURlkIyRgZ71iSSSSyNJ
I7O7HLMxySfrSp0pO3Nsm3+Y5TilpvZL8EXYpBVjfms6MkVZDmtXEyTJiagY80FzUZfmhIQ6nLUa
kVICKGUhTUbAU8mo2PNCGyNwKYEzTmPNKtUSN8ontQYSasKKkAFLmKsZ5iI7GmlSK0GUYqBlHpTU
iXEqGmmpmWmFK0TJsR0U/YcUhQ0XFYZRS7TRimA2kNOIpCKBDKKXHFJ2pjCikooAU0lFAoAcBzSs
KF605+lIBiVKKhB5qUdKAFFOpopc5oAcGI708SkVFRSsFywJvWneaDVXmkyc1PKVctFhTM5qHcaN
xo5RXJx0pRUIfinq4NJodycU8Co1NSg1LKQNTDTm60hpDEpDSikagDT0SHmWY/7o/mf6VsVU02Ly
rGPjlhuP41brkm7yZtFWQUUUVAwooooAKKKKACiiigAooooAKKKKACiikOSDg4PrQB5fqbRaz4z1
K5lTzrbT4mYRf89CmAF+hc/lW6mk2/h3R7jXNUjS71MKG+cZVGPCqo6DGR/Sk07wZe6PrP22G7iu
4ZMrNHKCjMpOe2RkEA9uldNrOmJq+kXFi7bfMX5W9GByD+YrqnUV1FPQwjB6trU8U1HUrvVbtrm8
maSQ9M9FHoB2FVVUuwVRlicAVuX3he9tbnyAoE2eInO0t7oTw4+nPqBT9D0C/PiKxjurC4jjEys7
PGQMDnrj2rt54qOhy8sm9T12wthZ6fbWyjiKJU/IYrS8Iy+bqesHOQpiUfhuqozBEZj0AzSfD5zJ
Jqjt1Yxk/wDj9eRVV6U5en5np0tKkV/WxzEcbzOI40Z3PRVGSfwqf+zr7/nzuP8Av03+FdP4atIY
9NS6C5mlzuY9gCRge3FaV9eQ6dYz3lwSIoULtgc4Hp7062O9nJpLRCpYTnS11Zw39nX3/Pncf9+m
/wAKcNPvv+fO4/79N/hXXWl/cm3e41K1hsYRGJA5uQwAPUNkDaRxnqOetPbWdLW0W7bUrMWzNsWY
zrsLegOcZrL+0X1Rp9R1OP8A7Pvf+fO4/wC/Tf4Uv9n3v/Pncf8Afpv8K6mbxDpcF3ZW7XkJN6CY
XEi7SB05z3PAx1NWhqVibxrMXtsbpRloPNXeBjPK5z0o/tHyQfUWu5x39n3v/Ppcf9+z/hR9gvf+
fSf/AL9n/CupbxBpP2S5uYtRtZ47aMySeTMrkD8D36CnQa7pc9vazLqFqouv9SGmUFjx8o55IJwQ
O9L+0bu2g3gHvqcr9gvf+fSf/v2f8KhlhlhYLLG8bEZw6kHFegVVv7CLULfy5OGHKOOqn/PatI43
X3loZSwmmjOLht5p8+TDJJjrsUnH5U/7Be/8+k//AH7P+FeiaXZW9jZrHbjj+InqT71dqZY930Wh
UcEras8u+wXv/PpP/wB+z/hR9gvf+fSf/v2f8K9Roqfr8uw/qUe55d/Z97j/AI9J/wDv2f8ACopN
Ovj0s7j/AL9N/hXpGragdNs1mWISyPKkKKz7F3OwUbmwcDJ64P0ND6lFYWUc+sz2VgzHad1yNmec
AMwXJwM9KP7Sa6FrL7rRnmP9m3//AD5XP/fpv8KP7Mv/APnyuf8Av03+FepSalYRXUNrJe2yXEwz
FE0qh5B6qM5P4Ui6pp7tKq31szRKXkAmUlFBIJPPABBGfUGn/ab7IX1DzZ5d/Zl//wA+Vz/36b/C
k/sy/wD+fG5/79N/hXol54m062jsZ0urWWzupzC1ytwvlx4RmyW6fw46jrWrBPDdQJPbyxzQuMpJ
GwZWHqCOtCzNvZIHl/Lq2eTf2bf/APPjc/8Afpv8KBpt/wD8+Nz/AN+m/wAK9dop/wBoy/lJ+pR7
nkyadfA/8eVz/wB+m/wpZIZYG2zRvGxGcOpBxXrFZusaPDqtsVYbZV5Rx1Bpxx95e8tBSwdl7r1P
NWPFQMeauXtpNY3DQTrtdfyI9RVBzzXpRaaujiaa0YbyDTxMRUOeaM1VkCZY8+k8zNQZpMmlyjuT
E5qRO1VgakR8UNAXFFPqBJBUocGs2i0DVA9SswxUTmmhMhPWlUc0GnIKskeqCniMegpVFSCobKSI
WhX0qB4BVw1E1NNg0UmjxURU1baojitEyGivg0hFWAgNKYcincVirSVZNuaaYGo5kHKyCkqRo2FM
KkU7iHLUjfdqNal7UMCDoalU8VG/BpyHigB9KKTtRSAdmkozSimMKaadTaAAUtJS0CEpVOKSigES
LKQamWb1qsRSZIqXFFXLokFLuBqjuPrTlkIPWp5R3L3aiOMzTpGP4jiqon4rT0VPOuzIekYz+NRP
3YtlLV2N8AKoA6DgUtFFcJuFFFFABRRRQAVBBfWl1I8dvdQSun3ljkDFfqB0rz/x7qdxqvijRvBl
pO8Ud44kvmjOGMQ5257DAYn8K2dU8GWy6louoaSbfTBpchaTyogDJFxlCR2wD1z1qOZtu3QvlVtT
qWuYEYq08YI6guOKDcwKATNGARkEsOa8h+Hcmkanca1qurae93NqF+TEXsXmVVzn7wUgct7dBWhH
ZWutfGtrX7LC9ho9gEWHywYwSBgbenWT9KSqXSfcbhZtHqKOsi7kYMp7g5FMFzAzbRNGW6YDjNeT
pfJ4Y+JviSHTAINOh0xrmW3j4jEgRSCB0ByQOPWuUsYLG7+HlppNpbx3HiPU77zImZNrxgHr5hAH
Remf4jSdXyGqR9DSSJFG0kjqiKMszHAA9zUdteW15GZLW4hnQHBaJwwB+orzHSVn8WePH0jUZjda
V4fgSN4nyVuLgAKWcfxfMGPPoPU07UbiHQ/jPbCwRbe3bTWe+jiUKrKqu2SB3G1eaftOouToenrL
G7MqOrFeoBzigyxrIIy6hz0Unk15D4FmTw/401Zr6QotxpUeozsw6EhXb9XNLpNtcax8a4rq9VhP
bWn2mWJufJ3L8kf1UOuffNCqaLQHT31PXZZoreMyTSJHGOrOwAH4mkW4geETLNG0R6OGBU/jXAeL
799H8b2Opa1YTXXh2O1KI6R+YkE5bl2X128Z9+O9RXXh/S9WsVsNOvvO07xBePdgRDbHEqRtnaB0
+fZn3p8+tkLk0uz0K4gt7mApcxxywnqsgBU/nVGy0PTrC9M1n5kTKMGFZmKDP+znFcbouqTat4Gs
NJu9xvo9Qj0y6U9f3bbmz/2zQ/rWh4Exf6v4p1vqLnUTBG3qkQ2j+dVGq9l1E6a3fQ6vU5PL0+Y5
IJG0fjVr4ert/tH/ALZf+z1l65Ji3jjz95s/lWt4A/5iP/bP/wBmq6qth5f11FS/jIt+H/8AkB23
/Av/AEI1PqunrqulXVi7mMTxlN4Gdp7GnafafYLGO28zzNmfmxjOST0/GrVefWtOUuzuddJuCi+q
OfutP1nUrBIbtbBJIHimTZI7LM6Nk7sqNoOO27HvUMfh+9fU49QnNsjtfi6khjdmVVERjABKjcTw
egrpqKx9mm7s3VaSVlocxb6DqNncWdxEbWRoLm5cxtIygpKxIwdp5HHGMe9R2Phaa3ux9o2TxxTy
TxTNdzFizZI/dfcU/MckZz6c8dXRU+xhp5f8D/If1ievn/wf82crD4YulsrC3aWBTBps1nIyknLO
FwRxyOD1xT20fVnj0141tba9tkWJrmK6cjyxjI2GPDgjPBxg4wa6ein7KN7h7eb3CiiitTEs2ZPm
sO22rtZkUrRMWUAnGOal+2Sf3V/KpaKTL1FUftkn91fyo+2Sf3V/KlZj5kS36SyWUscNtb3LONph
uJCiOp4IJCt27YrmZPDGoEWk5eOSSHzlFsl9PbpEjsCFSRBuIXaBgqAR2GAK6H7ZJ/dX8qPtkn91
fyqJUlJ3ZpCs4qyOeu/DGot9ihtpovstolv5Uf2mWNEeNwzfJ824MAAC5JXHfrVxfDsy+H7myDwi
eS9e7GCdj/vvMVWOM8gBTwce+K1ftkn91fyo+2Sf3V/Kj2S1/r+thvESaSKUunX99c6bc3MVnA9t
dmeRIpGcFfKZBhioy2SOw4+lWdD0+XTLGSCUoWa5mlGwnGHkZh264IqT7ZJ/dX8qPtkn91fyqlCz
v/XT/Il1bq3T/h/8y9RVH7ZJ/dX8qPtkn91fyp2ZHMi9RVH7ZJ/dX8qPtkn91fyosw5kYfjhEGn2
8m0b/NxuxzjBrgWr0vVbVNYt0huCyqjbgY+DnGO+fWsc+EbA/wDLa5/76X/4mvSwuJhTp8sjhr0Z
TnzROKortf8AhENP/wCe1z/30v8A8TUg8EWjAEPc4PI+df8ACun67SMfq1Q4aiu6/wCEHtf79z/3
2v8AhR/wg9r/AH7n/vtP8KPr1HuP6rUOForuv+EGtf79z/32n+FH/CDWv9+5/wC+0/wo+vUe4fVq
hwwYjvTllI7123/CDWv9+5/77T/Cl/4Qa1/v3P8A32n+FL67RD6tUOK845oMma7X/hBrX+/c/wDf
af4Uf8INa/37n/vtf8KPrtHuH1aocSDzUqmux/4Qe1/v3P8A32v+FOHgq3H8dz/32v8AhSeNo9x/
VqnY5NRUg6V1Y8HwD+O4/wC+1/wp3/CIw/3rj/vtf8Kj63S7lLDzOQNQvXanwhAf4p/++1/wph8G
25/iuP8Avtf8KaxlLuJ4ebOGY1FXeHwTbH+O5/77X/Cm/wDCD2v9+5/77X/CrWNo9yfq1Q4hamUV
2Y8E2w/juf8Avtf8KcPBluP4rj/vtf8ACpeNpdxrDVDjgBSFR6V2f/CHQf3rj/vtf8KP+EOt/wC9
cf8Afa/4UvrlLuP6tPscQ6DFV2QV3x8GW5/iuP8Avtf8KYfBFsf47n/vtf8ACqWNpdxPDVOxwO3m
pAvFdx/wg1r/AH7n/vtP8KePBNsP47n/AL7X/Cn9epdxfVah57Ihz0pqg+lehnwRanq1z/32v+FN
HgW0H8Vz/wB9r/hTWPpC+q1Dg+3Skrv/APhCLX+9cf8Afa/4Un/CDWv965/77X/Cj69SD6rUOCpR
Xd/8ILaf37n/AL7X/Cj/AIQW1/v3X/faf4UfX6IfVahwhpDxXef8ILa/37r/AL+J/hR/wg1r/fuf
++0/wp/XqPcPqtQ4Oiu8/wCEFtf791/32n+FH/CC2v8Afuv++0/wo+vUe4fVahwQpa7z/hBbX+/d
f99p/hR/wgtr/fuv++0/wo+vUe4fVahwWaQ13v8Awglp/fuv+/if4Uf8IJaf37r/AL+J/hR9eo9w
+q1Dgc5orvv+EDtP791/38T/AAo/4QO0/v3X/fxP8KPr1HuH1Wp2OBNdNoEPl2BkPWRs/gOK2P8A
hA7T+/df9/E/wrTi0BYYljQSBVGB8wrKtjKco2RcMNNO7Mmitn+xPZ/++hR/Yns//fQrm9vA19jM
xqK2f7E9n/76FH9iez/99Cj28A9jMxqK2f7E9n/76FH9iez/APfQo9vAPYzPLNZ8Najb/EWx8V6f
ai+jWIwz24kVHX5SoZdxAPXpmm3+k+KNVuNX1R/Mts2T2thpguQQWYEeZIQdueTgZPbnivVf7E9n
/wC+hR/Yns//AH0Kj2lPuXyT7HmHgay1bw34fsdGuNDmBVmM1wtxEVBZiScbskAEe/FZnh7SfEuh
694i1WTQhc3WpT7oG+1xqiJliAxzkDkdAelexf2J7P8A99Cj+xPZ/wDvoUe0hprsHJPXTc8WvfAW
sx+GddmDQ3viLWXUTMjBI4494JVS2OMD+XpV/V/B+otpXg20sYlc6TcQvcnzAMBcbiM9eQeletf2
J7P/AN9Cj+xPZ/8AvoUuemHLUPKtJ0XV/C3i3X72DTG1Gy1R/tCPBNGro+SSrB2XjLHkZqqngzV7
pNb1rUBF/bWrILZYI5AVtYCQGG44y2wdR6cda9f/ALE9n/76FH9iez/99Cnz0+4ck+x5fqPguXUP
iRZ6w21dMgs1SSMN/rHViVQj+790/wDAad4R8O6lY+LvEmt6pCsZvpgttiQMfLBPXHTjbx7V6d/Y
ns//AH0KP7E9n/76FHtKd7i5KlrHn0TeIbRtZgudPbVEmnZ7J/NiWMRsABGwJBAHOTg5zUHhLwpc
eHjYQTNHJHaWbrvToZpZN74HoAqgV6R/Yns//fQo/sT2f/voU/awve4ezntY8ubwtqFp8Qb3WbNQ
1jNamdYy4wbsKUHB9VJ56c1r+CNFuNA8JWVhdqBdjc8+GDfOzEnnv1ruv7E9n/76FV7+yt9M065v
7x3jtbWJ5pn67UUEscAZOAD0oVSmncHCbVjjdbk3XioP4F/nXReAP+Yj/wBs/wD2asWebQLiZpXj
8RbmOTjRrv8A+M10vg7+zv8ATfsC6kP9Xv8AttnLB/ext8xFz3zjOOOma1rYinKi4LcilRmqikyz
qV9Fpel3eoTK7RWsLzuqAFiqqWIGcDOBVM6rqg/5lTVz/wBtrT/4/UXjI7fA/iBvTTbg/wDkNq57
Vdd0SbxhZ6xB4/sEtoLeWJrZL20IG5oTsXKE7G8oliW3A7dpAzXntnWlc67SNTTV9PF2lvNb4llh
eKbbvR45GjYHaWX7yHoTU73trFEZZLmFIxIIi7SADeTtC59cnGPXiuW0DWIbTwJeavEy3EYvNQlh
8o7hMTdy7ApHXcSAPrXHXTXOj6HeabqMd5pQuLizvxNdSwkiX7RGLh1IZ1ChijYbpuPGKad3b+v6
3Cx7DRXAHxFc/YDs14nSv7SFudeKw8ReVvLbtvlf6zEe/bjnGNwzTrTxZcWz6VNqmpwx6dPHeot3
MEjS5ZJFED5wBlkywC4DZJAxjA9Ff+trhyne1Xvb+z021a6v7uC1t1IDSzyBEGTgZJ4615/Z3013
qfgnWNS1d7U3OmOHkYRIk0rGI+X8y9X54XB+XjHNdF4hnt7DxFouo6nJHDpkCzgzynEcM7BQjMTw
vy+YoJxy2OpFNqwWNKXxLoNvJbxza3psb3KLJAr3aAyq33SoJ+YHsR1qS313SLy+lsbbVbGe7hz5
kEVwjSJg4OVByMHg5rj4dd02L4hyTwa3pNrY3NhAFE2Abn97N/qm3qOpznDZyMdc1Rtby0vdK/sq
zuIJdYh16aYQoQ0kCC5Yu7Acopj3DJxncB/FSv8A187Dcf0/K53+na3pOrtIumapZXpix5gtrhJN
memdpOOhp1lrOl6lPPBY6lZ3U0BxNHBOrtGc4+YA5HIPX0rzPSLfUn8NWKzSxtczeHni0g20RiLb
lBkjZixy+EQrjb/EcccdFcatot7faG+jT28h0syS3AhP/HrbiF1ZJMfcy2wbGwcr0+U4crR3/rf/
ACFbWyOx+2Woh877TD5W/wAvfvG3fu27c+u75cevFLc3MFnbSXN1PHBBGu55ZXCqo9STwBXkI0zX
JNBi0r9+qyQnxD5uRgS7d5gyOR++Kv34yK7zVriPUtH+139zYafpg8i7tL+W5BHmAq6+YjKq7d2O
jknttOCF/X9fO/3C0vp/X9afebtnqen6hHFJZX1tcpKrNG0MquHCnDEEHkAnB9DSxahZTyrFFeW8
kjb9qJKpJ2Ha+Bn+EkA+h61wL3V14k8R6Ld2sqRXdvbXptriMt5FwUkhUMPWNxkd8Z4JIDUeEJbs
eILEXET25nGqO9tNFGWiYXSnh8bud3OG2nAOO9Na2+Y2rK56CLy2LTKLiHdAQsw3jMZIBAb04IPP
rTluIHuJLdZo2njVXeIMCyq2cEjqAcHH0NcZ4q0a41HWxpsPnx2mswBbqaI48owHcDnrltwX/gIr
Kk1PXLXQTq7NFp9zqN+Ibm4uZViFtFGhQZcxyKoLocFlI/eY4JBEp9/66BbWx6Q1xCtwlu00YndS
6RlhuZRjJA6kDIz9RT2ZURndgqqMkk4AFeXz6nIdR8PXeseJoNOY2l6F1C3ki2zKJIto3SxBWyBn
KoA2Mrwa7HKa14DDa8wskurEG7ZsReUCuWJ35C49Gzjoc1XS/wDXULamrp+qafq0DT6bf2t7CrbG
ktplkUN1xlSRnkfnVuvPNR8XalJpA+wX+nmGO8S3l1qKQRWxQxltyuySoh3YQkhxk4yCflnsNQ17
UrrRbGTWUiW5truSS6slSQyLHJGI2VniCk4blggVgSQOQQb7f1pcLdzuJ7iG2jElxNHEhZUDSMFG
4nAGT3JIA9zUledanf63LaRx3Vzj+zL22trrdaxst3I06YY7kIGIyr/JjDP1+XFbGl6xLda5cxXO
siO/jnmjXRB5X+rXOxyNvmDcArbi235unSlfS/8AXT/MLHW0V5lo/iHxDfWt7JPr2kwyfYpJJVku
Vb7BNxgOPIXyQCWBEjOeOM7Wz2XhTU11XQknW6nu9sjxm4lMTeYVbBKNEqoyehAHTkA5FMT0NutO
L/Up/uisytOL/Up/uipkOJDZajY6ksrWN7b3SxSGKQwSq4Rx1U4PBGenWrNeZ/Bj/kF+KP8AsYLr
+SVqeKfFutxeK7Pwn4Vs7GbVprc3c0+oOwggiBwMhPmJJ446ccHPE9vNL8rl9/L/ADsdxRXlD/Fn
UdF0TxJH4g0iD+3dCeJHS0kIt5xK2EdS2SowRnPP0JwEtfGHj2DxxoGha0fDqJqkEk8Z09JJM4Qk
K5Z8qMgfMAR9eaFrt/Wlwem56hbX9neSTx2t3BO9vJ5UyxSBjG/91gOh9jVivF/DfiW/0Twx8QtW
Ol6Pb6xp983nm1WYwzyjgsQ75xnPA29elXpPiH4z0vT9G8S6xpeiDw5qcsK+VbSyG6hWQZVmJ+U+
uAPbjrQtWl6fjsD0u/X8D1qiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigA
ooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACi
iigAooooAKKKKACuf8d/8k88S/8AYKuv/RTV0Fc/47/5J54l/wCwVdf+imoA8s+InxIt/CmqNY2q
C7vzKGli34WKPOTuI6MR0HbOTxgN33w516x8R6dcajYTGSJxGCG+9G3zZVh2Iz/IjIINcRc6r4+m
upZP+EIiTcxO3+2Lc49q7P4dXGvXDan/AG5oqaaVEXlbbyOfzPv5+593HHXrn2q3sQtzU1vUv7H0
HUdU8rzvsdrLceXu279ilsZwcZxjODWZHqPiqX7uhaR/4Npf/karPi+CW58Fa9b28TyzS6dcJHHG
pZnYxsAAByST2rOivfD0t+t+6+KFuA6vtW31SOLK4x+6ChCOORjB5znJpMEkaGn+IFl0FtT1KFbM
x3MttKkbtMqsk7Q5B2gkErnJUYB56VcutY0+zjvZJ7lVFkge4CqWKAjI4AJOcdBWXpVgmpeFL+0n
hmiivbm+O2WNon2SXErKdrAFchgRkZ5rmrLw3rE1xpt7eQbLjU5kfWMMTtEJDRD3B2bT/vU1vZie
1z0YsFUseABk1BY3tvqVhBe2knmW86CSN9pG5SMg4PI/GuF0+319/Fcz3d9fBxcT+ZALK48kwfN5
YEjS+RjGz7ib89f4jS+AYbm1TSreCHWIY49PK6gl+twsazDZsEYm4H/LT/V/Ljr/AA046/16jasd
hc65Y2upR6c7TyXThTsgtpJdgY4UuUUhASDyxA4Poa0a5fW5msdaSfSor99UmESSQpaSPbzx7sfP
Jt2IVUuQQ6npkNwKxdOg8QN4slkur++WQXM5kgFnceSYPm8vEjS+RjHl/cTzM9f4jSuFj0Kq1tf2
13cXUEEm+S0kEUy7SNrFQwHPXhgePWuK0/T9dsfDekarDNqlxq0lukN3b3U8jgl1ChjG52qUbaSQ
AdofOSaYtnqumx31rJPrU2mR6nGJpfMnluHt/s65MbDMmDLjOzp82MAGm9G1/W6Cx6DRXAeII7+S
10hbG61a30nZLvd7a8mn35Hl7xFIk4GN+CxPbcM4qa2XUrXxBoxupdV1C4e3iimQxzwRQnaxaVij
GBj0BRiTnBDHgEX9f1/XcT2udZqOq2elRI908mZG2xxwwvLI5xn5UQFjgcnA4HNPsNRtdUtRc2cv
mR5KnKlWVhwVZSAVYHqCARWVrBew8QWGryW9xPaR281vJ9nhaZ4mdkYNsQFiDsIOAccZ4yRyuqM8
U8F9cLqtnY6rrW8wWwnjuHjW1KglYf3gy0Ybb1AxkDkBL+vvt/wR2/r5HpNFeaXqeIJdL0oS3Op2
1hvufm+zXU1xt8z/AEcSCCRJQfLzySefv/NitrSbLV5NcVtSuNSlS30y2dQWaBJbjMm7cEYruxty
uWHIznAphb+vnY62eeK2gknnlSKGNSzySMFVQOpJPQVFHqFrLqEljHKGuYokmdADwjFgpz0OSrfl
Xm1pa67qmg+JbK4h1Ere6bvggkW5Xy5/n3RB5nJbGUGRtVuy4zVtY9QjTUDpX9vCwa0s8ic3PmgC
ZxP5Yl+cP5Y/h56EckUBb+vu/wAz0eivP4bbUrt7S3hbXF0iTViIzLLPHP8AZ/szbt7MRKF83OC5
B6Y421AP7Utk01p/7bupbe7uIY7Mfa186P7RiN3mT5flQD/W5DDuMlqOomrK/wDXX/I9HooooAKK
KKACiiigArTi/wBSn+6KzK04v9Sn+6KmQ4nleheFfiT4UfVYdGl8JyWl7qEt6DeNcmQbyOPlAHQD
1781par4R8Wy6zpXizS7zRofE0VobS/gmEps5kJJ+Uj5xg4+vrxg+i0VPby/yt+RfV+Z5Bqvg2+0
3wZ4v1fxHrulQa3rYRZ7hoybSBFICRqGBJyON20sCRjJGTzHgR7fwf480axtbTwhqUmqbrd7jQry
e5mgAAJdi7MFB5JwBkA9AK+gp4IrmCSCeJJYZFKPHIoZXUjBBB4II7VR0zw9omiySSaVo+n2DyAK
7WtskRYehKgZojpK4S1VjhD8OtX/ALB8d2P2mx83xBeST2p3vtRWOQH+Xg/TNWPEngLVdY+GOh+G
re4s1vbD7L5ryOwjPlLhtpCk/TIH4V6LRQtPw/DYbd7/AD/HcQDCge1LRRQIKKKKACiiigAooooA
KKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAo
oooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigArn/Hf/JPPEv8A2Crr/wBFNXQVz/jv
/knniX/sFXX/AKKagDBvv+P+f/fNbXhT7959I/8A2asW+/4/5/8AfNbXhT7959I//Zq1lsZrcvUU
UUgM3xFqEukeGdV1K3VGmtLOa4jWQEqWRCwBwQcZHrWfDD4vmGRqujD/ALhMv/yTVzxRZ3Go+Eda
sbSPzLm5sJ4YkyBudo2AGTwOSOtZiJYy366jc/Dq5k1BXVxdyRWDShlxtIfzs5GBg9sCpdxqxpaD
qVzd6I9zqbwCaC4uoJXhQxoRFNJHuClmIyEBxk1Z0/Uv7QG4Wd1DEy745JlUCRfUYJI7HDAHnp1x
n6bp1xP4ZvLS5hks5bue8fY7KzRrLNI652kjOHHQmo7xLvUtJNleaNdDYFLeVJAwdlYY2hmwy8ZO
4Djt6aQSa1M5tp6eZr3upW2nvapcPta5mEMXuxBx/KrdcjJousanbKkiWWnrFaeSkSw71DE7iUCu
AhG1P72CDjI5NuCzuH1NbrUNJNxPJ5TxzboyLTCjcuS24fNuPyg5zVuEbbkKpK+2n9XOjorBstPk
h1SZ59OMly0sjrqWU4Q52r138DAxjHFZOn+HJ4oblbqC/aR7Z4p2R7dftDHHKkAFu5zIRjPfJpKC
7jc5J7HaVRstTF/M4htLgW6llFy2wI5U7SAN27qD1UDj6Vzn9k3YisXXRI/Pt5GEMZjgESIWHzSK
G+V+M5jz9P4avXNnqE015FptvPp6SxSh3klTY8hHysiqzFTnJJwvXJBPR8kV1JVSTe1jo6imghla
OSWFJHhbfGWUEo2CMr6HBI/E1yEPh24GmzxQ2t1D5kkGYpGt0ztkBZgIgB0/iJ3H04GdObw7GLww
W9tCmlT4luIFAVTIn3Rt6HdkE/7nvScIrqVGpJ/ZNy1n+02sU/lSxeYoby5V2uvsR2NS1yNto1xB
bael9pX29IrNIlh3RkW8gJy3zMAM8crk/LT7vQrqfxG91Ily4aWN4Z42gCwoAMqWZTIOQ3C8Hdzj
Jp8kea1yfaSS+HsdXRWDolhLZapfFbDyLaUl/OmEfmyOWJxuQksnPG7BGe/berOSs9DWMm1qgooo
pFBRRRQAUUUUAFFFFABWjiQ2mImVJDH8jOu4A44JGRke2R9azq04v9Sn+6KmRUdzhH8QeKLO08UX
VxeaPMmhq4CR6fLGZmECygkmdtoywBGDnHUZ40rjxvZPYobO4EV2Li2ikS8srhAolcDONmcMAwV/
ubsAmrN14V+02Pia2+27f7cJ+bys+RmFYumfm+7nt1x71DqXg7+0L6W5+3+Xvjsk2+TnH2eYy5zu
/izj2689KStdX8v+CW7W08/0t+psaZrdjq8lwtkbhxAxRpHtZY42IJU7HZQr4IIypNVLzxfoljfS
2U1zMbiJtjJFaTS/PtD7AUUgttO7aOcZOMA0zRvD9zpms399LeW/lXI+W0s7ZoIg24sZHBkYNIcg
FgFzjkHjFaXwf5mtPqP27G7Uhf8Al+T/ANO3kbM7v+BZ/DHep6fL8QVrsu3Hi7RLaK2la6keK4gW
5V4baWVUibpJIVUiNTz8z4HB9DjJ1/xyNLudbsbe0ka5sNL+3RTNDI8LsQ5wxChQPkHO4ZyQOQao
t8MLYxaepk0y5eCxisZpL7SkuWKx5w8W5sRt8x671+7wcHOrrnhCbU7i/a01CG1h1DTv7PuI3tTI
QoD7GQh1C4MhyCDkAAY61Tt08/8AgDja+vl+av8AqW7Xxho09lczvcyQm1RHnjmtpYnG/hSqOoZw
xBC7Qdx4GTUw8V6OdNe/+0TeWkwt2iNrKJxKcYTydvmbsEHG3ODnpzVHUfCH267urpb8xSyW9pHE
fJ3COS3laRXPPzAsRleOAeecirc+GZYIf7Ru9ctYtWOopeLdSW2238wxiBU8oyZwVIGPMyWOc/w0
aX/ruSlpr/Wn+Zo+HfET6v4cudWnjKCOe5RVW3kDbI5GVcxkF92FGRjOe3asrUPHceneCI9TaSK5
1SXTTeRpaWk8kRO3IZgF3Rxk9329+eDW54f0SbRtGksri7S5mlnnnkljhMS7pHZyApZiAN2OprnZ
vh9dpoo06w1mGEy6SmlXUk9kZfMRA2GQCRdjfO3UsOnpyf8AA/J/8ApWvd9/1/yOibxRpcN3FZzz
yLcN5auy28jRRu4G1XlClEY5GAzAncvqMpa+LNGvNSSwguZTO8skKFrWVY3kjLB0EhUIWG1uAc4G
elY8nw/tG8RNqe3S5FklimlNxpaTXAdFUfu5mPyKdi8FWIy2CCQRctvCP2f+z/8ATt32PVLjUf8A
VY3+b5vyfe4x5vXvt6DPBoSvh8/+A/8AgGdbfEGG9e12QTWoN/cW8qz2Ny3mJEJP9Uwj2mQ7Adp7
bhyRSeHfGs2pvZXF7c2kFpd2U1/5cllPA0USlQP3j5RwoLbm+XOVIGOTbi8G3EV3B/xM4jZ2+oy3
8MX2U+YGlWUOrPvwRmXIwowBg561H/wgMEul6dp1zfNJBaaTNpj7YgpkEgQbxkkDGzoQev5pbX/r
b/OxTtf+u/8AkaY8Y6KbWW4aW7QRsimKSwnSZt5whWIoHYE5AKgjg+hrVF7G2nfblSby/K80K0Lq
+MZwUI3A+2M+1crZ+BBZaZeW8cXhxZ7jy1Pl6EscBVDkFo1kDM+TnO8AYGFBznpNJ06XT9EtrC5v
Zr2WKLY9xKSWkPc8kn6ZJPqSeaJbO25K31OTs/iPDdnRLl7O6hs7+ymuJUWxuJZUdPKwFCplkw5+
YKQcda6CfxdodvFbym8eSKeEXCyQW8kypEekjsikRp1+ZsDg+hxnaN4PudMn00zanFPFptnNZW6p
amNjG/l7d5LnLDy+SAAc9BisxvhhbGLT1MmmXLwWMVjNJfaUlyxWPOHi3NiNvmPXev3eDg5p2/r5
/wDAHodre6laadarc3UwSFpI41cKWyzsFUcZ6lgPxqhd+KtIsppYJJp3njn+zNFb2ksz+ZsEmAqK
SflIOQMD1qTXdFGsaIdPimFs6vFLDJ5e5UeN1dcrkZGVGRkcdxXPz+CtSuLXUPN1bTnvb67Fybht
NceQwiWMGHE4ZHG3IfcSMmp7/wBdv+CC21N+fxLpVtqIsZZ5RNuRGYW0hijZsbVeQLsRjkYViD8y
8cjMmna9p2rXE8FjLJK0DOkjeRIEVlYqy7yoXcCOmc4wehBrnj8PrU+IP7SY6dceZJFNNLeaZHNd
F0VVykxOFB2KSNhIJbaVyMb+haONEsp7cTCbzbue5LbNuPMkZ8dT03Yz3xT0F0Hf2/pf2hLc3arN
JdtZKjKykzBC5Xkf3RnPQ8YPIrBfx9p9tr11BcyMNMjtIp0uY7SZ8EySo7OyqQqDyxhiAOpyRVnV
fBNjquoX9800sU9zCqxsgH7iVcYmX/b+SMfRPc0y68Ewy2+p21tdC3gvNIj0uNBFu8lUEgDdfm4f
px0680ltqPTb+t1+hpz+J9It9UXTpLpvPZkQssMjRI7/AHFaULsVmyMKzAncMDkZvXGoWtpc29vP
L5clxuEWVOGKjcRnGAcAnn0PpXPT+EJ5b2UJqaJptzcwXdzbm2zI0sQTGyTdhVPlJkFWPXBGeNXx
BoNv4i09LS4d4wkqyB0+8OzAf7yFlPsxoe2gl/X9f18xsfibSprOG6t55bmKa2F3H9mtpJWaIkAM
FVSeSemM8Hjg4gk8Z6HFBbS/aLl/tKSPHHFZTySERsFfKKhZSpIBBAI59DWfc+ArRrHVbe0nEP2+
aOQJJHviREbf5JQMu6NmMhK5GfMI6UaH4HGi3NrIl5EY7ZLtEhhtREoE7o5AAYgBSpAAHQgdsk9P
6/rYF5lq48Z2EOs6TZIks1tqVo91HdwxSOgUFME7VIAIfJYkBcDPUVq6TrFprdn9rsvtJhJG1p7W
WDcCAQVEiqWGD1HFYdt4QudPt9BFjqcIuNKtGsme4tDIk0bbN3yh1Kt+7GDkgZPBq94a0G40KK6S
a8glWaQNHb2lu0FvbgKBiOMu+3JyTggZ7A5Jemv9df8AIH0LSeINNbULixeWWCe3jaV/tFvJChRS
AzK7qFdRkZKkgZHrUcHibSrixuLwTTRW9uAXe4tZYcg9CodQXB6ArnJ4Ga5xPhvA2q3t3cXkUiXk
d1BMyWu2eSOcg4eUsSxTACnAAUY2962JfD+pX+iy2GqapbTOGie2kt7MxLG0bB1LKZGL/MoyAVBA
wMdaXT+v6/rcely0fE+lrpwvna7SMy+SsT2Myzs+M7RCU8wnHPC9AT0GaavivSJJLOOKW5lku93l
pFZzOy7WCt5gCExYY4O/bg5z0NUNY8KXPiDS7aLVrrTbu8trn7REZdN32x+UrtaFpCWGGJzvBzgj
gYqCTwTKtlptrZXWnWP2VzI01ppohlUs4ZhAUdREpA2kMHyMbt3OWt9RPbQ39M1ux1eS4WyNw4gY
o0j2sscbEEqdjsoV8EEZUmqEniy0g8U3mi3MUsK2tml0120b+UAd+dzbdqgBM5LYOSOoNLo3h+50
zWb++lvLfyrkfLaWds0EQbcWMjgyMGkOQCwC5xyDxiLV/CrapqV7OL5YrbUbD7DeRGHc5Qb9pjfc
AhBkOcqwOB0pdhq2t/61X6XNLSdf07WjKLKSXfEFLxz28kDhWztbbIqnacHDYwcHB4NYPiHxv/ZN
1rlhBZyG60/TPt0UrwSNEzYc7WIUBR8g53DOSByDWro2i3tnqFzqOp6hFeXk0MduDBbGBFjQsR8p
dyWJdsnOOmAO9LX/AAncavd6jLbajFbR6lp5sLlJLYynaN+1kIddpBkOchs4HTrTe+g42vr5fpf9
S1aeL9HubO4ma4lia1RGnjmtZYnG/hSqMoZwxBC7Qdx4GTWjpmrWerwvLaPJ+7fZJHNC8MkbYBwy
OAy8EEZHIIPQ1gax4Hg1mS9ee5jYXFrbQrHJbiRFaCRpFZlJw6ksAV44B55yNPw3oEXh+ylhSPT0
eaTzHGn2K2kQ4AGEBJ6DqzMck9BgA01IWyC38U6Tcs3lzXARbgWwle0mSNpCxUBXZQrfMCMgkZxz
yKWTxRpKagliss81y8jR7Le0ll2lSoYsUUhVBYAsSBnIzwcYd34WvYbfW5Q8dx9uj2Q2WnwC2RJC
5InbfIymQEglwATt6McASy+Dbl9P0m2h1C2gmtPnmvBak3LOzh5WjkV1CbzncCrA55BHFKPn/X9f
qhvy/r+v0Zbt/Gdi+oa3a3MVxbLpUyxNK0EpWXKoRtOzBYs4UICWbggHIqdvGGipZi5e4uFBmMAh
azmE/mbd+3yinmA7RuA28jkVnar4JOpyavG95bmy1GWK6aCez80rPGECkkuFaMiMZQrk5PzDjBZe
BorSOw2Pp9u9tetdumn6cttE+YWiChAxI4bOWZjnPQYAOnn/AF/wf60Hpc29J8Q6Zrjyrp9w0piR
JDuhdAUfO1lLAblODhlyODSy67YQasmmTNPHcyA7C9tKI3IUsQshXYWwCdobPB44rN8NeE/+Eelj
f7b9o2abb2GPK2Z8oud/U9d/TtjqapXXgX7T4tGvfbLfzFuFnQyWm+ZR5RjMQlL8R4JYKAMMcnPS
nLfQRq6d4w0PVWxa3jgfZzdK89vJCjxDGXVnUBgMjJBOM84qtonipNd8SX1laxyCygtIJ43mtJYH
ZnaQHiQDK4VcEDHXk9qg8BQvpenafPfu8NrpE2luUi2tIJAgLjk7SNnTnr7c39D0DULDWLrUtS1K
2u5ZrWG1VbezaAKsZcgnMj5J3n06U9L/ANef/AG9tP62/wCCTz+LNGt9WTTJLib7S0vkApaytH5m
3dsMgUoG2jOCc4psPi7SLnTDqVs17cWny4kg064k3BhkFQqEsB3IztPBweK5mbQNW/4WE95DpzSW
ElyJTLOAIY/3WxnULc4L9QGMG7kjcByNO48DrN4U0XQzd28iabsDC5tPNhuAqFfni3gHruGSQCAc
HFQr8t+v9XB2uX7rxr4ftNplvZGRreO6MkVtLIiQvnbIzKpCr8p5JAGOcVHdeM7Cw8RX2l3kVxFF
aWaXbXSwSuhDb8jKoQOFGOfmJwBkYrOtvh/9n0a907+09wuNHTSlf7PjYqeZhyN3JxIMjj7vbOBo
Xvhm6l1Ka7tLyyC3NitlcwX1ibhJFTeVIAkTAy5yDnI9Kp26f1vYNLf15f8ABNyxvotQtFuYUuEj
bOBcW8kD8HHKSAMPxFZUfjPQJYrqVb1xFbQPcs728qq8S/eeMlcSqOOU3DkeozY0DR5tI0g2V1e/
a2MjtlUZEjVjwkaszFUA4ALHHbAwBz58BXEulvp1zrCSW8OmTaZY7LTa0UcgUFpDvPmMAiDgIOvH
PB1CNvtHWWGoW+p2xuLUyNFuKhnhePdjuu4Dcp7MMg9jXPL42s5/E0NjbyD+zxaXNxcXU1vJGn7p
kGUkYBHX5myV3Dgcjv00UKx2yQdVVAnAxxjFcXF8PZXijsb7VYp9Mt9Nn023ijtCkojk2cu5dlZg
EHRAD6dqXX+uzCO2puDxjon2Sa5e4uIUiaNXWezmik/eNtQhGQMVLcBgCMg88Gq58XWd3e6XDp84
X7RePbTJdWk8bqViLlMFBsf7rDfgFckZrPtfh9HBp8sG/SbaV57aQvpukpaqRDIJMMAxLM2MZ3YH
GFHObsvg5ZdbfUGvflfUhfGLyu32byNmd3/As49sd6en9fL/AIP3Bp/XoWk8ZaE8dxJ9rlWOGJpv
Me1lVZY16tESuJRyOU3dR6jOrY3sWo2iXMCXCRtnAuLeSB+DjlHUMPxFcjo/w8t9Ggnigj0Nv9Ga
1hY6KgZ0OP8Aj4YNmU4AB2lAcnIPGOi8PaTPoul/ZLi9+1v5juCqMiRgnhEVmYqgHABY47YGADQT
NWuf8d/8k88S/wDYKuv/AEU1dBXP+O/+SeeJf+wVdf8AopqQGDff8f8AP/vmtrwp9+8+kf8A7NWL
ff8AH/P/AL5ra8KffvPpH/7NWstjNbl6iiikAUUUUAUJ72SPW7SyCp5c0MsjEg5BUrjH/fRpZtXs
YL0WkkzCXcqkiNiis33QzgbVJ4wCQTkeoqhrPmR6raXME7xTQxOuP7OmuUYMR3QjB+X171RkCSzu
WuLsQTyxT3Ea6RcZZ02/dbHyqdi8EMevNaxgmlf+tf8AIxlKSbt/Wn+ZoX3iaxgguFhnPnpHIUZ7
aVoiV4J3KuGAPXBOKsf29YLOtvJM3m70jYrC+xXYAgFsYGdwxk964+JHmvr6BrLUI7adLhFnl06f
92HOfkUOw5OP4EyByc8HYeK1eK6TzL8efcQz5/syf5fL2cfd5zs/WrdOKtuQqlR3+Z1dFFFc50hR
RRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFaKtstg2C21M4UZJ47VnVpxf6lP90VMtio7
nlmk+NtZuLPVnW9SePybe4gkklile1jeUpMX2RRqGjXDMvzbT1Yg4rfu9c8jQbWWz8Ui8sJb3ybn
Wybc/Zo9hOdyoIvvBVyVwN2Dk129FSUedeI/EGo2lpoy6d4itBYXCTM+s3NzDbLMykBFEhgkiyQW
PCDdtypABBeniLUYNc0iLUtdt1lu7SMfYbMxgiUo5aWWKWMTCLgHcCuMcrjJr0KigDk/AesSarp1
1HPqrarc20ipNdxyQy27MVBxE8SICo7hhuBPORgnnZr+fRNa8YNHrTw3Ut7A4gkWImK3ZYFe5Vdu
4hFLDcSUG35gcGvTqKd9b/10/wAgWhznhDU5tSg1Ef2l/alnBdeXaahhP9ITYjE5jARtrsy5UAfL
jqDXC62vlap4ntX1qWO6uNYsJYbN/JDbC9sPOVdu4gH5c5K8cgnJr12ihP3k/wCun+Q0zzXUfEOr
aba6lpz6xMZ4dVS0t9Qne3t8KYFlxK5hZOpKjbHknaPU0221OTUNb8Ea3qOrGwNxpsscuPKSOS4L
RZhy6khmIYbQQ3ycYwa9MooTtr/W1v8AgiZzHiDxB/YfiPTFvL+Gz0y4tbkM85VEacGPyxub+LBf
Azzz1xXN6L4rv5rvw499rf2iTULCEjTrZoBK8zIzM8sZTeIzgfMjAAjlcZNel0Uulv66/wCf4DbP
JLDxZ4nk0XWL6TV7B54dLnuJLaKYSyWM6jKqUFunlYO4bZXcnbxnaxPodjerY/YLLUdSkuL+/DyR
b4gAcKGZV2KAFA6bsn3NbFFO4nqFFFFIAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKAC
iiigDD8YazceH/C17qlokTzwbNqyglTudVOcEHoT3rkvAvjnxD4r1w281nYJYwxl55I4pAR2UAli
Mk84PYN6V3Gu6Nb+INGuNLu3lSCfbuaIgMNrBhjII6gdqw5PANjZvDc+HbiXRb6GNo1liHmq6s2S
JFfO/vjJ4467QBzVI1faKUXouh7WDrYFYOVGtH95Ju0mrpKy3trvfZO251tFcxa+KprK4Sy8T2P9
lzHIS83hrSYgdpD9wnaxCtzgDnJArp63jNS2PLrYepRaU1vs90/RrQKKKKoxCiiigAooooAKKKKA
CiiigAooooAKKKKACiiigAooooAKKKKACiiigArn/Hf/ACTzxL/2Crr/ANFNXQVz/jv/AJJ54l/7
BV1/6KagDBvv+P8An/3zW14U+/efSP8A9mrFvv8Aj/n/AN81teFPv3n0j/8AZq1lsZrcvUUUUgCi
iigDKuZpF8TafEJHEb287MgY4JBTBI9sn86Zca3LDdzKtor2lvNHBNKZcOGfbjamOQN65OR3wDjm
xfWFhfXcH2h3W5RW8ryrl4n28bsbGBI+7+lB0Swa4SdopGdNp+aZyGK/dZlzh2HHLAngc8VonGyv
/WplJTu+X+tDKXxaDdzo1rH5MEc0kmyfdNGIzj549vy7u3zVYfX7i2EiXlgkc6+SQsc+9Ssj7Ac7
RyDnIx6c+i23h+SHUZZpbsPayGTdaqJdjbychg0jL3PRV59uKtJoOnJbTQeS7JMFDmSZ3bC8qAxJ
YAHkYIwelNunpoSlVd9e/wDwChq2tXaW16tlGizWt5BBud+HDFCf4Tj72P19q34y5iUyqqyEDcqt
uAPfBwM/kKoJoenx2s9uIpGS4YPKXmdnZhjDbiSwIwMEHjFXoolhhSJC5VBgF3LH8SSSfxqZONrL
+tEXFSvd/wBaj6KKKg0CiiigAooooAKKKKACiiigAooooAKKKKACiiigArTi/wBSn+6K53W7iWz0
DUbmB9k0NrLJG2AcMFJBweOtZWl6d4uvtDs9Q/4TPylntkn8v+y4m27lDYzkZxmsalTldrX+7/M7
cPhFUpurKair215t9+kWd1RXm2kXPiXV5LZF8W3dt9qhM1sbjSLfEyg4bG12wRkcHB5rc/4R/wAX
/wDQ8f8AlJi/xrNVW1dRf4f5m8sFTi7OvD7p/wDyB1tFcl/wj/i//oeP/KTF/jR/wj/i/wD6Hj/y
kxf40/aS/lf4f5k/VKP/AD/h90//AJA62iuS/wCEf8X/APQ8f+UmL/GoLXTPE96Jjb+PN/kytDJ/
xKIhh16jk0e0ltyv8P8AMf1Olv7eP3T/APkDtKK5L/hH/F//AEPH/lJi/wAaP+Ef8X/9Dx/5SYv8
aPaS/lf4f5i+qUf+f8Pun/8AIHW0VyX/AAj/AIv/AOh4/wDKTF/jR/wj/i//AKHj/wApMX+NHtJf
yv8AD/MPqlH/AJ/w+6f/AMgdbRXJf8I/4v8A+h4/8pMX+NH/AAj/AIv/AOh4/wDKTF/jR7SX8r/D
/MPqlH/n/D7p/wDyB1tFcl/wj/i//oeP/KTF/jR/wj/i/wD6Hj/ykxf40e0l/K/w/wAw+qUf+f8A
D7p//IHW0VyX/CP+L/8AoeP/ACkxf40f8I/4v/6Hj/ykxf40e0l/K/w/zD6pR/5/w+6f/wAgdbRX
Jf8ACP8Ai/8A6Hj/AMpMX+NVEfxHo3jLQrC/8Rf2ja3/ANo3p9ijhx5ceRyMnqR6dKHVa3i/w/zK
jgYTv7OtFtJu3v8ARNveKWy7ncUUUVqeeFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQB
DdWtve27293bxTwPjdHKgdWwcjIPHUA1g2GjR+F76FbXV1tdGlbyo9NufmHnN08qRm3AkjO35uS3
rxDL4rn1eZ7PwpbrezIxV764Vls4iv3lLjl2+7gLxhgc4BqxpvhK3hvF1PV5v7X1cYAu54woQAgq
I4x8qYxnI5yWOecVi2ptOKv5/wBb/kenCE8PTlGvLlT+za7fnZ6R9fi7I6Kubu9avl8W/wBlQvHH
AsMUmfsEs5YuzAgsjBYx8o5YY5PpXSVTj06GPVp9SDP500KQspI2hULEY4zn5j39K0km2rHHQnCH
M5q+mnrdd79Lmb/wlVt5VxL9hvfKhna1D7U/ezCTy9iDdkknoSAMdSKRvFdsrJCbG9+2G5+zNaYT
zEfYZBk79uCoyCGI55xziw3hyzbTprLzJwsl014sgYb45S+8FTjHDdMg++aZD4ZtIrmK6e4uZrpL
n7U88hXdK/lmMbgFAwFOAAB0+uc/3mny/S/6nUngrNtPrbf5fLe/Xbpcj0/xXa6hcWsQs7yAXLyR
RyTBApkTO5OGJyNp5xjjrVm416GHVWsEtLu4eMRmd4Iw6w7yQu4Z3dieAcDk4pkHhuzt3sWSScmz
uJriPLDlpN24Hjp85x+HWn3Ggwzao1/Hd3ds8ojE6QOFWYISV3HG4dSPlIyODmmvaWV/60/z/AmT
wjqPlvaz773/APkfx8iCPxTZyXKJ9nuUt5Znghu2VfKlkXOVX5t38LYJAB2nnpmrF41t50haLSdS
bz7Y3UIxEN8YxuIzJxjI649s1aj8LWcdyj/aLl7eKZ54bRmXyopGzll+Xd/E2ASQNx46YfbeGbK2
jtESWci2smsU3MOUbbknj73yj29qm1W39dv8/wADS+BXRv7/AD/Ha/TexVufGdjBE0yWt5cQpaR3
jyRImEifOGO5gf4eQBn9cPl8YWFtb3kt3DcWrWvl7o5dgZxJkIQQxUA4PUjGOcUo8I2C2M9oJrny
5rGOwY7lyI03YI+X73zHPb2qW88MWN7PdzSSXCyXCwjcjAGNoiSjLxwQT3yPam1U6f1v/wAD8R3w
F7Wdvx+z/wDbfgVIPG2nXUcJtre5nlluDbCGFonIcIX+8H2EEDqGI9cYOHReKjdahpsNtp1yYrpp
llZ9gaJoztZcbucHrjPHTPa4ugRGWzmnvb25mtbhrhZJnUlmKFMEBQAMHooHPPrlkPhq1t5raWG5
uka3mnmGGX5vNbc6n5ememMH3pWq/wBfL/gicsFrZd++9penXlt+IaF4mtPEDSfZILhY0GRK4Qq3
PT5WO1uh2thsHpUMniiK3vJbZoLi5lN6bSKOCJVO4RCTBLPg8Z54+nGam0zwzaaZqkmoi4ubi6eL
yvMnKFtmRwWChn+6oy5Y8dad/wAI3Z/2kt95k/mi8N5jcNu8x+Xjp0x+veqXtOVX36/f/kS3g1Vl
a/LbT1/P8hsniS3Hhm61tIJtlusm6GTAcOhKlTgkdRjIzSfbNY06znvdQW0u4I4PNK2aGN1I5I+d
iGGMnOVPHQ54tQaJZw6Xc6cytNbXLyvIsh6+YxZhxjjLHFVf+EailtpLa91C+vYXjEQjuGQqqgg/
dVQGPA5bJ9COaTU2vO349SYywybS2v1V3y6Wt2trfVXDQ9Yu72yuZ9TtPsf2fAYnbgkIC54duA2f
wx3zTI/Fds9h9sewv4kcRm3DxDNx5hwgQhiMk44JBGckAVc0/QdM0uzmtLS0ijinZzKFRV37iTg4
A4G4geg4qnH4UtlsPsb3+oSxosS25eVR9n8s5QoAoGQccsCTgA5FP3/6/r7iubCSnJtWV1b069X+
L9A/4Sq23CAWd4dQ8/yDY4TzQ2zf13bMbfmzux+PFZsXjy1gsY5dQTbcTT3CpCrJEQkchXLGV1Ge
nGck5wODjS/4RW23CcXl4NQ8/wA832U80ts2dNuzG35cbcfjzTI/CNrbpCbW/v7e4iMxFyjoZGEr
bmU7lIIzyOMjHWoarX/ry/4JrGWASs1+e9n/AOS3tb7W9zZsL2DUrCC9tWLQToJEYjGQfarFRwRC
CCOFWdlRQoaRyzHHqTyT7mpK6Dy58vM+XYK5/wAd/wDJPPEv/YKuv/RTV0Fc/wCO/wDknniX/sFX
X/opqCTBvv8Aj/n/AN81teFPv3n0j/8AZqxb7/j/AJ/981teFPv3n0j/APZq1lsZrcvUUUUgCiii
gDmfEdzLZ6jHcwttli066dCRnBGwioLfUtRj1OOOS+kljF2ICjRxgMGg8zPCg5B6c9Ouetb95qQt
bmK2jtbi6uJFLiOHYCFBAJJdlHUgdc1OLqCS6e03fvljEjJg8KxIHPTsa0UrRtb+rmLjeW/9WOR0
zXb+WyEttf8A9qXJsJJ5YdqHyZRjavyKMZy3ynJOOO9LDq+qnTZ5Y9Ttbj95AqSxyLNsZpAGUkRI
vQ/d5YevIrr7W2hs7WK2t02QxKFRck4A9zUd1ex2k1rHIrlrmXyk2gcHaW59sKar2kW9Ik+zklrI
xZr2ew1+1tJtVe4WRQi26GHzWY7jukTYDsxjlSMY5HU1nLrt99inlj1Hz7gWE088Xlp/ocq42rwM
jqww+Sdv1rtKKlTXVF+zd9zlLnVL3TxfRy3s0w+zwSxysIozE0jspy2zaEGAckEgZ61TkvZr3TNJ
urzUfI+z6g8c1yjJtAAcKxZkC8grg7QDuzjkV29FNVEuhLpS25tDlLDVdTufEBie7tQnnujWfmgu
sYztbYI9wyAp3F9pz7gV1dFFRKSdrKxpCLje7uFFQ3N1DZwiWd9iFlTOCeWIA6e5FENx5008fkyp
5TBdzrgPwDlT3HOPqDU26lXWxNRRRQMKKKKACiiigAooooAKKKKAMvxJ/wAitq//AF5Tf+gGtHw0
pbwXpCjqdOhA/wC/YrO8Sf8AIrav/wBeU3/oBrR8NSJD4L0iWQ4RNOhZj6ARiueavUt5How0wP8A
2/8AoYGneGNRsfCUbkvPrEVi0ENtcmNood33lUAAEkAfeJ6DnGaqWHhW+82G2udOY6euqC58qbyA
BEYCpykeF+9wQBg578mu5+3w/wBy5/8AAaT/AOJo+3w/3Ln/AMBpP/iaXsY3T/re5l9ZnZ+Zxj+H
9Uj8UwXcGnrFBb3BjRoFgRDbeUVUZ/1hIPUE46YBqqvg29/sny202M3J0fYxLoSbwH5Gzn7wBIDd
hxmu9+3w/wBy5/8AAaT/AOJo+3w/3Ln/AMBpP/ian6vG1rv+lb/g+o/rU9Nun4HGP4X1C615579b
t2aaKSG7hktwIUUD5SzKZVIIPCfK2e2SaJfDd9FYaxaWWmLA8995/nQ+Sv2m33A+UCc4OMjDrt6j
oa7P7fD/AHLn/wABpP8A4mj7fD/cuf8AwGk/+Jp+xjv6/jb/ACF9Zn+X4HHQeEXCWCfYpzanUfPn
trpoMIgiZc7IgEGSRlVznqeprQ0rQ30vxZNLZaaIrCSMh5pkiypAUKsTKd+04HysMDbx6V0P2+H+
5c/+A0n/AMTR9vh/uXP/AIDSf/E1UaUYu6/rRL9CZV5yTT/rW5aoqr9vh/uXP/gNJ/8AE0fb4f7l
z/4DSf8AxNaGJaoqr9vh/uXP/gNJ/wDE0fb4f7lz/wCA0n/xNAFqiqv2+H+5c/8AgNJ/8TR9vh/u
XP8A4DSf/E0AWqKq/b4f7lz/AOA0n/xNH2+H+5c/+A0n/wATQBarkvEH/JQvB3/b7/6KFdH9vh/u
XP8A4DSf/E1yuvXcbeP/AAi4WbC/bM5gcHmIdBjJ/Csq3w/Nfmjuy7+M/wDBU/8ASJHaUVV+3w/3
Ln/wGk/+Jo+3w/3Ln/wGk/8Aia1OEtUVV+3w/wBy5/8AAaT/AOJo+3w/3Ln/AMBpP/iaALVFVft8
P9y5/wDAaT/4mj7fD/cuf/AaT/4mgC1RVX7fD/cuf/AaT/4mj7fD/cuf/AaT/wCJoAtUVV+3w/3L
n/wGk/8AiaPt8P8Acuf/AAGk/wDiaALVFVft8P8Acuf/AAGk/wDiaPt8P9y5/wDAaT/4mgC1RVX7
fD/cuf8AwGk/+Jo+3w/3Ln/wGk/+JoAtUVV+3w/3Ln/wGk/+Jo+3w/3Ln/wGk/8AiaAML4h3VxZe
BdSuLS4lgnTytskTlGXMqA4I56EiuB8J6xN4+1ddL8TajLJBHAzJaxkQpdtuyd+0gsVGCAB/DnjB
3erXUtje27293aSTwPjdHLZu6tg5GQVx1ANVLXT9AsrhLi00WGCdM7ZItNKMuRg4ITPQkVzVKMp1
FK+nVHtYPMqOHwcqLh+8u3GStdXSWj36dPzNeKKOCFIYY1jijUKiIMKoHAAA6Cn1V+3w/wBy5/8A
AaT/AOJo+3w/3Ln/AMBpP/ia6TxW76stUVV+3w/3Ln/wGk/+Jo+3w/3Ln/wGk/8AiaALVFVft8P9
y5/8BpP/AImj7fD/AHLn/wABpP8A4mgC1RVX7fD/AHLn/wABpP8A4mj7fD/cuf8AwGk/+JoAtUVV
+3w/3Ln/AMBpP/iaPt8P9y5/8BpP/iaALVFVft8P9y5/8BpP/iaPt8P9y5/8BpP/AImgC1RVX7fD
/cuf/AaT/wCJo+3w/wBy5/8AAaT/AOJoAtUVV+3w/wBy5/8AAaT/AOJo+3w/3Ln/AMBpP/iaALVF
Vft8P9y5/wDAaT/4mj7fD/cuf/AaT/4mgC1RVX7fD/cuf/AaT/4mj7fD/cuf/AaT/wCJoAtUVV+3
w/3Ln/wGk/8AiaPt8P8Acuf/AAGk/wDiaALVFVft8P8Acuf/AAGk/wDiaPt8P9y5/wDAaT/4mgC1
XP8Ajv8A5J54l/7BV1/6Katb7fD/AHLn/wABpP8A4msHxZfW+p/CzXL+zk8y1utEuJoX2kbkaBip
weRkEdaAMm+/4/5/981teFPv3n0j/wDZqxb7/j/n/wB81teFPv3n0j/9mrWWxmty9RRRSAKKKKAM
nW4pZEQ21jczXShvJngkRPKbtuLMCVJwSMMDjkHis680e7fVJ7pbSNrq4sBCl5HtHkSgMC2SQwBy
BlQTxWjqerPply3mIrQG1kljwDuMiYyvXuCMcdjWZP4nuBbRTxRRBVhhe5R1ZmR5JAm0YPYCT15A
raClZWMJuF3f+tv6+8oX+nm30u6caR9jtJGtUNnmM+a4lG5sKSvIIGSQTjnGKvQaRdiSB4rD7JbL
fmZLXen7lPJKk4UlRlucKT1z61srruntbPOJZMJIIjGYJBJvIzt8vbuzjnp05qvqWvJb6Ql7YR/a
nkfbHEAQxxkuMHBBAVuDzkYp882rW3/4BKhBa36f5mBbeGryGKBxYRieOO0bdlMiVZMyHOeu3HPc
cc1Lo9i82oefbaf5Ekd/ctNf/IPMTLjZwdzcleGAHy/Suhm1/TYGjV7g5kRJF2ROw2t905AOMnge
/FRxayt1qdlFbENb3EUzMzoyuGRlXGDgjknII7UOc3e67/1+AclNWs+3b+upztt4bvo7G+Qw3P2t
7OWJ3d4AlxIw4IKKGbnJzIQRnvk1o3+iCF9PksdKWa4h5+dIjCGJXcz7iG3cZ3Lk8c56V09FT7aV
7lewjy8py8Wk3S6usv2HbOtzLLLf71/exMG2x9dxxlRgjA25B6VXtNBvbC0tHtLGBLr+zZYrjdtI
klwu0Pz83Q12FFL2r/r5/wCZXso3ucXD4fujod7ZvYM0ZuYriGGYQDIG3eoVMIpO1uOnzDnk1LH4
feS7GdKjhsnv1ma3YR7QnkbTlVJH3uMc/lXX0U/bS/r5f5EqhFJL+uv+Z51rVkthZwW16tukBN0s
cUzQsERnyrRo8iYYKeCCcdMV39mEFlAI1dU8tdocYYDHGR2NTUUpVHKKTKhSUZOSCiiiszUKKKKA
CiiigAooooAy/En/ACK2r/8AXlN/6AataP8A8k8sP+wVH/6KFVfEn/Irav8A9eU3/oBq1o//ACTy
w/7BUf8A6KFYS/i/I9CP+4/9v/oZ9po8Ot+IPEsl7ear/o+oRwwpBqtzAiJ9kt3wEjkVfvOx6d6s
3vhWwtbSSaFfEd5IuMQQa/dB357F7hV9+SOlT+Hv+Q54s/7Csf8A6RWtdBVnGefeHLfS/EpleHT/
ABfa28ckkTT3OvzbfMjbayYS6Zs5B5xjjr0rof8AhDdL/wCfrXP/AAe3v/x6uWm0GbT/AIcasmpS
Q6feQ6lc39lNNKoVJPPZ4TuBwN2VGM5+bGO1Yur6VKYPDOpa5oov9S1nWvtV5p+yNuPs8gjhxKVU
7FC/eI5BPehapfL8bf8AB+7zB6X+f4f0vvPQ/wDhDdL/AOfrXP8Awe3v/wAeo/4Q3S/+frXP/B7e
/wDx6vP5/A+vSWtil3ZXM2kLNdumkWxs5HtBI4aIbbgNCQqhl+U5XdhSRmvTvD+mto/h+w05pZ5T
bwqm6eUSPx2LBVzjoDgcAcULa4PexR/4Ryy0ySG7t7nVjKk0YAm1e6mQgsFOUeQqeCeorL0HQbbW
bO7vb291lp21O/T93rF3EoVLqVFAVJAoAVQMADpXVX//AB7p/wBdov8A0YtZPg3/AJAdz/2FdS/9
LZqAD/hDdL/5+tc/8Ht7/wDHqP8AhDdL/wCfrXP/AAe3v/x6ugooA4+/0XQ9Nv8ATrS4n8Qg38rQ
xSjXL3YrhSwVj53BIU445IpbHQ9E1C/1G1gm8RZsJVhklbXL0IzlQxCnzsnAYZ4HJrW8U6VLq+gT
Q2oH22FlubQk4AmjIZOfQkYPsTXIal4U1dvB+laUbKK7e4uHudX2R28riaQMxZPtGU2iRsE4LbR8
opXsn/X9dfwHb+v6+X4mxHouhy+ILjRln8Q/aYLaO5Zjrl5sKuzKAD52c5Q9vStD/hDdL/5+tc/8
Ht7/APHq4rTvCfiRtDvLO8sytxceFo9O8ySdGH2hDINpIYnkMpB6Y688UzUtB8Va22oTRaRdaarW
FlbGOW4ty9ysUjNLGuGdBlWwN/ynoRgmn1t/W7/yX3i8/wCtl/m/uO4/4Q3S/wDn61z/AMHt7/8A
HqP+EN0v/n61z/we3v8A8eqp4F8O/wBgWF5iG9tUuZ/MW1ujbjy8KBkJbqI0zjkKTnAJOSRXV02h
I5//AIQ3S/8An61z/wAHt7/8erlvEWhWmm+LfDn2a41MlkvJN02p3MrApEGXaXkJUZ6gYDDg5HFe
k1xPjH/kbvDX/XHUP/RArGt8PzX5o78u/jP/AAVP/SJE1po8Ot+IPEsl7ear/o+oRwwpBqtzAiJ9
kt3wEjkVfvOx6d60P+EN0v8A5+tc/wDB7e//AB6jw9/yHPFn/YVj/wDSK1roK1OE5/8A4Q3S/wDn
61z/AMHt7/8AHqP+EN0v/n61z/we3v8A8eroKKAOf/4Q3S/+frXP/B7e/wDx6j/hDdL/AOfrXP8A
we3v/wAeroKKAOf/AOEN0v8A5+tc/wDB7e//AB6j/hDdL/5+tc/8Ht7/APHq6CigDn/+EN0v/n61
z/we3v8A8eo/4Q3S/wDn61z/AMHt7/8AHq6CigDn/wDhDdL/AOfrXP8Awe3v/wAeo/4Q3S/+frXP
/B7e/wDx6ugooA5//hDdL/5+tc/8Ht7/APHqP+EN0v8A5+tc/wDB7e//AB6ugooA5/8A4Q3S/wDn
61z/AMHt7/8AHqP+EN0v/n61z/we3v8A8eroKKAOf/4Q3S/+frXP/B7e/wDx6sXWbDSdI1Gw0+O2
8Vahd3qyvFHa69cDAj27iTJcoP4h3ruq5TxJb6lF4r0HVrLSbnUYbSG6jmS3kiVlLiPb/rHUEfKe
hpMaGaRomga3p0d9ZXuvNExZSH1u+VkdSQysplyGBBBHtV7/AIQ3S/8An61z/wAHt7/8erhNQ8C6
5JHZPfQyX9tNNd3N3Y2P2WTy55pN6sBdL5bBVyucBgSccE1dTwZqWm65pEmmWtzNPFZrazX+pG3u
Et0CvgxSfLKsik7flTYwIyB1pva4up13/CG6X/z9a5/4Pb3/AOPVVPhvSxqy2H/FTHdAZvtA1q98
kYYDYW8773OcegNcnF4QvX8HppY8LvbamGtft179oi/05knRpJNyvufgO25wGGcAckU/xv4Vt9Is
dfvdL0q1s9OHhu6gY26JGPML7wNo56bj0xSk+XX1/BX/ADBK/wCH5o6nUfD2g6TYS319qGuQ20WN
7nXL44yQBwJc9SKD4b0sasth/wAVMd0Bm+0DWr3yRhgNhbzvvc5x6A1xU3gq81TRdVOn+GotOsp9
Otlh02TyFFzco+8ygIzIpKfKCSCc84Arb1PwtqN7dXFxomlrojT6BJYxfNHE0MvmAoh8pjjABwVy
Bn14ptWdvX8n+qEnf8PzX+Z0n/CG6X/z9a5/4Pb3/wCPUf8ACG6X/wA/Wuf+D29/+PVw914Kvb61
v47Dwwuk6dcLYxvpjPABK8c4eWUrGxTGzjJO5sdOmez8LaJLod/r0EdpHaaZLeLJYwxbRGq+Ugba
q/dG8Nxgc5PemPoS/wDCG6X/AM/Wuf8Ag9vf/j1H/CG6X/z9a5/4Pb3/AOPV0FFIDn/+EN0v/n61
z/we3v8A8eo/4Q3S/wDn61z/AMHt7/8AHq6CigDn/wDhDdL/AOfrXP8Awe3v/wAeo/4Q3S/+frXP
/B7e/wDx6ugooA5//hDdL/5+tc/8Ht7/APHqP+EN0v8A5+tc/wDB7e//AB6ugooA5/8A4Q3S/wDn
61z/AMHt7/8AHqP+EN0v/n61z/we3v8A8eroKKAOf/4Q3S/+frXP/B7e/wDx6j/hDdL/AOfrXP8A
we3v/wAeroKKAOf/AOEN0v8A5+tc/wDB7e//AB6j/hDdL/5+tc/8Ht7/APHq6CigDn/+EN0v/n61
z/we3v8A8eo/4Q3S/wDn61z/AMHt7/8AHq6CigDDttCtNI1C1mtbjU2aRzGy3Op3NwpGxj92SRhn
IHOM1zf/ADb1/wByp/7aV211/wAfFl/12P8A6LeuJ/5t6/7lT/20oAdff8f8/wDvmtrwp9+8+kf/
ALNWLff8f8/++a2vCn37z6R/+zVrLYzW5eooopAFFFFAFLUdMh1I2plLD7POsy47kZ4PtzVJ/DsP
lXaRSlDc3aXLErnbtZW2jnpkH/vo1JqTNcanZ6e0kscMsckr+VIY2crtAUMCCPvZ4I6emazh4kW2
tLaG0sruaZjKuy43uyCNtrbmjWQnkgA857n11ip2XL/X9WMZuF3zf1/Vy9NocjXU11DdrHcNcrcx
l4tyqRH5ZBGRuBGe461GnhpGeJrq7mk8vzHIhdoMySNuZso2cdgM9OpNMk1XUJtU0tLe38uC5tpJ
JYpyUdSCvbaTkZ6ZGc9sVXtru6Oj+GpDLM8krjzfnOZP3TnB9eQOtO00t/61X6CfI3t/Wj/UlTwr
5cfli9JQLCiAx5KpHKXUZ3c8ELn2zVuz0L7JfRXP2nfsa4O3ZjPmuG657Yx7+1VP+EokXTo5pLJf
tcsoiW1jeR2Q7Sx8wCPcpwDwFPY9Dmpotfup5LOCPTGWe4WQlZ3aILsKgnlN2DnIO0Hpx6DVXr/W
gk6XTy7/ACN2iuZF2oB1S5a+dhfNbBIJ8JEok2LuQsFYHqTgn5vYYtLr87Wtzc/YVEUc5to/33zS
SeZsHG3AU5HOcjng1Hs30NPaLr/X9WNyisWPXJRcxWtxZrHcG6+zSBJdyrmMyBgdoJ4wMEDnP4xD
xBdXFxHb2dhC8rvcD97clABE4XOQh5Oen60vZyD2kTforEttfa7u7NFtVitrmFZFlnlKliwPyKAp
VmGORuB7jIFbdKUXHcqMlLYKKKKRQUUUUAFFFFABRRRQAUUUUAZfiT/kVtX/AOvKb/0A1a0f/knl
h/2Co/8A0UKq+JP+RW1f/rym/wDQDVrR/wDknlh/2Co//RQrCX8X5HoR/wBx/wC3/wBDNW/ktfEG
vppek69dsbxDdyW72YiEv2aHAXzZFbGzy88dSas/2vrX/QueJf8Av5p3/wAeqquu2vh2bxfqF2rN
EusRJgSRx8mztQMtIyov1Zh6dSBVlfGjXNjpN5p/h/UryLUXkVQklurJsDHPzSBWB2kgqSpHIPQG
zj2F/tfWv+hc8S/9/NO/+PUf2vrX/QueJf8Av5p3/wAeq5qXiR9NurW2Oh6rczXURkjW3WJvmGNy
EmQBSAc5Py9gxJAM66rM/iGCw+yTx28tq86yyRqBIQU4B37lI3chk5z1GMEAzP7X1r/oXPEv/fzT
v/j1H9r61/0LniX/AL+ad/8AHqtWXiqO61FrWXStRtIxNLAtzOsXlPJGCWUbXLfdUkHGOCM54pLD
xUl/qttYf2Pqls1zE88M1wkao8S4+fhyRkso2kBhuGVHNC12Ahh1HUJ7mCK80XXraBpUzLcPZFFO
4bd3lyFsZwOB3rO0vUZ4IruLSdF8R3NouoXn71HsQrSfaJPM275A23zN4GRnAFdbf/8AHun/AF2i
/wDRi1ymh+I9N0TS2t71rkzT6nqjxx29nNcMVW9l3EiNWwBuHJ9aAsXP7X1r/oXPEv8A3807/wCP
Uf2vrX/QueJf+/mnf/Hq0k8T6RLfQWcF0Z554o54xBC8gMb52vuUEBTtPzE4HGcZGW2PivRdRllj
t7wjy42m3yxPEjxqcM6O4CyIOMspIGRzyKHoBn/2vrX/AELniX/v5p3/AMeo/tfWv+hc8S/9/NO/
+PVFZeOrK61y9iYyRabDBatHLNZzRO8k0joOHUEqSEwQMcnn02bjxHpVsLvzLli1pMtvKiQu7+Yy
hgiqoJclWBwoP6GgLa2Mv+19a/6FzxL/AN/NO/8Aj1H9r61/0LniX/v5p3/x6ptU8Y2mnLo0i215
NDqdyYAVtZt8WEZiTGELZyuNpAPU9jWPH4+uJdOuz9ljhvYNUW1RZASk0BuhB5i89RyCM8NgkYIy
0ru39f1qHS/9df8AI0v7X1r/AKFzxL/3807/AOPUf2vrX/QueJf+/mnf/Hq0ZfE+kwXF5BcTTW72
kTzyme1ljUxpjcyMygOBkZKk9R61HZ+L9Fv76KzguJ/Pldo1WS0mjG8Lv2ksoAO35gCckcjI5pbg
Uv7X1r/oXPEv/fzTv/j1c1rl/eT+L/DhvdJ1m3RRdgrO9oXZTGAxXy5CMKOTuwcfdyeK7jTvEmla
rdG2tJ5Wk2l0MlvJGkyggFo3ZQsi8jlCRyPUVz/jH/kbvDX/AFx1D/0QKyrfCvVfmjuy/wDjS/w1
P/SJEi38lr4g19NL0nXrtjeIbuS3ezEQl+zQ4C+bIrY2eXnjqTVn+19a/wChc8S/9/NO/wDj1c94
k0vT9Q0L4iS3tjbXMltcPJA80KuYm/s+2+ZSR8p4HIqe50s6V4m0CDw1DpmmN/Zl3KQbPMROYMko
jJycDnP51r6/1o3+hxW2/rt/mbX9r61/0LniX/v5p3/x6j+19a/6FzxL/wB/NO/+PVz8vj3xDd21
nPpekQsBpUOo3W8xlPn3fLukni8tRsPz4fGenHPW+JdXvNK0GO8tI4RcyXFvCFmBZV8yVEOdpGcB
j3ptNO3nb9BFL+19a/6FzxL/AN/NO/8Aj1H9r61/0LniX/v5p3/x6sy48V63bW19Y5tZ9Zt9QFpC
bexJSceSJidjzqEwpOSZMfL3JxVQ+PdXuYLK5tIbGKOWzsJ5FljaQlrmQx4UhwAFIDd8jjjOQJN7
eX47Dt/X4G9/a+tf9C54l/7+ad/8eo/tfWv+hc8S/wDfzTv/AI9WK/jLxFPDYWdhYQ3GpSyXizSx
QKUIt5fL+WOS4j65B/1hI9DnI6Z9fng8DP4gntE8+OwN21vHMrqSE3YDrkEe4zxS6XBJt8vUp/2v
rX/QueJf+/mnf/HqP7X1r/oXPEv/AH807/49XOeJtV16fTLzRri70qSUtp7vPDaP5bxTzmMxshlJ
/h5O7DKSMDrXUeLEl0r4d6sulvHZSWunyeSYEKLFtT+AKRt6cYPHHXFDTSbCKu0l1Iv7X1r/AKFz
xL/3807/AOPUf2vrX/QueJf+/mnf/Hq5m8vtf0fWNX1SO706a4stBtri5D2kgWcK87bV/e5Q4/iJ
fntWpP4v19/EU0NlpUbaba3MFtM0hiXcZAhz5jTqV/1gwvlPuIwD83Dtrb+t7C8/62T/AFNL+19a
/wChc8S/9/NO/wDj1H9r61/0LniX/v5p3/x6rXibUtSsptHtdLktIpr+8+ztLdQNKqKInfIVXQk/
IB171jWPinWtUvtMsLb+zkknF6s9wYnkQm3mWPcihxw2TwScZHJxyJXG1b+v67F/+19a/wChc8S/
9/NO/wDj1H9r61/0LniX/v5p3/x6q1r4o1OTVLWSQWR0+71G406O2SNhcRtEJPnL7sNnyj8u0YDj
k455u58Rau13ZeKHaxcNoF/eWdskDjygDEwWRt53npkgJ0NJf191x8rvb+t7HW/2vrX/AELniX/v
5p3/AMeo/tfWv+hc8S/9/NO/+PVX1Lxfd2d9e28UEEoitLKSI4PElxK0eW5+4MA4GD159GeKptet
fCoA1WzXUF1G1jM9tbyRrtaaMbSnmkj73I38r6Z4dne3y/GxK1/ryuW/7X1r/oXPEv8A3807/wCP
Uf2vrX/QueJf+/mnf/Hq6G1uUkLWzXVvNeQKouFi42sRkErklQeoBJ47muA8Q+IWh8cw3UMt6INJ
kjtZVjtJZLd/Ox5rPIq7FMYMTcsOjDuKXWwdLm9/a+tf9C54l/7+ad/8eo/tfWv+hc8S/wDfzTv/
AI9We/i/VBYzAx28d5ZqttdKlu0268eQJGiJ5iYVhlvmYYEiEkDJPMaxrl7rukTz31pbJcf2Jq0L
bEYPG8Uio2NsrJhsKcfNgrwxBoWv9f1/TRUY3dv6/r/I7f8AtfWv+hc8S/8AfzTv/j1H9r61/wBC
54l/7+ad/wDHqzX8WXsXia00uKJZdMkb7HJIbcIY5vs5lwHMuX4A6RYG772Riubt9Q1G3+FkelXc
tpcQ3fhqee3EEDRyQrHGow+XYPnzByAvI6HPDtv/AF3/AEVxQXNbzO2/tfWv+hc8S/8AfzTv/j1H
9r61/wBC54l/7+ad/wDHqym8V6+utva2WlxvptlPb2szyGJdxkVDu3tOpT/WDC+U+4jAPzcb/ibU
tSsptHtdLktIpr+8+ztLdQNKqKInfIVXQk/IB170WEtVcq/2vrX/AELniX/v5p3/AMeo/tfWv+hc
8S/9/NO/+PVQsfFOtapfaZYW39nJJOL1Z7gxPIhNvMse5FDjhsngk4yOTjma18UanJqlrJILI6fd
6jcadHbJGwuI2iEnzl92Gz5R+XaMBxyccodn/X9eRZ/tfWv+hc8S/wDfzTv/AI9R/a+tf9C54l/7
+ad/8erkrnxFq7Xdl4odrFw2gX95Z2yQOPKAMTBZG3neemSAnQ10upeL7uzvr23igglEVpZSRHB4
kuJWjy3P3BgHAwevPo7O39ef+QNW/r0/zLH9r61/0LniX/v5p3/x6j+19a/6FzxL/wB/NO/+PVU8
VTa9a+FQBqtmuoLqNrGZ7a3kjXa00Y2lPNJH3uRv5X0zxfsdV1eLxQ+m6xJaxRSKfsQjtGH2naql
3EnmsFwS3yMoOOhYAmktf69P8xPQj/tfWv8AoXPEv/fzTv8A49R/a+tf9C54l/7+ad/8eqt4m8WX
uj+ILS1s4lntle3W9VrcfuxNL5aESmVeTzhVjf7vO0HNVn8Wa5H4e1HV/s9pKI757C1t44yGLfaf
JWRmaQLjGPl+XJH3lzwLVX/r+tR2NL+19a/6FzxL/wB/NO/+PUf2vrX/AELniX/v5p3/AMeqLS9c
1+e3VNSj06xuo9RjtpPtLohljZQ2FSOaXbLyMKXORzxnFQfEG0+3S+G7b+z7LUN+p/8AHrfNthk/
cSn5jsf6/dPIFH9fl/mJfpf8/wDIuf2vrX/QueJf+/mnf/HqP7X1r/oXPEv/AH807/49VXUtel8O
Ra5ZWVlYW1vpOipe20KRlUDkygrgEDZ8g6AdTTW8VatGniO+aG0ay0VSwhWNvMnP2dJcby2EwWOT
tOQe2Mk7sdnov66f5lz+19a/6FzxL/3807/49R/a+tf9C54l/wC/mnf/AB6uX1XXNeu9Bni1vT1j
aK706eIxCJHcNcrx5aTzHHy8MSAeRjjNW9W8e6pa6BHqFpFBJd7Li5nsvsuTBFCQHSR2mQKysdpI
DEk/KhAyXb+vuCxu/wBr61/0LniX/v5p3/x6j+19a/6FzxL/AN/NO/8Aj1dDb3ttdM8cU0bSxqrS
RK4LR7hkbh2yPWrFIlO+pz2n395dajAl9pOs2igkxyXb2hQttPH7qRmzjd2xxWB/zb1/3Kn/ALaV
211/x8WX/XY/+i3rif8Am3r/ALlT/wBtKBjr7/j/AJ/981teFPv3n0j/APZqxb7/AI/5/wDfNbXh
T7959I//AGatZbGa3L1FFFIAooooAoatDp0lqsupSJDFEwZZmmMJjbpkOCCM5xwec4qKPSNLuLG3
EAYwrl4poLlwx3ck+Yrbjnqeeah1a4is9X066u5Fis0WVfNk+5HKdu0se3G8ZPrjvWJNreotY2bL
c2VpDLJPm7VxBE+18LtLrIBuGW98cH11jGTSszCcoqT5l/n/AMMdTJpdnJ9mPlMhtuITFI0ZUccf
KRkcDg8HFU7G10SW7kaynSaWEkNHHdtIsBOQcJuIQ9RwB3FZdw0japodzqN+LXzLWRJGTCI7kp8o
LrkFvTg8cY5pn9rvZaTNZ6TcW15FaxRiO7iYbYk3BSHIDLuVfmzj3K4HLUJW3/q4nON9v6sbo0HT
hE8ZjmYu4cytcSNLuAwCJC24YGeh7n1NSLYWFiI7gqIxbI4EryH5VYgsWJPOSMknmuft9R1SaGzj
GpQSLPe+SLiBlmynlsx+by1UkEcELgYwc4NGqz6pHY6jYvdMxtYZLhrh4Y282IqdisCuz724HA6J
2zRySvZsanC11E3X0XTp7r7WYmLuyyMFmcRuw6MyA7WPA5IPQelTf2ZZmzltPJ/cSuzuu4/eJ3Eg
5yDnnjp2rIi1B21YQXGpCzKmIW9sAn+kqVBJwRuPJI+UjGKqWupalda7Jbz3dskfnSRyWZm+dYhn
DbBHuGQAdxfbz7gUuSfcFOG9tzUt7LQ72GWztp0nMUoklMV2zSpJ0BZw28HAxyegx0pknhexaa22
NPHBCsoMaTyKzmQgklw27qDwc5zWZ/a72WkzWek3FteRWsUYju4mG2JNwUhyAy7lX5s49yuBy+HV
b8aWJJtStzbtdCNr+KRZBFHtyTvMaofmwuduBnB5FVyz3TJUoPRrX+mbv9jWPnW8nlOBbhRFEJXE
SbehEeduR64q+TgZNc7JrCWc+nvJqsclhLFMDcybFWRwV2/MABnG7pgHFVdJvtS1UwrJqEkSf2dD
cMY4o9zOxcHqpGOOmOw98w4Sau3/AFr/AJFqcE7Jf1p/mdTFLHPEssUiyRuMq6HII9QafXE2zsz+
GrmW/NkHsnQOqxIhc7MKAVxk+gx04xzW5ot9e308q3GVFoogmGzG+cH5mHHTG0jH9/2olTt/Xnb+
vUI1U9Lf1a/9ehtUUUVmbBRRRQAUUUUAFFFFAGX4k/5FbV/+vKb/ANANWtH/AOSeWH/YKj/9FCqv
iT/kVtX/AOvKb/0A1a0f/knlh/2Co/8A0UKwl/F+R6Ef9x/7f/QoWemy6lq3iZYdTvdOki1qOQS2
ZTc3+g242sHVlZfmzgjqAe1abeGkGl2lpBqV9bzW0rTJeR+UZS77t5IZCnzb2424GeMYFR+Hv+Q5
4s/7Csf/AKRWtdBVnHcwZfDUjXVhNDr2rQfYovKVA0MnmA43F2kjZiTgZO4dOMVLdaDPc67Fqi67
qUHlAqttGlv5W07dy/NEXw2wZ+bPoRWzRR5gYCeFgs0LtrOoyLFeS3flsINrGQEFDiPO3DNjBB+Y
8nAxS0Pw7qtn4ja9v7ppbW2gktrJXuxKwjZkPIEMe3iNepkY/wB7jnrKKFpsD1Kt/wD8e6f9dov/
AEYtcBpmk63eX1pe6RPbWqQ3OtxS3FxB5wUvfMVAQSIcnaTnkDHI5rv7/wD490/67Rf+jFrJ8G/8
gO5/7Cupf+ls1A07DdE8JwaHeebFcvLENOg09VdBuxEXO4sO539AB0rPg8CO9n9g1DVPtFlBp0um
2iw2/lSRwyBQS7FmDuAigEBR14OeOyopt3/r1/zYJtO5xUngnUbw3s1/rVrJdTRWscDwWDRrEbeU
yIWUytvyTyAV46YqaPwdfB7i9l1a2fVX1Bb+KYWTLDG4hEJUx+ZlgVz/ABg5Ptz19FF3/X9eQv6/
QwNR0PUNQtNNdtTt11SwuPtCTm0JhZirIQYxIDja5x8+cgZJ70X8CWtxpMNpc3RaeHU21GK4jTYV
LT+aUxk5U9CM84B6gY62ii4eX9df82cBP8NPOu9SuBqNusl7BdwNN9izMyT4P7yTflyhAC9AFGMd
61B4LX+1BeNfbl/tBb0x+VjIFt5GzO7/AIFn8Md66uil0sO7/P8AE5Lwt4FtvDN2JYk0srFCYIXt
tLjgnZSRzLKCS7YA5UIDkkg8YreMf+Ru8Nf9cdQ/9ECu2rifGP8AyN3hr/rjqH/ogVnWd4r1X5o7
cu/jS/w1P/SJFefUpbPVtesYdMtdRfU9dW08m7mMcWP7Ogc7iEfIwhGNveuqSeyRRPqY022v7S2L
TBZlcW8TdfnZVIQ7OpAB2+1cbqPh+fX9W1gQ2OnX6WniGOeW01BysUq/2dAuCQj8gsDyvareu+Gv
EGoLqLWdvpUb6ppI0+eN7uQLbMpkwUIi+cYk6EJjFaL+vuOPS6/rr/kbslv4TubyyspIdFlubLP2
SBliZ4NoVv3a9VwNh4xgYPpUsmu+Gr/Spb2TVdJudNglXzJ2uI3hjkBBXLZwGB2kd84rLTwhM9l4
qt5ZoY21pRGksYLFF+zrF8wOOjBjgHoaxtd0PXnsrrUZLCyN9JJp0EVnZSySIVhuN+9n8sED5z0U
7Qucns+tr9vxEtr/ANf1v/TOnnm8IX+m/bbiXQ7iwuZvN8+RonilkRT8248Myqh56gL7UofwlHeW
9gG0Rbq6RJILcGIPMoYujKvVgG3MCO+SKyIvCepXOpW+pX4sI5TrA1Ge3hkZ0RVtzCoVioLtkKxJ
Vf05beeCri48UXV4VSezu7qG6d5NTuozEYwg2/Z0Ijk/1YIYkYzyG24Ilqv67f18hP8Ar7/6+80r
y48D3lld217N4entLKcyXUUzQslvKzEFnB4Vixbk4JJNaUuv6FbxWfnatp0Ud6ALTfcoonBxjy8n
5uo6Z6iuaPhvWdt/CLOyGntIs1pZDVZhtm8wuZhKId8R6fIu5c9MDO6pfeCNa1CSO41CeHULm5sE
s71jqNzaIpBck7IAomUiQ5UiPO3gruwEtV/X9f19z6/1/X9ff2VroGjWNq1raaRYW9u0gmaGK2RE
LgghiAMbgQCD14FYl942s4f+EntXtC9xo0LSmGRsLdIIlc7TjtuAI5xlSfvCtuwe8/tC8t5I0FhA
sSWz7WVi207wck7gPlww9SOSDXNax4Gl1iz8SxPcxwTajOZbOeMktFm3SIhhjocMCOeD64wflb/L
9BwtdXNS3j8I2DxaOkOiWc97AFGnhYkaWM7jt8vgsuS/GMct71cFv4eu9QtNTEOlzXqxMba6CxtI
I14bY/XaN2Dg4G73rmpfA9y/iCa4cRz2lzcQXMjvqd1H5bRqg2/Z0Ijk5jBDMRjPIbbgre/D57ie
8mi1J4WedhbbSR5NvKSbhPqxdyD22x/3ab3/AK/r/gErbU1NSi8K+MLyz0+5vtO1CW0cXgsRNFLv
BQgF4znK4kBB/wB05q1aal4VSzN5Z3ujLa6ahgM8MsQS1U4ym4HCDheOOgrJu/C+p3WoapbWzwab
pF/byxzeTcvK0rsior+WyARFQD91yG7jPIsXOm+I7zw9NaCPT9PulEMcf2O9kHmxq2WUy+UrRZGQ
NqkrkkGl6f1/X3/kHqWXvvB1hcLr8l1oVvPeR5XUWkhRp0G0cSdWX7o646e1XbTQdBhupdRs9J01
Li6U+Zcw2yB5lbk5YDLA9feua0DwbqGmXtnLcSWzRW6X6gCeSVv9IkSRfmcZOMMCScng9yBs+GdM
1bRtN0vTLl7J7S006OF2jLmQzLgcZAGzaPTOadl/Xz/r5gy7aeHND0+CeCy0XTraG4Ty5o4bVEWR
eflYAYI5PB9TUkOh6Rb6W+lwaXZRafICHtEt0WJs9coBg5+lX6KQFWz02w04EWNlbWwKqhEESplV
GFHA6AcD0pzWNm1tNbNawGCcsZYjGNsm7724dDnvnrViigCrcabY3dtPbXNlbTQXBBmikiVlkwAB
uBGDwB19BTIdG0u2IMGm2cRCsoKQKvDABhwOhCrn12j0q7RQBmReHNDhmSaLRtOjlRUVXS1QMqp9
0A44A7elLp/h7RdJEw03R9PsxOMTfZrZI/MHPDbQM9T19a0qKAM5PD+ixXVrdR6RYJcWkYit5ltk
DwoAQFQ4yo5PA9TUWueHNN8RCyTVIFuIbSfz1gkRXjkbYy4dWBBHzE/UCtaigCtDp1jbfZ/IsreL
7NGYoNkSr5SHGVXA+UfKOBxwPSo49H0yLVJNUj060TUJV2SXawKJXXjgvjJHA79hV2igDNg8PaJa
3s97b6Pp8N3OGE08dsiySBjltzAZOT1z1pLTw5oenwTwWWi6dbQ3CeXNHDaoiyLz8rADBHJ4Pqa0
6KAKEOh6Rb6W+lwaXZRafICHtEt0WJs9coBg5+lMsPDuiaXdG60/R9PtLhk8sy29qkblOPlyADjg
cewrSooAo3ei6Vf3K3N5plnczqhjWWaBXYKeSoJGce1S/wBn2X2Sa0+x2/2abeZYfKXZJuJLblxg
5JOc9c1ZooAowaLpVraQWlvplnDbW8nmwwxwKqRvkncqgYByTyPWnalpOm6xbrb6pp9pfQq29Y7q
FZVDdMgMCM8mrlFAGTN4X8PXMVtFPoWmSx2yFIEktI2ESnqFBHyj2FaEVpbQNK0NvFGZiGlKIBvI
AUFsdeABz2AqaigDOtdA0axtWtbTSLC3t2kEzQxWyIhcEEMQBjcCAQevAon0DRrqfz7jSbCaXzDL
5klsjNv2hd2SOu0AZ9ABWjRQBTtNMtbG4mngjCvKqR8KAERBhUUADCjJ/M+2LlFFAFW6/wCPiy/6
7H/0W9cT/wA29f8Acqf+2ldtdf8AHxZf9dj/AOi3rif+bev+5U/9tKAGancwQ6jMss0aMWJwzAGt
3wi6Sfa3jdXUhMFTkH71YepXfkahMv8AaKW2WJ2Muc+/3x/LtW54Sk843knnifIj/eAYB+97n+da
y+EzjuaFFFFIClq9/wD2Vol/qPleb9kt5J/L3bd+1S2M4OM464qm9z4jSdIDp2hiZ0Z0jOryBmVS
AxA+z5IBZcntuHrS+LIpZ/BuuQwRPLNJp9wsccalmdjGwAAHJJPaue1O60e88U22up/wk4khidDE
tjqSoxLREEKFChf3XKAYfOWyQKljSR0+h6nJqulm6uII7eVJ54JI0lMihopXjJDFVyDsz0HWprLV
bPUGYWzuwAyGaJ1Vx6qSAGHuuRyPUVhaDbXN34KvIRHNbzXVxftGLiJomAkuJWQlWAYZDA8jvU11
eC70cWscepWMkapv22c3y7SPkBTBYHkZQnjnPrpCN0ZzlyvTzNO71qxsro288kgkCCRtsDsqKSRu
ZgCFHB5JHSr4IYAggg8giuStrPUdRvHIR7CCfT44pRcRvM+Nz5AdiPmwc/MCeRkdqtJZX0baw1u9
0JIBssEaRhH/AKlRwPutz65AI+tW4RWl9SIzk3tp/wAD+ux0lQw3UM808UT7ngYJIMEbSQD+PBFc
wpvhaX39n/2n9n8uHP2nzPN3bj5uzf8ANnZjpxn7vNQ2gmtLiW6totTFn/aKu/mRztI8fk7SSrDe
w3Y9entR7LfX+tBe120/rU7OmNNEkqxtKiyMpZVLAEgdTj0GR+dcrHJeS28Ml8NTWxa4uC4jWYTf
f/dcJ84Xbn26Zqzf2qNq+kXc0d+9usDxkr5rMGOwqHVPXBzkY9e1L2eupXtOxs2WpW2ohmtjKyDB
DtC6KwPQqzABh7jNW65KSTUBp1za6SLwWkaR+XJPbOkkY3AMiA7WcBBx3/2icYS3ttReGziF3fvb
ve/M3lzQsI/LbIO92k27u7Ec9O1N01vclVXs1c6m5uIrS2luJ22RRKXdsE4A5JwKkVg6hlOQRkGu
U1Gx1NLa+s4Zr8wW8T3FvKkzmR2ZSFj3Z3NtbccZ/udatp5v9r/6cdR3Zj+y+R5vl7do3b9vyZ3b
s7+3SlyK25XtHfVHQnkVDa2sNnD5UClVyWOWLEk9SSeSfc1zFrFqra7I9xd3SMJpNyLbSmPyuduG
L+X02/dXdn8TWj4aMq200Mi3biNgBc3PnKZjjkhJfmXHoPl9O4A4WV7gql5Wa7m5RRRWZqFFFFAB
RRRQAUUUUAZfiT/kVtX/AOvKb/0A1a0f/knlh/2Co/8A0UKq+JP+RW1f/rym/wDQDVrR/wDknlh/
2Co//RQrCX8X5HoR/wBx/wC3/wBBujs1nrfiYzwXKrPqSSRMLdyrr9kt1yCBgjcrD6g1sfb4f7lz
/wCA0n/xNczaaPDrfiDxLJe3mq/6PqEcMKQarcwIifZLd8BI5FX7zsenetD/AIQ3S/8An61z/wAH
t7/8eqzjNb7fD/cuf/AaT/4mj7fD/cuf/AaT/wCJrJ/4Q3S/+frXP/B7e/8Ax6oz4V0VbhLdtQ1k
TupdYj4gvdzKCASB52SASMn3HrQBtfb4f7lz/wCA0n/xNH2+H+5c/wDgNJ/8TWT/AMIbpf8Az9a5
/wCD29/+PUf8Ibpf/P1rn/g9vf8A49QBoXNyk8aRxxzljNGeYHAwHUnkjHQVmeF5DY6Vcw3NvdRy
f2nfuAbaTlWu5WUj5eQVIIPcEU//AIRyy0ySG7t7nVjKk0YAm1e6mQgsFOUeQqeCeorL0HQbbWbO
7vb291lp21O/T93rF3EoVLqVFAVJAoAVQMADpQB1X2+H+5c/+A0n/wATR9vh/uXP/gNJ/wDE1k/8
Ibpf/P1rn/g9vf8A49R/whul/wDP1rn/AIPb3/49QBrfb4f7lz/4DSf/ABNH2+H+5c/+A0n/AMTW
MfCejCdYDf6yJmUusZ1+93FRgEged0GR+YpsHhbRLpC9vqGsTIrshaPxBesAynDDibqCCCOxFAG3
9vh/uXP/AIDSf/E0fb4f7lz/AOA0n/xNZP8Awhul/wDP1rn/AIPb3/49R/whul/8/Wuf+D29/wDj
1AGt9vh/uXP/AIDSf/E0fb4f7lz/AOA0n/xNZP8Awhul/wDP1rn/AIPb3/49R/whul/8/Wuf+D29
/wDj1AGt9vh/uXP/AIDSf/E1x3iudbjxh4ZWOOYt5V+oBhcEkwgDAI5rb/4Q3S/+frXP/B7e/wDx
6uW8RaFaab4t8OfZrjUyWS8k3TancysCkQZdpeQlRnqBgMODkcVlW+H5r80d2Xfxn/gqf+kSOn0d
ms9b8TGeC5VZ9SSSJhbuVdfsluuQQMEblYfUGtj7fD/cuf8AwGk/+Jrz/XRdJN4t1fy7y8j0275h
Gv3discS2dvJhFiypJZnPIHJ60ONM0u9sLfxHNdaWt5BLMJ/+EuvWiQIYwAWdk5PmHjtt7541Wpx
WPQPt8P9y5/8BpP/AImj7fD/AHLn/wABpP8A4muau9J8K2DWq3mvX9u12cWwm8S3aGbp9zM3zdR0
9RVqfwtolrGJLjUNYhQsqBpPEF6o3MQFGTN1JIA9SaBG39vh/uXP/gNJ/wDE0fb4f7lz/wCA0n/x
Ncxe6Z4S01JHvvEF9apHIIXafxNdIFcruCnM/DY5x1xzT5NH8LQ6jDp0uu6gl9Ou6G2bxLdiWQc8
qvnZI4PT0NAHSfb4f7lz/wCA0n/xNH2+H+5c/wDgNJ/8TXLtp3hFHkVvEV6rRf6wHxPdAp8+zn9/
x8/y/XjrTTZ+DRpY1M+JboaeX8sXX/CUXXlFv7u/z8Z9s0AdV9vh/uXP/gNJ/wDE0fb4f7lz/wCA
0n/xNczcaV4UtHiS51++heVd8ayeJrtS64JyMz8jAJ/A0ybT/B9tpsOpT+I7yKwmO2K6fxPdLFIe
eFcz4PQ9D2NAHU/b4f7lz/4DSf8AxNH2+H+5c/8AgNJ/8TWQvg/SXQOl5rbKwyCNevSCP+/1L/wh
ul/8/Wuf+D29/wDj1AGt9vh/uXP/AIDSf/E0fb4f7lz/AOA0n/xNZP8Awhul/wDP1rn/AIPb3/49
R/whul/8/Wuf+D29/wDj1AGt9vh/uXP/AIDSf/E0fb4f7lz/AOA0n/xNZP8Awhul/wDP1rn/AIPb
3/49R/whul/8/Wuf+D29/wDj1AGt9vh/uXP/AIDSf/E0fb4f7lz/AOA0n/xNZP8Awhul/wDP1rn/
AIPb3/49R/whul/8/Wuf+D29/wDj1AGt9vh/uXP/AIDSf/E0fb4f7lz/AOA0n/xNZP8Awhul/wDP
1rn/AIPb3/49R/whul/8/Wuf+D29/wDj1AGt9vh/uXP/AIDSf/E0fb4f7lz/AOA0n/xNZP8Awhul
/wDP1rn/AIPb3/49R/whul/8/Wuf+D29/wDj1AGt9vh/uXP/AIDSf/E0fb4f7lz/AOA0n/xNZP8A
whul/wDP1rn/AIPb3/49R/whul/8/Wuf+D29/wDj1AGt9vh/uXP/AIDSf/E0fb4f7lz/AOA0n/xN
ZP8Awhul/wDP1rn/AIPb3/49R/whul/8/Wuf+D29/wDj1AGt9vh/uXP/AIDSf/E0fb4f7lz/AOA0
n/xNZP8Awhul/wDP1rn/AIPb3/49R/whul/8/Wuf+D29/wDj1AGt9vh/uXP/AIDSf/E0fb4f7lz/
AOA0n/xNZP8Awhul/wDP1rn/AIPb3/49R/whul/8/Wuf+D29/wDj1AGt9vh/uXP/AIDSf/E0fb4f
7lz/AOA0n/xNZP8Awhul/wDP1rn/AIPb3/49R/whul/8/Wuf+D29/wDj1AGt9vh/uXP/AIDSf/E0
fb4f7lz/AOA0n/xNZP8Awhul/wDP1rn/AIPb3/49R/whul/8/Wuf+D29/wDj1AGt9vh/uXP/AIDS
f/E0fb4f7lz/AOA0n/xNZP8Awhul/wDP1rn/AIPb3/49R/whul/8/Wuf+D29/wDj1AGt9vh/uXP/
AIDSf/E0fb4f7lz/AOA0n/xNZP8Awhul/wDP1rn/AIPb3/49R/whul/8/Wuf+D29/wDj1AGt9vh/
uXP/AIDSf/E0fb4f7lz/AOA0n/xNZP8Awhul/wDP1rn/AIPb3/49R/whul/8/Wuf+D29/wDj1AGt
9vh/uXP/AIDSf/E0fb4f7lz/AOA0n/xNZP8Awhul/wDP1rn/AIPb3/49R/whul/8/Wuf+D29/wDj
1AGk863F1aCOOb5ZSzFoXUAbGHUgdyK43/m3r/uVP/bSukttCtNI1C1mtbjU2aRzGy3Op3NwpGxj
92SRhnIHOM1zf/NvX/cqf+2lAEt5LIl7OEkdRvPAOK2PCzM8t6zMWJEfJOf71Yl9/wAf8/8Avmtr
wp9+8+kf/s1ay2M1uN16+l0vw9qeoQBGltbSWdA4JUsqFhnBHGR61Ulj16K/hsW17SFuZopJo0Ok
SnKIUDHP2jHBkT8/Y1N4mtLi/wDCmsWdpH5lzcWM0USZA3OyEAZPA5I61zuo2kOoeIYddf4f37X8
SkCV1sCWbKFXY+dkuvlgKc8An1qHcasbek6xdy+HLi/vYhc3FtPdROtnFt8wQzSRgqjMcEhAcbjy
aW68U6da2l7eHzZbSztRdSzxqCm0jIUc8sRzj0IyRkZr6FHqem+E52bTX/tBri7uI7N5UB/eXEjo
GYMVHDKTgnHPWsc+GNRtNObQYoI57G6u4bqe5jWOMDMgedGTIJB28Yzw208KMmuwab/1/X9dDqH1
+wTVbTTfMLXF1bPdRbcYKLtz36ndx9DU+lajDrGk2mpW6usN1EsqLIAGAIyM4JGfxri7LwfqOnXs
V7tWaW0u1t7UIQu2wCOqqcnsZSTjk7R7Vt+DDqFpoNhpV/o15ZyWlqkbTSyQNG7KACF2SM3vyBVK
zX9ev+XzE9P6/r/hrHS1S1TU4dItFubhZGRpooQIwCd0jhB1I4ywz7VylzoWoHxHrEulaebWS+tp
VbVLlYdySFFVPJdGMoXIyVccYyCMYLJvD32vw3JY2fhb+zS91aNPE7QD7QElVnY7HIPyg8sdx9Ol
Ja2+X5jsju6K851LwfeC3v7Szsnj0n+1FuEsbMW+JYfIVSEjlBiwJPmKsADgnrior7wZqEuj21tD
ZTSiHT70Qx3MsJaGd2RoQAgVFIwcbRtTGAcYJP6/C/8AwB8utrnpdFec3nhXUBY32nxaTEdOn1JJ
vJiitnYJ5Cguiy5jU+YDkkE4LEAk5qXSNC1O01PQbmfRnmv4LWK2u7u7+zyRxKisC0ThvNVznsCp
B5AOSH/wPyJ6HoNFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFAGX4k/5FbV/wDrym/9ANWtH/5J
5Yf9gqP/ANFCqviT/kVtX/68pv8A0A1a0f8A5J5Yf9gqP/0UKwl/F+R6Ef8Acf8At/8AQ5zU3lB8
UxRS38Jm1yFDLZWs85QCxt2+ZYGWUKduMqw5Izxmm/2WT4d8PXWrv4gnFvcTea8Et4s+xhJsYxxt
5oH3AA25lBwx+8T0ejs1nrfiYzwXKrPqSSRMLdyrr9kt1yCBgjcrD6g1sfb4f7lz/wCA0n/xNX0O
RnH6u0F1qmjLL/wlVlFLalZo7YXbYBx5ayPFuVXzklgwbjDNtODfnvYbDxrap/xPZS1s0E7C2u5L
cuTH5Z+VTCDjflhjHOSK6H7fD/cuf/AaT/4mj7fD/cuf/AaT/wCJp31EcVp5ktdXjuIJPETzT6lc
wMl0l28KxbWKfK4KKu7y8P7kA4BAXw/ubxdYIk/iL5bGeS8TUXnWNrgNGuVV8K33n4jzGMgjHFdp
9vh/uXP/AIDSf/E1Ss7XRdPuri6stKS2uLk7p5YdPZHlOc5YhctySefWlHT+v69fWwMu3/8Ax7p/
12i/9GLXBab4g/sOe1W8v4bPTLi81oM85VEacXz+WNzfxYL4GeeeuK7e5uUnjSOOOcsZozzA4GA6
k8kY6CszwvIbHSrmG5t7qOT+079wDbScq13KykfLyCpBB7gikxp2OX0XxXfzXfhx77W/tEmoWEJG
nWzQCV5mRmZ5Yym8RnA+ZGABHK4yaz7DxZ4nk0XWL6TV7B54dLnuJLaKYSyWM6jKqUFunlYO4bZX
cnbxnaxPqP2+H+5c/wDgNJ/8TR9vh/uXP/gNJ/8AE1Ter+YJ2d/Q4bUtN1G48WeHnXVJJNTSwu7m
GWQKqB90H7sqgGYyCV5y2DnOQCOfn8R6vo3hdRaedpuoSXepXXk3EkSK5WZj5WDHIZHO4YVNuRk7
hxXrP2+H+5c/+A0n/wATR9vh/uXP/gNJ/wDE0X7f1rcE9LM4CfxBrF9rzR22sy29pLqC2ca28ULB
UazE+8MyNltwwM5GCeDwRnXXjDxJcWmjyR6nYae0+lQXMbXM6xfbZ2zuVU8iQyYwv7uMo3z8HkY9
Q+3w/wBy5/8AAaT/AOJo+3w/3Ln/AMBpP/iaNPyC5YjLmJDIFD7Ru29M98Zp1Vft8P8Acuf/AAGk
/wDiaPt8P9y5/wDAaT/4mkJFquJ8Y/8AI3eGv+uOof8AogV1n2+H+5c/+A0n/wATXHeK51uPGHhl
Y45i3lX6gGFwSTCAMAjmsq3w/Nfmjuy7+M/8FT/0iRO+mzaxafEDTLdo1mu7swo0hIUM1hbAZwCc
c+latxoc83iDTL/dCYrWwntnBJ3FpDHgjjp8hz9RTNHZrPW/ExnguVWfUkkiYW7lXX7JbrkEDBG5
WH1BrY+3w/3Ln/wGk/8Aia1/r9P1OK7/AK/ryPPh8Or9LKxgYwXI/sqHTrlf7TuraOPZuywWLHnK
d5+RtnT7w3HHYeI9Hn1Tw/8AYrJolnilgmhEzEIxikVwrEAkA7cZwSM55rR+3w/3Ln/wGk/+Jo+3
w/3Ln/wGk/8AiabbevzEcXN4Z8RSDUb5bfTY9Vub37VbPFqUqC0PkLFu3eSfM5U5Vl2kHmnSeCL2
XxBLdXDRXcF1cQXM8zajdQ7XjVAQLZD5b8xgglhtzyG289l9vh/uXP8A4DSf/E0fb4f7lz/4DSf/
ABNCdndf1YDl/wDhD7oeGp9ODWvnzaz/AGgzZO0p9qEuDxndsAHTGe+OaZqPhbWZLnU3s7qNYL3U
lungS8ltjJEIFjIMka7lO9Q2F+8AASMmur+3w/3Ln/wGk/8AiaPt8P8Acuf/AAGk/wDiaXS39dP8
kNt/1/XmcHbeAdVis7eGSeyLw2unW4YO5z9muDIx5XjK4wPXjtkyz+B9TBtrhHjuJoLi+byV1O4s
h5c83mAiSIbsjABUgg568DPb/b4f7lz/AOA0n/xNH2+H+5c/+A0n/wATTbb38/xC/wDXpoUdG069
0mOz0+MWY0u2sliAQyeZ5oOONzN8mPUk571sVV+3w/3Ln/wGk/8AiaPt8P8Acuf/AAGk/wDiaG7i
LVFVft8P9y5/8BpP/iaPt8P9y5/8BpP/AImkBaoqr9vh/uXP/gNJ/wDE0fb4f7lz/wCA0n/xNAFq
iqv2+H+5c/8AgNJ/8TR9vh/uXP8A4DSf/E0AWqKq/b4f7lz/AOA0n/xNH2+H+5c/+A0n/wATQBao
qr9vh/uXP/gNJ/8AE0fb4f7lz/4DSf8AxNAFqiqv2+H+5c/+A0n/AMTR9vh/uXP/AIDSf/E0AWqK
q/b4f7lz/wCA0n/xNH2+H+5c/wDgNJ/8TQBaoqr9vh/uXP8A4DSf/E0fb4f7lz/4DSf/ABNAFqiq
v2+H+5c/+A0n/wATR9vh/uXP/gNJ/wDE0AWqKq/b4f7lz/4DSf8AxNH2+H+5c/8AgNJ/8TQBaoqr
9vh/uXP/AIDSf/E0fb4f7lz/AOA0n/xNAFqiqv2+H+5c/wDgNJ/8TR9vh/uXP/gNJ/8AE0AWqKq/
b4f7lz/4DSf/ABNH2+H+5c/+A0n/AMTQBaoqr9vh/uXP/gNJ/wDE0fb4f7lz/wCA0n/xNAFqiqv2
+H+5c/8AgNJ/8TR9vh/uXP8A4DSf/E0AF1/x8WX/AF2P/ot64n/m3r/uVP8A20rsnnW4urQRxzfL
KWYtC6gDYw6kDuRXG/8ANvX/AHKn/tpQA6+/4/5/981teFPv3n0j/wDZqxb7/j/n/wB81teFPv3n
0j/9mrWWxmty9RRRSAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiig
AooooAy/En/Irav/ANeU3/oBq1o//JPLD/sFR/8AooVV8Sf8itq//XlN/wCgGrWj/wDJPLD/ALBU
f/ooVhL+L8j0I/7j/wBv/oZ9po8Ot+IPEsl7ear/AKPqEcMKQarcwIifZLd8BI5FX7zsenetD/hD
dL/5+tc/8Ht7/wDHq5zU3lB8UxRS38Jm1yFDLZWs85QCxt2+ZYGWUKduMqw5Izxmm/2WT4d8PXWr
v4gnFvcTea8Et4s+xhJsYxxt5oH3AA25lBwx+8TfS5yNHS/8Ibpf/P1rn/g9vf8A49UZ8K6Ktwlu
2oayJ3UusR8QXu5lBAJA87JAJGT7j1rJ1doLrVNGWX/hKrKKW1KzR2wu2wDjy1keLcqvnJLBg3GG
bacG/Pew2HjW1T/ieylrZoJ2FtdyW5cmPyz8qmEHG/LDGOckU0tbCLf/AAhul/8AP1rn/g9vf/j1
H/CG6X/z9a5/4Pb3/wCPVgaeZLXV47iCTxE80+pXMDJdJdvCsW1inyuCiru8vD+5AOAQF8P7m8XW
CJP4i+WxnkvE1F51ja4DRrlVfCt95+I8xjIIxxSjr/Xz/rzaBm9/wjllpkkN3b3OrGVJowBNq91M
hBYKco8hU8E9RWXoOg22s2d3e3t7rLTtqd+n7vWLuJQqXUqKAqSBQAqgYAHSuqv/APj3T/rtF/6M
WvNP7bOmyWlpP4mOg2M13rUrzDyBvkS+bauZUYdGbgcmi40rna/8Ibpf/P1rn/g9vf8A49R/whul
/wDP1rn/AIPb3/49XHah401qCbQHkm+xXDW1pPfWszxxLKssgWQpG0bSHaNxY70CcZzyKlfxLeCP
W7b/AIS60F1BMjm6+02otbeIzEeUH8o+XMVGNsofpwTyQ2rfj+Av6+86z/hDdL/5+tc/8Ht7/wDH
qP8AhDdL/wCfrXP/AAe3v/x6uc/4SDxFcwWZ0X7TdR39rFd20l7FGrKsRJmVii7cyDywCOP3hK8A
UXXiO/eDTrrUdbfw/p2oi4uEuXjhUxgFBBCTKhUFkLOQRuJBAIxil/X9fj93oCVzo/8AhDdL/wCf
rXP/AAe3v/x6om8LaIlyls2oaws8is6RHxBehmUYyQPOyQMjP1FZmg6rr2s61Al5dSWix6RaXs1r
HCilpnMgZTvUsqnaMjORgYI5zkeGNWbWPHGj3NzrX2u/bTbprrT8xD+z3Lw5i2qodcdP3hJ+X61X
L73L6/hf/Idv0/E6/wD4Q3S/+frXP/B7e/8Ax6j/AIQ3S/8An61z/wAHt7/8eroKKkRz/wDwhul/
8/Wuf+D29/8Aj1ct4i0K003xb4c+zXGpksl5Jum1O5lYFIgy7S8hKjPUDAYcHI4r0muJ8Y/8jd4a
/wCuOof+iBWVb4fmvzR3Zd/Gf+Cp/wCkSMvXRdJN4t1fy7y8j0275hGv3discS2dvJhFiypJZnPI
HJ60ONM0u9sLfxHNdaWt5BLMJ/8AhLr1okCGMAFnZOT5h47be+eNZ9Nm1i0+IGmW7RrNd3ZhRpCQ
oZrC2AzgE459K1bjQ55vEGmX+6ExWthPbOCTuLSGPBHHT5Dn6itdv68n/wAA4tNP67f8Ez7vSfCt
g1qt5r1/btdnFsJvEt2hm6fczN83UdPUVan8LaJaxiS41DWIULKgaTxBeqNzEBRkzdSSAPUmuZHw
6v0srGBjBcj+yodOuV/tO6to49m7LBYsecp3n5G2dPvDccdh4j0efVPD/wBismiWeKWCaETMQjGK
RXCsQCQDtxnBIznmm0l9/wCAjJvdM8Jaakj33iC+tUjkELtP4mukCuV3BTmfhsc4645p8mj+FodR
h06XXdQS+nXdDbN4luxLIOeVXzskcHp6Gs+bwz4ikGo3y2+mx6rc3v2q2eLUpUFofIWLdu8k+Zyp
yrLtIPNOk8EXsviCW6uGiu4Lq4guZ5m1G6h2vGqAgWyHy35jBBLDbnkNt5EtdQfkWJNL8PNcpbWW
papeXHmBZYovEl4WiTcVZ2AmJADKQc45GMirGnaJ4Z1iF5tM1rUb6JG2M9t4ku5VVuuCVmODyOKv
+H9Dk0jSb62mWCSS5vLm4IUna4kkZlDEjrtIB4P403wrpuq6XaT2+oGGO2VlWztYrl7n7PGFAI81
0RmBOcAg49SMAJA99DNtdM8JX2oS6faeIb24vYc+ZbReJrp5EwcHKifIweDmmLZ+DXsri9TxNdNa
2zBJ5x4ouikTHgBm8/Cn2NUdA0PXLq4hNxbW9lZ2Or313FK7ObiUu0yr+7KAKpEhbO5sgDjniOx8
F65B9rnvlttQuZ4bdSZdYuVYzRSMwlEnlkx53khEUKuMcgk0dhy0bt/Wv9M0jZeDVlhibxLdiSeL
z4UPii6zJHgneo8/lcAnI44NW28PeHUSR31fVFSOITOx8RXgCxnOHP77hTg4PTg1WtND8SR6np1z
PNZmYxImqXa3DE3SqG/d+R5QTqwxICh9sfLVez+Hr2s1pIdRdvLmVJhk/vLSMhoIv+AlEye+6T+9
T66/1/X+fleen9f1/S8y6mjeF5NTl02PXNQe/iXfJar4kuzKi8clPOyByOcdxUX9n+EPsk93/wAJ
HefZrcIZpv8AhJ7rZGHwVLN5+BnIxnrmkt/C2qJqVvE/2EWFrqFzqEdysjGeVpRJ8jJtwoHmn5tx
yFHAzwsHhTULDwp4bsrX7HJe6M8crQvIyQzsEZW+cKSOXLA7TyOnOQun3f8AB+4ppX/r+tSLw3pe
jeJNKbULe41kQ/aJoY2j8RXsiyKkjIHDCXGDtz+PU1r/APCG6X/z9a5/4Pb3/wCPVD4b0vXNJtre
C4GnCOW6u7i8WOR5CvmSM6CNiq5wWwcge1dNTYurOf8A+EN0v/n61z/we3v/AMeo/wCEN0v/AJ+t
c/8AB7e//Hq6CikBz/8Awhul/wDP1rn/AIPb3/49R/whul/8/Wuf+D29/wDj1dBRQBz/APwhul/8
/Wuf+D29/wDj1H/CG6X/AM/Wuf8Ag9vf/j1dBRQBz/8Awhul/wDP1rn/AIPb3/49R/whul/8/Wuf
+D29/wDj1dBRQBz/APwhul/8/Wuf+D29/wDj1H/CG6X/AM/Wuf8Ag9vf/j1dBRQBz/8Awhul/wDP
1rn/AIPb3/49R/whul/8/Wuf+D29/wDj1dBRQBz/APwhul/8/Wuf+D29/wDj1H/CG6X/AM/Wuf8A
g9vf/j1dBRQBz/8Awhul/wDP1rn/AIPb3/49R/whul/8/Wuf+D29/wDj1dBRQBz/APwhul/8/Wuf
+D29/wDj1H/CG6X/AM/Wuf8Ag9vf/j1dBRQBz/8Awhul/wDP1rn/AIPb3/49R/whul/8/Wuf+D29
/wDj1dBRQBz/APwhul/8/Wuf+D29/wDj1H/CG6X/AM/Wuf8Ag9vf/j1dBRQBz/8Awhul/wDP1rn/
AIPb3/49R/whul/8/Wuf+D29/wDj1dBRQBz/APwhul/8/Wuf+D29/wDj1H/CG6X/AM/Wuf8Ag9vf
/j1dBRQBh22hWmkahazWtxqbNI5jZbnU7m4UjYx+7JIwzkDnGa5v/m3r/uVP/bSu2uv+Piy/67H/
ANFvXE/829f9yp/7aUAOvv8Aj/n/AN81teFPv3n0j/8AZqxb7/j/AJ/981teFPv3n0j/APZq1lsZ
rcvUUUUgCiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKAMvxJ
/wAitq//AF5Tf+gGrWj/APJPLD/sFR/+ihVXxJ/yK2r/APXlN/6AataP/wAk8sP+wVH/AOihWEv4
vyPQj/uP/b/6DdHZrPW/ExnguVWfUkkiYW7lXX7JbrkEDBG5WH1BrY+3w/3Ln/wGk/8Aia5SCysN
V8U69HqWp6gk41BYLSCLV7i3BQWlvIwSOORQcF2Y4Geea1f+EN0v/n61z/we3v8A8eqzjNb7fD/c
uf8AwGk/+Jo+3w/3Ln/wGk/+JrJ/4Q3S/wDn61z/AMHt7/8AHqqroHhx9SfTV1jUzfpH5rWo8R3n
mqn94p52QORzjvQB0H2+H+5c/wDgNJ/8TVKztdF0+6uLqy0pLa4uTunlh09keU5zliFy3JJ59arf
8Ibpf/P1rn/g9vf/AI9R/wAIbpf/AD9a5/4Pb3/49QBoXNyk8aRxxzljNGeYHAwHUnkjHQVheG7O
2tka6vLK6S+gvtSWJjBLxHLeSPkADBDAIQfTGOtXf+EcstMkhu7e51YypNGAJtXupkILBTlHkKng
nqKy9B0G21mzu729vdZadtTv0/d6xdxKFS6lRQFSQKAFUDAA6UAdV9vh/uXP/gNJ/wDE0fb4f7lz
/wCA0n/xNZP/AAhul/8AP1rn/g9vf/j1H/CG6X/z9a5/4Pb3/wCPUAa32+H+5c/+A0n/AMTR9vh/
uXP/AIDSf/E1k/8ACG6X/wA/Wuf+D29/+PUf8Ibpf/P1rn/g9vf/AI9QBrfb4f7lz/4DSf8AxNH2
+H+5c/8AgNJ/8TWJB4W0S6Qvb6hrEyK7IWj8QXrAMpww4m6gggjsRUv/AAhul/8AP1rn/g9vf/j1
AGt9vh/uXP8A4DSf/E0fb4f7lz/4DSf/ABNYz+E9GieNJL/WUeVtsatr96C5wTgfvuTgE/hSR+FN
GleVI7/WXeJtkirr96SjYBwf33BwQfoRQBtfb4f7lz/4DSf/ABNcd4rnW48YeGVjjmLeVfqAYXBJ
MIAwCOa2/wDhDdL/AOfrXP8Awe3v/wAerlvEWhWmm+LfDn2a41MlkvJN02p3MrApEGXaXkJUZ6gY
DDg5HFZVvh+a/NHdl38Z/wCCp/6RI6fR2az1vxMZ4LlVn1JJImFu5V1+yW65BAwRuVh9Qa2Pt8P9
y5/8BpP/AImuHvUjuNc13zpNVub19VjsrG2h1i5tYh/ocEhz5bgKozIxbaTz0JwKdbWmjwPeweIL
jUtJuLJI5ZXbxRetbmOQkIyytIndSpBUEEdwQTqcJ232+H+5c/8AgNJ/8TR9vh/uXP8A4DSf/E1x
mor4P07Qo9abW9Un06SZIFuIPEl0yFmcLnd5+MDknngA+lFnB4YuLfUb2XWbuLTbOcRC9Hiy5eN8
qpyxE+EO5tuCc8A9xR/X9feB2f2+H+5c/wDgNJ/8TR9vh/uXP/gNJ/8AE1y1zYeD7O1hurrxHeQW
86eZDLL4nulSRePmUmfBHzDkeo9avP4X0WO0a7a/1n7OsZkMn9v3u3bjOc+djGO9D01YG39vh/uX
P/gNJ/8AE0fb4f7lz/4DSf8AxNecW2seC7k6XMNY1GGwv7aWY3Nx4oukEDoY/wB0/wC+ID/vOm7j
HfNdHJo/haG8trOXXdQS6ul3W8LeJbsPMPVF87LD6U7AdJ9vh/uXP/gNJ/8AE0fb4f7lz/4DSf8A
xNclptn4X1XWNS0m11TWDe6fJ5c0X/CQ3ZY/KpLACcnaC20kgcgirU2jeF7fU4tMm1zUYr+YborV
/El2srjnlUM2T0PQdjS7eYHR/b4f7lz/AOA0n/xNH2+H+5c/+A0n/wATXKzWfg23lkim8S3UUkbB
XR/FF0pUkkAEGfgkgj8KzbyTwzptvqF1f3+qR2lpfx2Ili8UXL7mbaCWHnjyypY5U8gKTQtQsd59
vh/uXP8A4DSf/E0fb4f7lz/4DSf/ABNcza6V4Uvb02Vpr99cXYjEpgi8TXbybCAQ20T5wQQc+4qS
fRPDNrqEGn3Gt6jDe3HMNvJ4ku1kk/3VM2T07UAdF9vh/uXP/gNJ/wDE0fb4f7lz/wCA0n/xNYV5
4Z0HT7SS6vdT1a2toxl5pvEN4iKPcmbAqpPp3hG106HUbjxFew2M5AiuZPE90sUhPTaxnweh6elA
HUfb4f7lz/4DSf8AxNH2+H+5c/8AgNJ/8TXOXejeF9Pmtob3XNQtpbo7bdJvEt2hmPHCAzfMeR09
RWfHa+H1uNXS+vtVsotPuVtxLP4lvEWUmJZOplAH3iMZPTNAWOz+3w/3Ln/wGk/+Jo+3w/3Ln/wG
k/8Aia4+1tPDX9maXc6lrF5YT6jGrQwv4ruWDscfKjCbEnJAyvXI9aua1omg6Dot5qt7d68La0ia
V9uvXmSB2GZgMnoOepoem4JX0R0n2+H+5c/+A0n/AMTR9vh/uXP/AIDSf/E1yi2ng5oLGY+I7xUv
+LUt4nuh55zjCfv/AJjkgYGeak1rQ9J0i1glNzqrPNcxW6JN4mu4dxdgDgtNgsBlgo5OMCnbWwLU
6f7fD/cuf/AaT/4mj7fD/cuf/AaT/wCJri9Rh8NWXiDTtEj1LUp7+7uPKkt18TXfmwL5bSbynnE4
+UDt94c1di03wlM94kXiG9kayBN2E8TXRNuBnO/9/wDLjB646GkFjp/t8P8Acuf/AAGk/wDiaPt8
P9y5/wDAaT/4muOu4vB9tomo6tHrmp3drp6s1x9l8SXUhUgfd/1+Ax6AEjmsi/1XwnaW93dQ6tcz
2sUcHlSr4wuMPNKzAIwExKAABi3PG4gHaaBpXPSPt8P9y5/8BpP/AImj7fD/AHLn/wABpP8A4muc
tPD2izWUU0+o6ishZYpBD4mvZEWU4GwMZRk5IA4BPpVXW7Pwv4em0+PU9T1m3F9OYI3k8Q3aKpCl
ssWnGBxjvywHegR1v2+H+5c/+A0n/wATR9vh/uXP/gNJ/wDE1xWhReGdbmmtBqmpQ6hFPPF9i/4S
e7aUrHIyb9vnA4O3PTjPU1pWejeF9Quri1stc1G5uLY7Z4ofEl27xHOMMBNleQRz6UBsdH9vh/uX
P/gNJ/8AE0fb4f7lz/4DSf8AxNYE3h3w9btOs2rarGbeITTB/EV4vlx8/M2ZuF+U8njg+lRR6P4W
m1GTTotd1B76NPMe2XxLdmVV4O4r52QORz7igDpPt8P9y5/8BpP/AImj7fD/AHLn/wABpP8A4muX
ttO8IXtq91a+Irye3SQRPLF4numRXJACkifAJJGB7irlp4Z0K/tY7qz1LV7i3kGUlh8Q3jow6cET
YNAG59vh/uXP/gNJ/wDE0fb4f7lz/wCA0n/xNZP/AAhul/8AP1rn/g9vf/j1H/CG6X/z9a5/4Pb3
/wCPUAa32+H+5c/+A0n/AMTR9vh/uXP/AIDSf/E1k/8ACG6X/wA/Wuf+D29/+PUf8Ibpf/P1rn/g
9vf/AI9QBrfb4f7lz/4DSf8AxNH2+H+5c/8AgNJ/8TWT/wAIbpf/AD9a5/4Pb3/49R/whul/8/Wu
f+D29/8Aj1AGt9vh/uXP/gNJ/wDE0fb4f7lz/wCA0n/xNZP/AAhul/8AP1rn/g9vf/j1H/CG6X/z
9a5/4Pb3/wCPUAaTzrcXVoI45vllLMWhdQBsYdSB3Irjf+bev+5U/wDbSukttCtNI1C1mtbjU2aR
zGy3Op3NwpGxj92SRhnIHOM1zf8Azb1/3Kn/ALaUAOvv+P8An/3zW14U+/efSP8A9mrFvv8Aj/n/
AN81teFPv3n0j/8AZq1lsZrcvUUUUgCiiigAooooAKKKKACiiigAooooAKKz9W1tdEjtmaK1b7TO
Id91ceTHH8rNkttb+7jp3q9FrWn+db2s3lm7mhSbZao86BHJAbeExsyD8xwPXGRWftI3aOhYSs6a
qKN0/wBB1FRJ4k0KSGaYTgRwxNOWa3dQ8a9XTK/OB6rnqPUUw+KdBVpFaWRfL2ly1nKAinoxOzhT
/ePHvS9rDuV9SxH8j+5liil1fVbXRzZrLbSSG6nEK+VCz4z3O0Ht26n88U9K8TadqLiKWL7NO08s
KKyMUYxsw4faFzhc7c5Ao9rC/LfX/hv80KODryp+1UXy9/69C3RTrHWNK1KcQ2r7nZC6b4HQSKDg
shZQHHI5XI5HrVCbxCIndBpyFor420w8zGyMBWMv3eeGU49+tHtYhHB1pSceXXz0/Mu0Vm3fidIL
VJY7CAmW+lsoTPOIo2KbuS+04JKEAYOTjmi98Q3NrcXCLokbJaWcd5ch7gCRFYtlVUKVYjYf4gDS
9vDf+tr/AJGiy7EPp+K72799DSopNM1SDU7/AFG2S2RUtGjCyZz5geNXzjHH3sd6h1fWk0zVLGwj
sRNJdbmLsrqiIvU5VGyfbjHcjim6sUrszWErOp7NLW1/la/5E9FU7TxLYzea88UUUEdrb3AlQs4f
zdwCqu0MTkADjJz0FXo76z1C2aS0JzHJskV4mjdDjOGVgGHBB5HQiqU4t2QquFrUrucWrf1+pk+J
P+RW1f8A68pv/QDVrR/+SeWH/YKj/wDRQqr4k/5FbV/+vKb/ANANWtH/AOSeWH/YKj/9FCs5fxfk
dEf9x/7f/Q5XVCx1zU12aoYB4iV7h9NhkaRYhpsKnmMFlyWUfLhsE7eRxcfd9ktBqMniT+x9032f
7Ot39qPK+X5vlDzsAb8b+oxvy2K3vD3/ACHPFn/YVj/9IrWugq/6/r9Dkbvb+v6/4Y4C+N6YLc6n
L4hF39hjNkbCOfHn/NkzCJdm/wD1eRL8nXAxurYudWSHxXpsM9tqDSx20kUskOm3DwiRzER+8VCu
OG5zgY5xXT0U7iPO9Jj1qHxfJLd6lfvP50+60OnXvkyp8xRRMZWtlGNhDKqnjB5LA0tLn1SOLWIr
iXXJEn055AFstQQxTj+FHkdiW548sIp7A449RoqbafK39f10HfW5xmiH7PPNZI+sywmOynEmopcN
mRn+fDyjg48vKA8HPA5FZujXOpSapZaVaahJZ21xd61NMYo42clL87cF1YD7xHToT3wR3d//AMe6
f9dov/Ri1k+Df+QHc/8AYV1L/wBLZqq+txJWVjl9M8ReIbrxhNbzajYIq3M8cmmG4DSxQru2P5Qg
3rkBG3tKUO7gfMoGdYeKPELQWV3NrEsm+HTLp4vIhCt9omMbpwmQoAyMHOSeSOK9Zoojpa/l/XzG
3e55vpniLxDdeMJrebUbBFW5njk0w3AaWKFd2x/KEG9cgI29pSh3cD5lAzrDxR4haCyu5tYlk3w6
ZdPF5EIVvtExjdOEyFAGRg5yTyRxXrNFEdLX8v6+YN3ueXeFtXe21U2djrJvLibWL9bjSMxMLePf
K3mfKvmJ8wQZZip34xyMVbDxZ4nk0XWL6TV7B54dLnuJLaKYSyWM6jKqUFunlYO4bZXcnbxnaxPr
dFIfN71/O/43PNvEUGrT6hpHlXs95eabby6ycBFJcFFWEAAfKytMozk+rcVmW2o6zodnrF/E4W81
qKDVAbhtotVeXY5PysB5cRiycMBtyQRxXrlFH9f1+H3eZP8AX9fj9/kcx4Iv9R1DS7iS+1Gz1FFn
2wXNrOJg67QTmRYokfBJGUXA6E5Bqh4x/wCRu8Nf9cdQ/wDRArtq4nxj/wAjd4a/646h/wCiBWdb
4V6r80d2Xfxpf4an/pEgi025vNb1+7sWiF7Ya4k8KTErHJmwt0ZGIBKgqx+YA4ODg9DW8RaNrc+n
XeqTWlvLqs9zYxxWdrI7xxxRXAf5pNgY8szM2wbR2OMkutYvNJvfEi6aA+oXOtpHBGbYTb8WFuzc
GWJVwqk5LgcdyRRH49vptCv9RW3tYzD4fh1WJXyR5jiTIJ3cqCg6YPJ5rRd+3/D/AKHGlr/Xe35s
ty+F9Wu9I1V5jYxaje6jBfrBFK7QqYjFhDIUBO4RDLbON3Q45afDOtfbZtWCacb3+049QjtWuHMT
YthAymTy8gglmDbD0HAzxBe63q2neJ9c1D7THLYWWhxXhsSj/M374/K2/CkleTtORgdsl914q1vT
Fu7S4fTLu8QWLxzwQvHGFuJjFhkLsSV2lgdwyD0GOaV9l/XT9EK7t/XVL/MsaV4SvbPUbG8uHtCY
4r8zRxlsJJcyrIFTI5VcMMnBPXAzgbfhzSp9J8J6bpNy8bTW1okDtGSVyq44yAcflXK2fjfUopJm
1WSyW3W2vm8yC0kyj20qxltvmHcrZztGCOm49aqXniTxDqXhW8V3TTdUstYtLZnEO3Ku8LDKJO+P
9ZgjzDkZHGeFa65ej/za/UHe+u+praF4V1Wym0YXosfK0rT57BGimZ2lDeVtcgoNudjZXJxkcmsx
vAviAafotkLy3eLTra0CoL2aKNJYZA7fIq4kDgKAz/dxkLVmz1XUrHU9Ws0Sw/tK71mO1N4tvIIg
Taq+94zKSTtXaAGUE4982PFfirV/DulwtA1pe38UM1zcrFany2iiIDNlpl8rkgYzI2TwpxTu7p+n
+f4XuDTen9dvxtY29M0y/wBO8R6vOVtpLDUJVuBJ5rCVHEaR7Nm3BHyZ3bu+Md6xbzwVcXHii6vC
qT2d3dQ3TvJqd1GYjGEG37OhEcn+rBDEjGeQ23BxpDLL4waSEBZH8RIyGQEqCdN4zjtXW+HPEc+v
XMiCGJEtIVjvNpyUu9xDxDngLtzz13r+KStZ+S/JP/L8O4S/P/O39f8AAOeufAWpy2t3Ek9mGmt9
UiBLt965lDxk/L2A59O2a0brwlqMtnrKpNbGa6v7W9gDOwU+SsPyudpK5MRGQGwCDg9KyPGUuqvf
+MIBfR/2dH4eEn2ZomJywmGVO/CnK8nacjA4xmrVz4r1zRIL+zuIbO+uYbeze1e3iMQHnyGIB1eT
B2lc53oGzj5etCbsrf1r/wAAqV76+f42/wAzZ0zTNch8SvevDZ2FjOrSXcMF9Jc+fMVUAhXiQR4w
eVPzd1zyKfinwzrWtazDPbXSG0hNvLFFJeSwrHJHLvbMaKVk3AKMuTtxkA1q+FtT1fULa7TWbNLe
6tpvL+Xy1LAqrDKJLLsPzdC5yMHjOKxLLxXrL31nNcrYvYXWp3WniCGBxMvleaVfeXIOREAV2jrn
PajZp9iLOz/rz/Q6DxDpl1frYXFl5L3NhdC5SCeQxxynay4ZgrFcb9wO08gfUZ99pWtyXWnatb2m
lNfQw3EMtpJcOsIErKxZZBGSSNgByg3bj074+h+LfEuqwfabiysrG2urF7y1muPLCRBdpw2y4ZpF
w2C22Pbxkc4Eeo+JNX1vwUNTs5U0udtTtYVhaKTzIQZkUiT5kJ3bg2MDKED+LIVteX+tdB31T/ru
SzeCNUttKOm2UlhcxXOjRaRcTXLNGYQm8eYihW358wnYSv3R83PFpfB+o2viS71q2uYXllugUhmk
bY0BhjjfPynbJlNwIzkDbkBjjU8Yy39r8P8AWJobtYr6Kwkbz4kZMMFJJUBsr3x8xxx1xXMS6xq2
i6vfyzf2bc6g1ppsa3K28sYKyzvHhlMrZ2klsjBOcGm7ybXf9R62v/XRf5fcN/4V3qC2djA5guc6
VDp1yv8Aad1bImzdlgsWPOU7z8jbOn3huOO31vSTqvhi/wBIikERubR7dXYFguVKgnua4+Hx3q9r
HdTX0FncpFaX8ix20TRMZLWQISWZ2AV85xj5fVq3PCmsa9qFzdW+t2MUBSKOaJ1ESFgxYY2JPMcf
Lw5IzyMccjvJeuv5/wDBFdxd+3/A/wCAZuo+GvEGoxXm630lH1PTV025DXUji2VTJiSM+UPMyJCd
pCcqPmOcjoPEOjz6ro0NlbyIHjubaUtKSAVjlR26A8kKce9ZGqeKNT0PUNWbUI4FtYbaafT7cQNu
uhHGHY+cHIUg5BUoDjkbgDVa68Va3pi3dpcPpl3eILF454IXjjC3ExiwyF2JK7SwO4ZB6DHIm3a3
k/xC39fcv8hyeFdZTVrSPNkdOt9UuNQN19ocXDCVZBt8vy8ZUyAZ39FHA6Vm2vw7votDu9PYW4lX
TJtPtbh9Tupw+8AbjG/yQj5QSqh+2CNvM0PjvV7WO6mvoLO5SK0v5FjtomiYyWsgQkszsAr5zjHy
+rVNB4s8SW+n3h1PT7aG4BtRbyuI0UefL5YZ447iUlAfm3bl3YIGMZoS0sv66Du1K/W/6/5v/I0d
Q8J3N9JriieCKLUdHi09CMkq6+bliMDj94Mc561RuvCmt6ncSXVyNPt5ZEsE8uK4eVR9nuGkY7jG
vVSMcdeOnNOfxNrq3cekrJphvxqv9nvdi3cxEG2M4YR+ZkEcKRvPTORniq/jPxFcQWFnYafDNqUs
l4k0kUKshFvL5ZKxyTxfeyD98lemDnId3e/z/X9RWaVv67f+2msmkyXHj6W4RZF02ALcyI8LIr3m
woGVjgMPLPOAQCBznIGj4j0y+vn0u704W8lxp939oENxK0aSAxuhG9VYr9/P3T0xxnNKmuMngwa5
erHasLP7RIEIuFQ7c8bD84+h59a5zTvGGuXds1lcWkFvqp1MWAllgAjjBhEwd40mfnHy7RJySOR0
pWadu3+f9L0F5/1tr/Xct23hC9jj0wSSWytbaxdX8hRmzslEwAU7fvDzFz0HB5pnhHwbcaDd2z3S
RsLK2a2gnGpXVwZASvIikOyEEIMqu7nGCAvOjdanrK3Wm6Rb3Gni/uY5pJL02zvAPKKgqIxIDuO4
cb+MHrWTr3izxBZ6ibTStPt7kWthHeXUv7vy3DFuA0k8flp8h+fEmM9OORPsN3f9ef8AmyfxT4a1
nUbrVn0oWDpquliwkN1O8ZhIMmGAVG3g+Z0yuMdTmmXnhTVr2bU7OKW30/TL+0liuDHdPM08jRqi
v5ZRRFjBzsf5h1GSCJ7nXPEUOp31r5FpHNJA7aTavAW+0sqKxzMJduQSQUKoT1DEAms+48Ya662F
hpcMd7qcv2j7S62IjERiZQY/JluU5G8ZYSMMDIBDAhdLf1/SC92n/XT/ACEHgW8uNOuEngtobiWW
zDB9Uur0NFDMJGG+boCMgIF4Ocsc8eg1x9p4j1iTUNIlv4rSx0y+giClY/tPmXDhiYxMkm1OgIJV
lboGyQKm8Xy6pHqfhmPTL6O1M2otHJ5kTOrjyZDhgrrkcdM9cHtg077ef9f5i/RHVUV5v4c1XVNJ
kt1JtJtOvtbv7fyVhYTIweZ92/eQ3KY27R161peEfFOv65eWz6hpkVvYX1s1zbsDErIAVwBtndpR
hwC2yPBxkfNgJK42rNr+t7HbUVy+tarq9lry2zSWlrpdxGIreaW0ebzbhg/yFllXZ0U8rhuQGBIF
c7oN5qbXHgoWM8FpYyaJJNLZJFI6sF8nhcydcNhS24jnrnhLXX+tm/0Cx6VRXE+EfFOv65eWz6hp
kVvYX1s1zbsDErIAVwBtndpRhwC2yPBxkfNgUPEN1eWfi/XtVZbC5GjaIt1Yxz2pZopG83JDb+M7
MEgDI2jjGSNW3BK+39a2PRaK5O41XxALjTtPjuNKhvLyCa7M0ts7Rxonl/u9okBZv3nL7gMKfl54
xpPHmr3EdpcWcFjDDLaWFw6So8hzdSGPAIZeFIDZxyOOM5Ds/wCv68mJaq53d1/x8WX/AF2P/ot6
4n/m3r/uVP8A20rd0LVLnV9Ps57wRfaYr+4tpGhQojGMypuCksRkKDjJ+tYX/NvX/cqf+2lIB19/
x/z/AO+a2vCn37z6R/8As1Yt9/x/z/75ra8KffvPpH/7NWstjNbl6iiikAUUUUAFFFFABRRRQAUU
UUAFFFFAEb6Z9vvLGfztn2K48/btzvyjpjrx97PfpVhtIWTWrq/eXKXFmlq0W3GAGc5znvvx07Ux
XZfusR9DTvNk/wCejfnWbpp/15W/I3jiKkY8qfS3yvf8zFk8GS3NgtpdamsiW9jJY2bLb7TGjgKW
f5jvICqONo68c8W9Q8LC/TVF+2bDf2kVrnys+XsLc9ec7unHSr/myf8APRvzo82T/no351PsY/18
/wDNm7zLEXT5tvJd0+3dXF1XS5NQishDcJDLa3CTqzx7w20EYIBHr61nReE1S2s4Hu96W97PdN+7
xvEgkG3rxjzOvt0rQ82T/no350ebJ/z0b86HRi3d/wBbf5IiGNrQjyReny8/82Z3h7wnFoM6urWb
iKIxRtFYpFKwz1kkySzYAHG0HkkHtNdeGUudS1G7NztW9tWg8sJ9xmCqXznk4RPTGOtW/Nk/56N+
dHmyf89G/Oj2MbJdhyx9eVR1XL3np09So/h+5Gh2unQ3tvhN32gXFmJYrndktuTcCPmO7hvrmqCe
DbiCA21vqwW3l0+Owm325aQou7JVg4CkhyOQccda2vNk/wCejfnR5sn/AD0b86ToQe5UcxrxTSe7
vst737FO10K+07Vry6sb+1S3uniLQy2jOyhEVMBhIOy+lXb/AEr7dqFrdeds8iOaPbszu3gDOc8Y
xSebJ/z0b86PNk/56N+dU6UWrMzljKspKbeqVtlta3z0MRvAsUmntayXoc/ZrWFC0AKhoCSGZScM
DnlfTvWlYaOuj2DxgWoaWbewtbVbeMcYACjJ7dSSfwwBZ82T/no350jO7DDMxHuaI0oqXMiq2Pr1
oOE5XT16eX+Rk+JP+RW1f/rym/8AQDVrR/8Aknlh/wBgqP8A9FCqviT/AJFbV/8Arym/9ANWtH/5
J5Yf9gqP/wBFCpl/F+RpH/cf+3/0Dw9/yHPFn/YVj/8ASK1roK5/w9/yHPFn/YVj/wDSK1roKs4w
ooooAKKKKAKt/wD8e6f9dov/AEYtZPg3/kB3P/YV1L/0tmrWv/8Aj3T/AK7Rf+jFrJ8G/wDIDuf+
wrqX/pbNQB0FFFFABRRRQAUUUUAFFFFABXE+Mf8AkbvDX/XHUP8A0QK7auJ8Y/8AI3eGv+uOof8A
ogVlW+H5r80d2Xfxn/gqf+kSILy/0HTX8U3PiKC2mshr1sircIjKrtaWqq3z8DGSSeoAJqa3vfBO
t6vLpV5Y+H2ltJhFYJN5LtOrxpKWiUjod/8ADnOM96SbSrjWD4utrRohcJrlrcRiViqMY7azfaSA
SAduM4OM9DT5vCmp3lvqjzixiuL7VLO+2JKzqixeTuXcUBJ/dtjjnI6c42ilfX+tv+D/AFY4uhuN
J4avPEEds76TPrVkhMcRMbXECkDOB95QQR6cGont/CegJDpzw6LpqXcweK2ZYoRNKCuCq8bmB28g
Zzj2rG0rwVcWPiIXEypLbRXs17FO2p3TMWkLnH2bIiUjzCN+TkA/KC2RqeIdK1W81Gxu9HW3guYv
ka9kunVo4y6ll8kIyyggdGKkHoQeaS6f1/Wv+Ynpe39f1/wCxFN4WluLy3ik0d57VZBdRq0RaFXO
ZN46qGIy2ep61BYN4MnjOlacdBkS6jKGztzCRMiZBGwfeC88Y45rmr/wP4gv7vVJpryCV7q0vbRJ
Jr2ZgUmIMf7vbsiC7VUhc5+8SSMVpJ4Pv01lbsT26RDU1u/kdgwjFn5BA+X727n0x37ULVa9v6/z
H5+v9fM17ODwlqEN7otlFolzHGVW7sYVicKVwqiSMdMbABkcbQO1LqNt4T06HTrbU4dFtoo2KWMV
ysSBWPBEQboeRwtY3hHwbcaDd2z3SRsLK2a2gnGpXVwZASvIikOyEEIMqu7nGCAvOpqGl6mniKTV
NOhsrpbm0W0mjvJ2jESqzHcoVG353nKnb90c88N9P6/r9BdyaePwvHqkWmzro6ajKkZitnEQmZY8
mMqp5IXBK8cYOKhsdT8OaFFNav4gsmuPO33MlzdxCR5XOMuBgAkjAAAHGAOKoX/hjU7jVbxIvsJ0
++v7a/luHdhPCYfL+RU2kMD5QwxZcbzwcc5lz4C1OW1u4knsw01vqkQJdvvXMoeMn5ewHPp2zQu7
/r+np8rjstvT+v67nS30vhHUtcj0/UJNEutXjVo0trgxPOqsuWUKfmAK9R3FXH/sK53b/wCzpfte
bJs7G87ZuzCf72Pn+Xt83HWuPi0LXL7WtYsza28OnvqtpdNeTSP5jeVHC37pNmGBaPbu3jHPBxg3
LXwvrUGrWKEaf/Ztnq1xqKzCd/OdZRL8hj2bQQZeu85A7UJKyX9dP839wdL/ANdf1sX9A8S+El0O
5k0y50zTtOsJ3hlQPFDHC28rkhThQxBIJxnNXje+GLe2tbhrrSI4HZrq2lMkQVmY4aRD0yTJgsOp
f3rmrrwbq8tr9mH2Z47XVJdQtimoz2zTiUyFldo13RFfM4Kl845Azxf0jwhLp+raReslui2kN35k
YuJZmEszo2Q8mWfgMCxIyTkKM4Atd/60/wAwdle39f1+pvJ4e0SM3ZTR9PU3jBrkrbIPPIOQX4+Y
55571zyXl/feJtQ0a98MaEY3t4pL2Zr5pPNhZnVQVNuN5GxvlYgc9a6mx/tD/SPt/wBm/wBe3kfZ
93+q427s/wAXXOOKz00i4XxVqOqF4vIubGG2RcncGRpCSeMY+cd/Wp6f12Dv3/4JJY6l4fe3isNP
vdMaABYY7e3ljK4KFlQKDjlASB6DPSqTL4L0XThKy6BYWPmiEORDFH5iOWCZ4G5X3HHUHJ61nQ+F
NR0/wv4YtbMWUl/osiSNG8rRxTHy3R/nCEj75Odp6dOazv8AhB9XEVndP9nlvIp713t4dVubNAs8
vmArNEu4kYAIK4Oe2Bmnu7Bpb+vP/gHdQafpyMk8Fnaq2HKyRxKDiQ7nIIH8RwT6nk1maNdeErKy
uDoc+iW9os4Wf7C8SIJWwoDbONx4HPJ4p/8Awjyf8IW3h2OUW6mxNoJIdxCZTbldzFsD3Yn3rLvt
C1fWvD40++s9KtmSa12iC4eVXjilV2BJjXHAIC4I5680fastv+CLoXluvBtnfRaqtxoMF3qYMcd4
HhWS7GQCA/V+Qoxk9qktLfwnZXT6DZw6LBcFhcvp8KxK5YYIkMY5yMKQ2OwrH8TeDrnV9cmvIVSe
C7s1tJo5NSubURKpc52QnEykOcoxXp975jgn8K6xJ4wtNTN0klnaXSywK97MNkXkmNoxCBsyCzNv
JLHO3gUL+v6/EHp/X9en/ALmleIvCF5Z3Wp28+l20djPNDNLI8KeUWkIYkg/KJGXdyRu4NTwv4M0
3T4bOBtBtbLVs+VChhSO83AA7VHEmcgcZzkVhXXg3V5bX7MPszx2uqS6hbFNRntmnEpkLK7RruiK
+ZwVL5xyBnidfCmq2MGnHSYrS0vUd2muzqM8hjWSUO67ZFf7RkZyXKHPI2Z4S13/AK/pjlpex0E8
Xhvw5p1u1xHpWl2NtLugMgjgjikYHlc4CsQW6c8mqmqN4LMMOn6s2gGKWQTxW92YdrvISQ6q3Usd
3I5PNTeKdL1LVbS1h0+fYiz7riL7XJa+dHtIx5sYLrhirYGM4wSAa5q28B6nHoGoWEs1k0s+gRaV
G+9iN6eaNxyuQpDqe5HPXAJFre/9f1/WwLt/W/8Aw53F/NYWmmzPqMltDYqm2VrhlWIKeMNu4xzj
muZv77wNpOmafbTW+ijStYkEEexIPs8gUF1LZwpUEYHXBYeta+u6fqV74eNnp9z5V3+7ywmaLeoY
b18xQWTcARuAyM5Fc9aeE9Y0/SNNSE2ct1p2qTX0cUt3KUkSTzPlaVlZ8jzTyQ27bk4zw7K+v9f1
/mJbJ9f+AXY77wVqq6h4fmt9INtoj/vbS4SHyogFBLqhyFVd5UkgYORVy5n8HX1hZ6rdS6FcWdqx
+y3krQvHCV67HPCkbex4x7Vkat4S1S/bW4ENr9m1C5gvkf7VLE4liEQ8o7FyFPlf6wNkZ+6cclr4
Mu0ewuGjt4Zk1I3lwjX9xdkj7O0Q/ey/M7ZKnooA45xkrW1+v6/1f7vMen9fkaUh8DSHU9Rl/wCE
dYlRDqNy3kHIbGElb0OBwx5wKqard+BLPwfbXE9rotz4fW5SOBYo4Ht1d32llB+QYLMSRyAGrn7z
whrWk6BAIo4byeO20q1EMLPhpILjczE7CQmG+9gkAE44rdl8L6td6RqrzGxi1G91GC/WCKV2hUxG
LCGQoCdwiGW2cbuhxzVl30T/ACa/zbD+vw/pGpqzeG9LspPF9xZWMrWlsZUvo4o2lMe04CSHHUHA
GcHPvS3ureFNX06zj1G90a6tNQI+zRXUsTpcMCBhQxIYgkDjPNWdX0651zwpe6bN5VtdXlo8LbGM
iRsykcEhSwBPXA+lc3qPhrxBqMV5ut9JR9T01dNuQ11I4tlUyYkjPlDzMiQnaQnKj5jnIXW39dQV
rL+u3/B/I6yS00qwtRNJb2Vtb2rPch2RUSFiDukz0U4Zst7n1rOsrvwhYW0+t2Nxodtb3bkzX8Dx
IszAkndIOGIO7qfWn+J9Ck1vw2+nQylZFeKRC0rxhzG6uFLp8y5243DkZzzjFYdr4Mu0ewuGjt4Z
k1I3lwjX9xdkj7O0Q/ey/M7ZKnooA45xkrv/AF/X/ABarUu6jqHhj7YmrW0WhX+rR3EVmJjPAsqG
Q42iQ852FyE6sAQOtS2V54V1vUp9DitdOluNDmUR2zxxN5JCqQ8a8lQNwXOBggisG28B6rDp9tbt
cWeYrTTIWw7YLW05kc/d6EHj364rp9M0y/07xHq85W2ksNQlW4EnmsJUcRpHs2bcEfJndu74x3qr
Jfj+lv1YP+v6/Aksh4ZsNdurSx/sm21i4Hm3EMHlpcSjrudR8x6k5PrWhNp9lcNO01nbyG4iEMxe
JW8yPn5WyOV+Y8Hjk+tcrd+GdaufGtvq73SSWtteLNCr3ko2RGIxtGIQvlg5Zm3kljnbwK7Op6IV
9SlqGj6Zq1sltqWnWl7AjBliuYFkVSBgEBgQDgmny6ZYTSGSWxtpHIQFmiUkhG3Jzj+E8j0PIq1R
QBRe2gtZbNLeGOFGuXcrGoUFmRyx47kkknuTXG/829f9yp/7aV211/x8WX/XY/8Aot64n/m3r/uV
P/bSgB19/wAf8/8Avmtrwp9+8+kf/s1Yt9/x/wA/++a2vCn37z6R/wDs1ay2M1uXqKKKQBRRRQAU
UUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFAGX4k/5FbV/+vKb/ANAN
WtH/AOSeWH/YKj/9FCqviT/kVtX/AOvKb/0A1a0f/knlh/2Co/8A0UKwl/F+R6Ef9x/7f/QPD3/I
c8Wf9hWP/wBIrWugrn/D3/Ic8Wf9hWP/ANIrWugqzjCiiigAooooAq3/APx7p/12i/8ARi1k+Df+
QHc/9hXUv/S2ata//wCPdP8ArtF/6MWsnwb/AMgO5/7Cupf+ls1AHQUUUUAFFFFABRRRQAUUUUAF
cT4x/wCRu8Nf9cdQ/wDRArtq4nxj/wAjd4a/646h/wCiBWVb4fmvzR3Zd/Gf+Cp/6RIaup3dhrWu
29isQub/AF+O2SaZC8cP+gQPuZQQW4TAGRyRzV++1XW47rTtJt7vSlvpobiaW7kt3aEiJlUqsYkB
BO8E5c7dp69naVY2mpah4wtL61guraTVY98M8YdGxZ2pGVPB5ANas/h7RLrTodOuNH0+axgIMVtJ
bI0UZHTapGB1PT1rT+v6/PzOK6ucjN431S50o6lZR2FtFbaNFq9xDcq0hmD7z5aMGXZjyyN5DfeH
y8c17TWbuHxZr1hbLFbG9vwRdXUTPEGFpEREArKS5AJ6gYU9yK7u70bS9Qmtpr3TbO5ltTut3mgV
zCeOUJHyngdPQU6TS9PmEolsbaQSyLNIGhU75FxtY8csNq4PUYHpTlZ3t1/zC/8AX9f1r5Hm1h4t
1u10HSrbRNGt/JtdGgvZwdnlhWDfKGluEMajYfnPmYzyOOfTLe8huHeJZYzcRBTNCsgZoiwyAwHT
Pb1qtLoGjTizE2kWEgssfZN9sh+z4xjZkfL0HTHQVcjtbeK4muI4Ikmmx5sioA0mBgbj1OB0zVN3
bYmS0UUVIBRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRR
RQAUUUUAFFFFABRRRQAUUUUAVbr/AI+LL/rsf/Rb1xP/ADb1/wByp/7aV211/wAfFl/12P8A6Leu
J/5t6/7lT/20oAdff8f8/wDvmtrwp9+8+kf/ALNWLff8f8/++a2vCn37z6R/+zVrLYzW5eooopAF
FFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAZfiT/AJFbV/8A
rym/9ANWtH/5J5Yf9gqP/wBFCqviT/kVtX/68pv/AEA1a0f/AJJ5Yf8AYKj/APRQrCX8X5HoR/3H
/t/9DNW/ktfEGvppek69dsbxDdyW72YiEv2aHAXzZFbGzy88dSas/wBr61/0LniX/v5p3/x6s5dY
uNH8Ray0UDXMdzry27W8UW6WRjp0DLsJYKvKcluMHJIxmttvFSNDCLfSNSubxy4kso1jWWHYQG3l
3CcErjDHdkFcjmrOSxV/tfWv+hc8S/8AfzTv/j1H9r61/wBC54l/7+ad/wDHqsz+LbZEjltdP1G9
h8hbieS3iUfZ4znBdXZWJ4b5VDMNvTkZtfbL0eJLeAT2smnXNrJLGqwsJFZDHzv34KkOeNo6dTTs
IzP7X1r/AKFzxL/3807/AOPUf2vrX/QueJf+/mnf/HqSw+IOh6l4k/sSCUGcySRRv9ogYO6Z3LsW
QyL91uWQA468jJYePtM1JNU+zQTSTadEZpII57eV3UZzjZKwU8dHKn260rhboSQ6jqE9zBFeaLr1
tA0qZluHsiincNu7y5C2M4HA71naXqM8EV3FpOi+I7m0XULz96j2IVpPtEnmbd8gbb5m8DIzgCti
11xdYtmVtPvbGWOS3k8q7VAzI7ja42MwwdrDBIIwcgVnaHrdjonh6aa/NwkLatqeZI7aWVUAvZsl
2RSEX3bA96GraAtdif8AtfWv+hc8S/8AfzTv/j1H9r61/wBC54l/7+ad/wDHq1ptf06DVE05pZXu
GKg+VbySJGW+6HdVKoT23EZyPWiLX9On1RtOikmedWKs628hiDAZK+bt2bh3Xdn2oAyf7X1r/oXP
Ev8A3807/wCPUf2vrX/QueJf+/mnf/Hqtr4y0Jormb7XKsVvC9w0j2sqpJEn3njYqBKo45Td1HqK
gvPG2mxeHtV1W1S5mfTrczvazW0sEpGCVO10DBTg/NtI4PoaPMdnexH/AGvrX/QueJf+/mnf/HqP
7X1r/oXPEv8A3807/wCPVY0fxG+r6/cWqQtHaJYQXSebBJFLud5FIZXAOPkGPlHrzkVHp/i60bSV
vL2bzGlup4oY7OzuHkZUdhgxbPM3KANx24B9sU2rbi/r8Lkf9r61/wBC54l/7+ad/wDHqP7X1r/o
XPEv/fzTv/j1aN74p0jTzF9ouJf3kQnzHbSyCOM9HkKqfLXg/M+BwfQ4ZJ4u0WLUjYPdS+cs6W7M
LaUxJI4UorSBdilt64yec4HNLyDzKP8Aa+tf9C54l/7+ad/8ermtcv7yfxf4cN7pOs26KLsFZ3tC
7KYwGK+XIRhRyd2Dj7uTxXdxa/p0+qNp0UkzzqxVnW3kMQYDJXzduzcO67s+1cXr2t2Os+LvD5sW
nkSKG/8A3r20kccgMHBjdlCyDjqhI6eorKq/dXqvzR3Zd/Gl/hn/AOkSNVb+S18Qa+ml6Tr12xvE
N3JbvZiIS/ZocBfNkVsbPLzx1Jqz/a+tf9C54l/7+ad/8ernvEml6fqGhfESW9sba5ktrh5IHmhV
zE39n23zKSPlPA5FbMZk0XU9H0Dw7ZaXp9veWs11KwtflVkMQyFRlBJDEfke2Dqtf6/rscTWif8A
XT/Msf2vrX/QueJf+/mnf/HqP7X1r/oXPEv/AH807/49VaHxdeuunb4bfdc6zdWEiqrZ8uITFdoz
9792ue3J4FR+EfFOv65eWz6hpkVvYX1s1zbsDErIAVwBtndpRhwC2yPBxkfNgCV/6+YNW0/rexd/
tfWv+hc8S/8AfzTv/j1H9r61/wBC54l/7+ad/wDHq5nxrJenWtZtbc2MZmj0yJpJIJHLwyXDoY3H
mBSM5PAGVYqexHV+LEl0r4d6sulvHZSWunyeSYEKLFtT+AKRt6cYPHHXFH2eYfL7yiRf2vrX/Que
Jf8Av5p3/wAeo/tfWv8AoXPEv/fzTv8A49XM3l9r+j6xq+qR3enTXFloNtcXIe0kCzhXnbav73KH
H8RL89q1J/F+vv4imhstKjbTbW5gtpmkMS7jIEOfMadSv+sGF8p9xGAfm4dtbf1vYnz/AK2T/U0v
7X1r/oXPEv8A3807/wCPUf2vrX/QueJf+/mnf/Hq0da1WfTdQ0SCJIzHfXpt5S4OVXypHGOeuUHX
PeudTxZrEkcF8/2O20lL25t7q6+zPNsCXHlxjAkBXcAcvhgDyQopLUHorv8Arf8AyNH+19a/6Fzx
L/3807/49R/a+tf9C54l/wC/mnf/AB6s7T/FviC91050qNNIa8ntEdzErAx7xu3eeWYkxk7PKBAJ
5O3J3PCGpanrXh2z1XUjaKbyCOVIbeJl8vK85Ysd2eo4GOnPWhaq4NW0Kn9r61/0LniX/v5p3/x6
j+19a/6FzxL/AN/NO/8Aj1ZP/CeX0Gsakr2n2nTYrS7uLV0gELyG3ZVZRmV2YZJG4onI4DA8a9xr
GsaVoUt5eS6dd3EhgEC20LxrF5rhAXBdiygnO4bc4PA60dLjsJ/a+tf9C54l/wC/mnf/AB6j+19a
/wChc8S/9/NO/wDj1Q63rev6Lp9nbotnqOq3d59mR7a3CIg8sycxyTrlsKRjzRnOf9k0ovEniW8m
0yzX+zNOupYbuS4e5h89cwSInSOfCZ3HI3ttIxk4o/r9Qsaf9r61/wBC54l/7+ad/wDHqP7X1r/o
XPEv/fzTv/j1ZUWtazrOveFb2xuIbaC+0ia6ls5Fd1c5hOMh1GfmwrFTjng543vCuq3+oW1xDrDw
rqluyi4torVofI3KCBkyOHHXDK2D0wCCKdmt/wCtbCZW/tfWv+hc8S/9/NO/+PUf2vrX/QueJf8A
v5p3/wAerldcl1mZvEySahDJbw65YR20TwufKYtbsOfMxt55UAZOTkZxWpdeL/EFos+mra2t5qqa
oLBJreELGwMAm3eVJMvOMrjzRnr/ALJS1V/66f5jasa39r61/wBC54l/7+ad/wDHqP7X1r/oXPEv
/fzTv/j1X9Bv7/VPD5n1G2SC8DSxSJG6MCVYrnCO4U8crubacjJxXn3hbWJ9H0tJktbeWb+xdLjh
k2uCokkeMeZ8xBVWJbICnBxnvTtv/W9/8gtpf+t7HZf2vrX/AELniX/v5p3/AMeo/tfWv+hc8S/9
/NO/+PVDret6/oun2dui2eo6rd3n2ZHtrcIiDyzJzHJOuWwpGPNGc5/2TUh8SeJb2XTrFI9Osbye
C7eZp4vPAaCREGFimwudxyu9ip4yccr+v1Cxo/2vrX/QueJf+/mnf/HqP7X1r/oXPEv/AH807/49
VHT/ABZqt0+i393Hb2mlahaQumLdpWluHViYg4kHl9BgshB6bskCl8I+Kdf1y8tn1DTIrewvrZrm
3YGJWQArgDbO7SjDgFtkeDjI+bAdtWuwi7/a+tf9C54l/wC/mnf/AB6j+19a/wChc8S/9/NO/wDj
1VvE3iy90fxBaWtnEs9sr263qtbj92JpfLQiUyryecKsb/d52g5rKn8aeJEGrXcdpbG0sra9lZXs
JlETxHEa+eXCTbsEnYBjGDil0v6/gNK7t/Wpvf2vrX/QueJf+/mnf/HqP7X1r/oXPEv/AH807/49
VHVvEHiezk0yxs7S3ub++jluS0NurLFGuz5NslxHvb5+WDDp9znilfeNvEbeR/Z+jwExabFqF2DL
BJH8+75RIbiMKg2H94BIOenHLt/X9eglrsbf9r61/wBC54l/7+ad/wDHqP7X1r/oXPEv/fzTv/j1
Zl34s11tdksbUafBH9uFinnQPKysbbz95KyKCByuBjOQc8YNKXx54gurWzm0vSYXxpUOo3Zfy9h3
7sruknj8tRsPz4kxnkccq39fiOz/AK+46D+19a/6FzxL/wB/NO/+PUf2vrX/AELniX/v5p3/AMer
PufFWtw399KFsFsLLUrWykgaFmldZhDkiQPtBUyn+Eg47dataHf3sHiLxVNqmrWw0y3vUSNZVKeV
mKIjDs5UL83TaMsSc84ppX/r0/zQib+19a/6FzxL/wB/NO/+PUf2vrX/AELniX/v5p3/AMerb1bT
LDVdPkt9Rsba8gA3iK4iWRdwHBwwIzXmelaTDZeFvAEmi2un2N9dTxvJP9lBDt9ll+ZwpUueT/EO
vWktb/L8R20v6/gdj/a+tf8AQueJf+/mnf8Ax6j+19a/6FzxL/3807/49WK3jPxHcQ2FnYadDNqU
sl4k0kUKuhFvKIyVjknixuyD98lfQ5yOpTUdUvPBy6jZ2cH9qS2glitvOWSMyFcgB1bawz3DAH1H
WjpcLa2KH9r61/0LniX/AL+ad/8AHqP7X1r/AKFzxL/3807/AOPVQbxpc2FhFcXb210X861wlu1s
wvlOUgKs7Y3DIBBIJGQSGFXIdW1xNbuNO1SWztfNgb7CEtHYTssalnEglIGGLfIVU46E4JpN2V/6
/r/hxIf/AGvrX/QueJf+/mnf/HqP7X1r/oXPEv8A3807/wCPVzOleI/FUHhjwxaWypqWoX9ibk3B
gDERoEG1hJcx73y+Swft93nIu3XjbWw1uYrfT4AbaxllR8z5a5laLCujhSFIDZGcjjjORTi72Xew
WOh0+/vLrUYEvtJ1m0UEmOS7e0KFtp4/dSM2cbu2OKwP+bev+5U/9tK3dC1S51fT7Oe8EX2mK/uL
aRoUKIxjMqbgpLEZCg4yfrWF/wA29f8Acqf+2lIB19/x/wA/++a2vCn37z6R/wDs1eXi11O6/fy+
I9TMknzMdluOT/2yruvhzbT2/wDaXn6jdXm7yseeIxs+/wBNir1989K0k9CEtTpKKKKBBRRRQAUU
UUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFAGX4k/wCRW1f/AK8pv/QD
VrR/+SeWH/YKj/8ARQqr4k/5FbV/+vKb/wBANWtH/wCSeWH/AGCo/wD0UKwl/F+R6Ef9x/7f/Qyo
NDGs694gf+0Lyyks9aWaJ7Uxg7zYW6gnerA4DNx0OeQa1z4Y2xRG21nUra8QuZL2MQtLPvILbw8b
J1VcYUYxgYHFN8Pf8hzxZ/2FY/8A0ita6CrOMwJvCsbRxx2uqahZReQtvMkBiP2hBn75eNiD8zcq
VPPsMST+HpZdZg1GLXNRt1gXZHaRJb+UEO3cvzRFsHYM/NkdiK26KLgY0Hh9re8kePWNQFi7Ox08
+SYfnyWAby/MAySRh+Og44qjF4MEayKdf1Z0azayRGFuFiiOMBQIhyMcE5984GOnooAwF0VrC4N4
2p3tyZFtbcxzCIKBHIMN8iKdxLMTzj5jgAYA5QeC08XaI6y3MKRJf6vC0c9t54G+8l/eICwCyLjh
iGwCeOa9Av8A/j3T/rtF/wCjFrJ8G/8AIDuf+wrqX/pbNQ9QWmwlnoGoadqclxaalbJBdNHJexta
MzySKioTG3mYQEIvBVsc888P07QbzTbq4iiv4DpE00s5tjbHzt0hLMDLvxt3MSBsB6DPrvUUPXcF
poedP8OBpfhvV7bT4NLluH02a0tPs+mxW88m5cDzZsne3AGRsBySQeMbUXhK6vLHVV1rUkmudRsF
sCbW28lIYgHxhS7ktmRiSTjpgDv1dFO472tb+tv8jk4PDniG21Y6lFrml+fJaxWswbSpCrLGzlSo
+0AqcPg5J6Z9qIfCF1YNDdadqcEd/FPdustxaNJGY7iTzGQoJFOQQuG3djxzx1lFF2L+v0OO1vwH
DrWqR6hM2mTTvbJbXD32lpcnCknfFuIEbfM3UOv3fl45tXHg9Zk1JFvRGt5qFtegCHiMQ+V8nXnP
ldeMZ6HHPT0UJ22/rW4GDp2g3mm3VxFFfwHSJppZzbG2PnbpCWYGXfjbuYkDYD0GfXg5PCcXhPxP
oNtAum+S1veoj22ni3mdVgOPOcMRK2D12r3OOePWq4nxj/yN3hr/AK46h/6IFY1fhXqvzR35e71p
f4an/pEi9pBsptb8WWF4bdxc6mF+zzYPmqLG13DafvDB5+tWdV1rSbAaddxNpk93cMkVnvuoomeK
R0DGNm+8MYbC/ewB6ViSaHJrt94mjt7o2tzDrcTpOvVVNjbJIB7lHcD3we1KfAUlvZ3NtZ3KGL7V
aGzjkLbbe2imEpjHXnJcD2CDtWsd9e/9f16+Rw/1/X9dh2kX+jaj4qhlXw3YQ6hO96TfBEMubeUQ
53bASWDevHTmr+u6j4b8CWGoat9n0qzvZ45Jtm6O3kvXUE7c4y5yfQn5veq2leFtQ0zX7e93WskE
M99/y1YMY7iRZQcbMblZdu3OCDnI+7TfFfhvWNRn1STSxYzDUtM/s9xd3DxeRy53rtR92d/I+X7o
5OeDov6/roV7vM+1/wBTZmu/DsupQW17JpY1O7jjdLeZo/OkCksmFPzMFbJHHByRU41/Qri5lsBq
2nSTqjmW3+0oWCrkOSuc4GCDnpg1y8vge5fxBNcOI57S5uILmR31O6j8to1Qbfs6ERycxghmIxnk
NtwbVt4Su4Bppd7Y/ZdYur+XBY7o5RMAB8vLYkXI6cHk929v6/r/AIYhbXe//ANq00nw7bwmystP
0uKK5tyDBDDGqyw5J+6B8yZc+3ze9MdfDE3iaJHGkPr9vF+7UiM3UceO38YXBPtzWd4L0ma0S6vJ
xIEZvs9gssTRvHaIWMasrHIPzN1AJAXIFVr3wvrV34zg1V7tJLW3uxNCGvZV2RGExsghC+WCCzNv
OWP3eBR1X9f15/MOj/r+v+GN6abw94he60ieTTNTaAg3Fk7RzGMg8b0Occ+oqhbW/ge7txd2sPh6
aHSmZhNEsLLZtncTuHEZyMnp0zVWx8N6mPDM/hu7FnDapZSWcF9BMzzvuGN7IUUIe5AZsnvRqGg6
vrfhmbT7230+zmjMBgFpeSkSCJw4VpAiMgJGBtBK5zz0pbbf1/wwy79v8GW5PiUXegRm6PkHVPMh
Hmn+55v8X3eme3tWhZajoqXQ0WxvNPW4t4wRYwSoHiTAx+7ByFwR2xyK5VvCWpwaW8ljaWsWrvcm
4SZ9aupDbt5flh/NkRzKcDlWRVxgEHGTq6bpGtWfiV7ktaw2Eqlrvy7h3N3NtVQ/lMgEJ4P3XIPc
E8hrt/X9f13tL/r+v6/K7ri88LaN4ttLGW20+11bURJPHN5cSM7AheW4Yu24gdc4b0qxpFv4TK6h
pmixaKRkpfWtmsXU5UiVF+hHzD1pNW0q/m8R6ZqtiLeQQQzW00c0rRkJIUJdSFbLDZ904znqKzfD
nhrU9NvdMN6LFINJsHsYHtnZnuQxj+dwVAj4jB2gvkseeOVFK2v9b/8AA+/yZT01RLfz+ENIntfC
VzYaXDDfRvNFZNFEkDlWXjYerMTxgHO0+lZ2jweDvHNrpF69vpU0llY/8ggNDNHarIEOGTb8pG0A
HA6nit3WNK1CbxBpuq2C20nkQzW0sc8rR4SQoS6kK2SNn3SBnPUVgDwDeS6LpWnS3NvF9n0O40ya
SIsTvkEYDLwMr8jZ5B5/IW1+v/D/APAHodLGfDXiu3RojpOsQWsg2lfLuFhcDt1Ctj8afYReH9Dt
57fTk0zT4UnVJo7cRxKsrBQoYLgBiCmM8nI9qzvCvh640m4ubu8t44riWKOEbdTub0lVLH782Noy
xwoXjn5jnAz9V8L61cajqCWg09rG/wBRtL55Zp3WWPyjFuQIEIbIi4O4denen1t3/wA1+hJrtJ4Q
v7+9vXfQ7m8sVC3c5MTyW6o24CRuqgMuecYK57Us114R1DSZbiefRLnTb1yZZZHieGd0GSWJ+Vio
TvnAX2rBu/CGs31pqdiHt7PTnlSe2s47+aQNKs3mljJsR4Q2ANqlgpOVxjDS2ngu4WbTbiWK3iki
1T7dcRtf3F2SBA0a/vZfmds7T0UADHOMlLVa/wBf1/w4/wCvwN+91Ky0PR7FrFLEW8ssNvaxC4jg
jKuQB5ZPynC5YKOuMCszwxd6Jr/9rnTdN0Y6cJHtHktnR2uMM28SIEwFJZiPmbcGJwM1qeJdKn1n
So7W3eNXW7t5yZCQNscyO3QHnCnHvR4b0qfR9Ont7h42eS9ubgGMkjbJKzqOQOcMM+9Na3b/AK2/
4IbRVv63/wCAczfeIPBljpuqaJBpukvb2F7DBdacywpF+8eMGXYMjapcZJA+ZSOOtdFBf+FotJi1
S3u9GTTbVDBFdxyRCGFCQCiuPlUZCjAPYVjan4W1W5vdUjh+wtZ39/a3/mSTMroYmh3JsCEEFYiQ
27qQMd6i1XwVfXl5fXkUkTM+qpfwwreTWu9RbiEhpYhuRs5II3dMHqcJfDr/AFt/wQsuhvQ2HhaK
KDX4bTR0jt4P3OopHEBFCAR8sg6JgnocYJoeTwr4auLq6d9G0qacrJczMYoGk3FtrOeCckNgnqQf
en6HoceneHzp1xBHiYyvPEJpJ1JkYlgXlJZ+vLHGTk4GcDAk8H6tDpMdvBfLLKbkCfF1Lama2RCk
SGVAXBUbWOMbm3DIBod+gv6/yNG5udBv/E00Go6dpshgs4HjvrgRtuWZ3URgsOhKjHPJbpWevhfw
ppWralrt9qNmwBkjuxcR2kUUZlwSsrJGjNkMOJGbO4Hk4NUE8B6xBptvBHNZSTQ2FnBl5nCmS1mM
ifwE7XBwT1Ujo1S3Xg3WtQN1fXQtEu31Rb9LW31GeJCotxCVM6IrqerAhT6Ec8PTp5/n/wAOPT8v
y/zOrv4NA1nQ1uL2HTNQ0tE+0I86xyQBQD84JyoGM8+lZ0F74a13+xTqsWiHVpIVubS1kmhuJI8j
OYj/ABD5fvLwdue1X9A0c6ToP2IokcrtJI6rPLMAzsWP7yQlnPPLHGTk4GcDn9F8L63o8uhpbmzg
W2tYbfULmO7dvtCxqw2CEx7ep4fcrD3Hyk6/d+v/AABdDQ1fU9KsfE2m6VFaaVJqt9I1zi4lWJgF
XYZB8rMz7SVUYGQrDcADVfU77wm2mWt5Z2Wi6uunXcFrCsPlOLRnkRBtIB2EZBwMfdHSte90m5uP
FNhqkUsaRW9ncQNnO7dI0ZUgYwQNhzz6Vx9v4F18RXct1dW813NHaMXlv5pvNmt5zLklk/dq+SNq
DCdg2aI7q/8AWv8Al+eg3/X9f1sdet94YujqIW60iY20gmvwJIm8p06PL/dK7By3Tb7U6C08N+IM
6rb2+k6l5yeSbuNI5t6qc7d4zkAjpnqK5q58Ia1fWWpWRa2srB5I7i2s4r+aRWmWbzWPmbEeENgD
ClgpOVAwQ2rouiapo9szW8NnFcXV6kt2st9c3h8oKFOJZTuZ8KMcKAOMHGSl5iZ1BAIIIyD2qsmn
WUcVtElnbrHanNuoiUCE4K/IMfLwSOOxNWaKAM660DRr60Fpd6TYXFsJTN5M1sjp5hJJfaRjcSTz
15NW7i0tru0e0ubeKa2kXY8MiBkZfQqeCPapqKAMn/hHNOQWEVvCtrZWUhlisraNI4S+chioXOQS
SACBk5IJxizDo2l2+pzanBptnFfzDbLdJAqyyDjhnAyeg6nsKu0UAZMnhbw9NbPbS6FpbwSTG4eJ
rSMq0p4LkYwW9+tXJdMsJpDJLY20jkICzRKSQjbk5x/CeR6HkVaooAovbQWstmlvDHCjXLuVjUKC
zI5Y8dySST3Jrjf+bev+5U/9tK7a6/4+LL/rsf8A0W9cT/zb1/3Kn/tpQBzFv/x7R/7ortvAn/MQ
/wC2f/s1cTb/APHtH/uiu28Cf8xD/tn/AOzVctiFubdFFFMQUUUUAFFFFABRRRQAUUUUAFFFFABR
RRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQBl+JP+RW1f/rym/8AQDVrR/8Aknlh/wBgqP8A9FCq
viT/AJFbV/8Arym/9ANaPhqNJvBekRSDKPp0KsPUGMVhL+L8j0I/7j/2/wDoVtHZrPW/ExnguVWf
UkkiYW7lXX7JbrkEDBG5WH1BrY+3w/3Ln/wGk/8Aiayf+EN0v/n61z/we3v/AMeo/wCEN0v/AJ+t
c/8AB7e//Hqs4zW+3w/3Ln/wGk/+Jo+3w/3Ln/wGk/8Aiayf+EN0v/n61z/we3v/AMeo/wCEN0v/
AJ+tc/8AB7e//HqANb7fD/cuf/AaT/4mj7fD/cuf/AaT/wCJrJ/4Q3S/+frXP/B7e/8Ax6j/AIQ3
S/8An61z/wAHt7/8eoA0Lm5SeNI445yxmjPMDgYDqTyRjoKzPC8hsdKuYbm3uo5P7Tv3ANtJyrXc
rKR8vIKkEHuCKf8A8Ibpf/P1rn/g9vf/AI9R/wAIbpf/AD9a5/4Pb3/49QBrfb4f7lz/AOA0n/xN
H2+H+5c/+A0n/wATWT/whul/8/Wuf+D29/8Aj1H/AAhul/8AP1rn/g9vf/j1AGt9vh/uXP8A4DSf
/E0fb4f7lz/4DSf/ABNZP/CG6X/z9a5/4Pb3/wCPUf8ACG6X/wA/Wuf+D29/+PUAa32+H+5c/wDg
NJ/8TR9vh/uXP/gNJ/8AE1k/8Ibpf/P1rn/g9vf/AI9R/wAIbpf/AD9a5/4Pb3/49QBrfb4f7lz/
AOA0n/xNH2+H+5c/+A0n/wATWT/whul/8/Wuf+D29/8Aj1H/AAhul/8AP1rn/g9vf/j1AGt9vh/u
XP8A4DSf/E1x3iudbjxh4ZWOOYt5V+oBhcEkwgDAI5rb/wCEN0v/AJ+tc/8AB7e//Hq5rWvDVhB4
28L2qXGqmO4+17y+rXTuNsYI2uZCye+0jPQ5FZVvh+a/NHdl38Z/4Kn/AKRI6PR2az1vxMZ4LlVn
1JJImFu5V1+yW65BAwRuVh9Qa2Pt8P8Acuf/AAGk/wDiayf+EN0v/n61z/we3v8A8eo/4Q3S/wDn
61z/AMHt7/8AHq1OE1vt8P8Acuf/AAGk/wDiaPt8P9y5/wDAaT/4msn/AIQ3S/8An61z/wAHt7/8
eo/4Q3S/+frXP/B7e/8Ax6gDW+3w/wBy5/8AAaT/AOJo+3w/3Ln/AMBpP/iayf8AhDdL/wCfrXP/
AAe3v/x6j/hDdL/5+tc/8Ht7/wDHqANb7fD/AHLn/wABpP8A4mj7fD/cuf8AwGk/+JrJ/wCEN0v/
AJ+tc/8AB7e//HqP+EN0v/n61z/we3v/AMeoA1vt8P8Acuf/AAGk/wDiaPt8P9y5/wDAaT/4msn/
AIQ3S/8An61z/wAHt7/8eo/4Q3S/+frXP/B7e/8Ax6gDW+3w/wBy5/8AAaT/AOJo+3w/3Ln/AMBp
P/iayf8AhDdL/wCfrXP/AAe3v/x6j/hDdL/5+tc/8Ht7/wDHqANb7fD/AHLn/wABpP8A4mj7fD/c
uf8AwGk/+JrJ/wCEN0v/AJ+tc/8AB7e//HqP+EN0v/n61z/we3v/AMeoA1vt8P8Acuf/AAGk/wDi
aPt8P9y5/wDAaT/4msn/AIQ3S/8An61z/wAHt7/8eo/4Q3S/+frXP/B7e/8Ax6gDW+3w/wBy5/8A
AaT/AOJo+3w/3Ln/AMBpP/iayf8AhDdL/wCfrXP/AAe3v/x6j/hDdL/5+tc/8Ht7/wDHqANb7fD/
AHLn/wABpP8A4mj7fD/cuf8AwGk/+JrJ/wCEN0v/AJ+tc/8AB7e//HqP+EN0v/n61z/we3v/AMeo
A1vt8P8Acuf/AAGk/wDiaPt8P9y5/wDAaT/4msn/AIQ3S/8An61z/wAHt7/8eo/4Q3S/+frXP/B7
e/8Ax6gDW+3w/wBy5/8AAaT/AOJo+3w/3Ln/AMBpP/iayf8AhDdL/wCfrXP/AAe3v/x6j/hDdL/5
+tc/8Ht7/wDHqANb7fD/AHLn/wABpP8A4mj7fD/cuf8AwGk/+JrJ/wCEN0v/AJ+tc/8AB7e//HqP
+EN0v/n61z/we3v/AMeoA1vt8P8Acuf/AAGk/wDiaPt8P9y5/wDAaT/4msn/AIQ3S/8An61z/wAH
t7/8eo/4Q3S/+frXP/B7e/8Ax6gDW+3w/wBy5/8AAaT/AOJo+3w/3Ln/AMBpP/iayf8AhDdL/wCf
rXP/AAe3v/x6j/hDdL/5+tc/8Ht7/wDHqANb7fD/AHLn/wABpP8A4mj7fD/cuf8AwGk/+JrJ/wCE
N0v/AJ+tc/8AB7e//HqP+EN0v/n61z/we3v/AMeoA1vt8P8Acuf/AAGk/wDiaPt8P9y5/wDAaT/4
msn/AIQ3S/8An61z/wAHt7/8eo/4Q3S/+frXP/B7e/8Ax6gDW+3w/wBy5/8AAaT/AOJo+3w/3Ln/
AMBpP/iayf8AhDdL/wCfrXP/AAe3v/x6j/hDdL/5+tc/8Ht7/wDHqANb7fD/AHLn/wABpP8A4mj7
fD/cuf8AwGk/+JrJ/wCEN0v/AJ+tc/8AB7e//HqP+EN0v/n61z/we3v/AMeoA1vt8P8Acuf/AAGk
/wDiaPt8P9y5/wDAaT/4msn/AIQ3S/8An61z/wAHt7/8eo/4Q3S/+frXP/B7e/8Ax6gDW+3w/wBy
5/8AAaT/AOJo+3w/3Ln/AMBpP/iayf8AhDdL/wCfrXP/AAe3v/x6j/hDdL/5+tc/8Ht7/wDHqANJ
51uLq0Ecc3yylmLQuoA2MOpA7kVxv/NvX/cqf+2ldB/whul/8/Wuf+D29/8Aj1V/Fljb6Z8LNcsL
OPy7W10S4hhTcTtRYGCjJ5OAB1oA4C3/AOPaP/dFdt4E/wCYh/2z/wDZq4m3/wCPaP8A3RXbeBP+
Yh/2z/8AZquWxC3NuiiimIKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKAC
iiigAooooAy/En/Irav/ANeU3/oBrU8Lf8ihov8A14Qf+i1rL8Sf8itq/wD15Tf+gGtLwwwTwboz
HoNPgP8A5DWueTtU+R6Ef9x/7f8A0NiisTSPE9trEsEa2l3bG4g+0QGcJiWMEAkbWbGMjg4PNal5
e2+n2r3V1J5cKY3NgnGSAOB7kVakmrnK4ST5WtSeiiimSFFFZTa/Zx2upzyLKn9msyzoVG44UMCo
zyGBGPWk5JblKLlsatFRrLut1mZHTKbijD5hxnB96g0zUItV0y2v4FdYriMSIHADAH1wTTvrYVna
5booooEFFFFABRRRQAUUUUAFcl4g/wCSheDv+33/ANFCutrkvEH/ACULwd/2+/8AooVlW+H5r80d
2Xfxn/gqf+kSOtooorU4QooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKK
KKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACuf8AHf8AyTzxL/2Crr/0U1dB
XP8Ajv8A5J54l/7BV1/6KagDzi3/AOPaP/dFdt4E/wCYh/2z/wDZq4m3/wCPaP8A3RXbeBP+Yh/2
z/8AZquWxC3NuiiimIKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiig
AooooAy/En/Irav/ANeU3/oBrR8NKW8F6Qo6nToQP+/YrO8Sf8itq/8A15Tf+gGtHw1IkPgvSJZD
hE06FmPoBGK55q9S3kejDTA/9v8A6HKWfhbXdP0yOK0DrcXOl/ZneS43GzlHPykscK3TCdCAelKf
B0smg6isWnTpNKkWy0uTbKrsjbiQsShAcZUMTk5OcCu5+3w/3Ln/AMBpP/iaPt8P9y5/8BpP/ian
2Ef6/rzM/rU9zj9X0vUmXUf7P0GURX2lLaRQpJCnkMC/DDfgDDD7uadP4VmnsvEUkmnRPezx7bJ2
Klv+PdUODn5cnI7fyrrvt8P9y5/8BpP/AImj7fD/AHLn/wABpP8A4mh0Iu6fX/gv9RLEzVrf1t/k
Y+h6K+ka1cG3tI7awks4Bti2qpmBbcdo74K896j1fw/cXniK2nhC/YJyjagpP3jEd0eB3yTg+y1u
fb4f7lz/AOA0n/xNH2+H+5c/+A0n/wATVuCdvJ3M/ayu35W/r8/U5G60bWZ/GKal9jwqXRXzYhAq
tbmIqMn/AFjEHqCcdMA0WWmaxp1p4fmOlSzS2lhNazQRzRBlZtu05LAEfL2Oeeldd9vh/uXP/gNJ
/wDE0fb4f7lz/wCA0n/xNR7BJNXZp9Yk7aL+r/5nny+ENVltbGC/triWNbGKCNYHt/8ARpBnflpA
xXOQd0eTx0OBXQ6Zo9zp/i6e4itJGtpoz593eCJpCwCgeW6nfg45VgAMcY6V0H2+H+5c/wDgNJ/8
TR9vh/uXP/gNJ/8AE040oxd0KWInJWZaoqr9vh/uXP8A4DSf/E0fb4f7lz/4DSf/ABNamBaoqr9v
h/uXP/gNJ/8AE0fb4f7lz/4DSf8AxNAFqiqv2+H+5c/+A0n/AMTR9vh/uXP/AIDSf/E0AWq5LxB/
yULwd/2+/wDooV0f2+H+5c/+A0n/AMTXK69dxt4/8IuFmwv2zOYHB5iHQYyfwrKt8PzX5o7su/jP
/BU/9IkdpRVX7fD/AHLn/wABpP8A4mj7fD/cuf8AwGk/+JrU4S1RVX7fD/cuf/AaT/4mj7fD/cuf
/AaT/wCJoAtUVV+3w/3Ln/wGk/8AiaPt8P8Acuf/AAGk/wDiaALVFVft8P8Acuf/AAGk/wDiaPt8
P9y5/wDAaT/4mgC1RVX7fD/cuf8AwGk/+Jo+3w/3Ln/wGk/+JoAtUVV+3w/3Ln/wGk/+Jo+3w/3L
n/wGk/8AiaALVFVft8P9y5/8BpP/AImj7fD/AHLn/wABpP8A4mgC1RVX7fD/AHLn/wABpP8A4mj7
fD/cuf8AwGk/+JoAtUVV+3w/3Ln/AMBpP/iaPt8P9y5/8BpP/iaALVFVft8P9y5/8BpP/iaPt8P9
y5/8BpP/AImgC1RVX7fD/cuf/AaT/wCJo+3w/wBy5/8AAaT/AOJoAtUVV+3w/wBy5/8AAaT/AOJo
+3w/3Ln/AMBpP/iaALVFVft8P9y5/wDAaT/4mj7fD/cuf/AaT/4mgC1RVX7fD/cuf/AaT/4mj7fD
/cuf/AaT/wCJoAtUVV+3w/3Ln/wGk/8AiaPt8P8Acuf/AAGk/wDiaALVFVft8P8Acuf/AAGk/wDi
aPt8P9y5/wDAaT/4mgC1RVX7fD/cuf8AwGk/+Jo+3w/3Ln/wGk/+JoAtUVV+3w/3Ln/wGk/+Jo+3
w/3Ln/wGk/8AiaALVFVft8P9y5/8BpP/AImj7fD/AHLn/wABpP8A4mgC1RVX7fD/AHLn/wABpP8A
4mj7fD/cuf8AwGk/+JoAtUVV+3w/3Ln/AMBpP/iaPt8P9y5/8BpP/iaALVc/47/5J54l/wCwVdf+
imrW+3w/3Ln/AMBpP/iawfFl9b6n8LNcv7OTzLW60S4mhfaRuRoGKnB5GQR1oA4C3/49o/8AdFdt
4E/5iH/bP/2auJt/+PaP/dFdt4E/5iH/AGz/APZquWxC3NuiiimIKKKKACiiigAooooAKKKKACii
igAooooAKKKKACiiigAooooAKKKKACiiigAooooAy/En/Irav/15Tf8AoBq1o/8AyTyw/wCwVH/6
KFVfEn/Irav/ANeU3/oBq1o//JPLD/sFR/8AooVhL+L8j0I/7j/2/wDoZ9po8Ot+IPEsl7ear/o+
oRwwpBqtzAiJ9kt3wEjkVfvOx6d6s3vhWwtbSSaFfEd5IuMQQa/dB357F7hV9+SOlT+Hv+Q54s/7
Csf/AKRWtdBVnGefeHLfS/EpleHT/F9rbxySRNPc6/Nt8yNtrJhLpmzkHnGOOvSuh/4Q3S/+frXP
/B7e/wDx6uWm0GbT/hxqyalJDp95DqVzf2U00qhUk89nhO4HA3ZUYzn5sY7Vi6vpUpg8M6lrmii/
1LWda+1Xmn7I24+zyCOHEpVTsUL94jkE96Fql8vxt/wfu8wel/n+H9L7z0P/AIQ3S/8An61z/wAH
t7/8eo/4Q3S/+frXP/B7e/8Ax6vP5/A+vSWtil3ZXM2kLNdumkWxs5HtBI4aIbbgNCQqhl+U5Xdh
SRmvTvD+mto/h+w05pZ5Tbwqm6eUSPx2LBVzjoDgcAcULa4PexR/4Ryy0ySG7t7nVjKk0YAm1e6m
QgsFOUeQqeCeorL0HQbbWbO7vb291lp21O/T93rF3EoVLqVFAVJAoAVQMADpXVX/APx7p/12i/8A
Ri1k+Df+QHc/9hXUv/S2agA/4Q3S/wDn61z/AMHt7/8AHqzY9I0FtYvtLe58QRT2cKXDGTXLwK8b
bvmU+dyAVIPTBrsq47xv4Zvtbls5dMKJJKGsL5mbbmzkIMmPVhtGP940nfp/X9fkP+v6+RJpGgaP
rOkWupQS+IoobmMSRrNrl6r7T0JAmOMjn8aZo+i6HrVtPPbT+IUSG5ltmEmuXgJaNyjEYmPGRxWF
4y8Na7qHiO1n07TQ0Gnm0exlt1tlKqkuZUZ5P3oO3G0IVUjOSc4qZNB1yztbSYaTJO9j4kub7yYp
og80Enm4ZCzBf+Wg4Yg8Gmmm/wCu6/Rv7hdP67N/nY6f/hDdL/5+tc/8Ht7/APHqP+EN0v8A5+tc
/wDB7e//AB6vPZfB3iG+t7WTUdKu2smur6aXTYGspZEeWXfHIRPuib5cjIO5d3HBNeoeH9NbR/D9
hpzSzym3hVN08okfjsWCrnHQHA4A4oWquwe9kUf+EN0v/n61z/we3v8A8erL16wXS9ImsrS81NIp
r3TVd31G4eUCS7SNwsjOXUFePlI6n1rtK5bxd/x7j/r/ANJ/9LkoAs/8Ibpf/P1rn/g9vf8A49XN
a14asIPG3he1S41Ux3H2veX1a6dxtjBG1zIWT32kZ6HIr0WuS8Qf8lC8Hf8Ab7/6KFZVvh+a/NHd
l38Z/wCCp/6RIu/8Ibpf/P1rn/g9vf8A49R/whul/wDP1rn/AIPb3/49XQUVqcJz/wDwhul/8/Wu
f+D29/8Aj1H/AAhul/8AP1rn/g9vf/j1dBRQBz//AAhul/8AP1rn/g9vf/j1H/CG6X/z9a5/4Pb3
/wCPV0FFAHP/APCG6X/z9a5/4Pb3/wCPUf8ACG6X/wA/Wuf+D29/+PV0FFAHP/8ACG6X/wA/Wuf+
D29/+PUf8Ibpf/P1rn/g9vf/AI9XQUUAc/8A8Ibpf/P1rn/g9vf/AI9R/wAIbpf/AD9a5/4Pb3/4
9XQUUAc//wAIbpf/AD9a5/4Pb3/49R/whul/8/Wuf+D29/8Aj1dBRQBz/wDwhul/8/Wuf+D29/8A
j1H/AAhul/8AP1rn/g9vf/j1dBRQB5xey6BYajqVvNB4tNrpjRi9v01u5MMO9QwJH2nzCAGGSEOO
SeBmumXwfpLoHS81tlYZBGvXpBH/AH+rndV0nX5b/wAYWNnpLmPXRHHDfvNEIYl8hY3LDd5mR82A
EOTjkDms2bwDqM/ip2vBqE0SzwNY6hbPaKLaFFX5Szo06EFWOI/lbdzjLGiOtk/67jlpqjtf+EN0
v/n61z/we3v/AMeo/wCEN0v/AJ+tc/8AB7e//Hq4aXwdrKrrVtp+kOunT3UVzKt19nS6v184tLD5
sbnfGVzjzcH5tpJBONhfCFvqmt6Q0/hSOy0WCC7WSxnMLIjOYtv7tGZBkqxwuQCN3BNC1E97GvZe
G9LvWul/4qaD7POYcz61eqJMAHen77lTng+xon8PaDbX1pZTahri3N3v8hP7cvjv2jLc+bgYHrXE
a7oA0u8062utAjurO68Uyzw2EawlZo2tmxhWYIOQThiOlXbTwbfWtxoN/d+HY72K1v7uRLEGBpLK
CQ5hQF2CkIRnCsduflziiOqXy/Jf5ibt/Xm/8jqrLw3pd610v/FTQfZ5zDmfWr1RJgA70/fcqc8H
2NWv+EN0v/n61z/we3v/AMerlJ/CN/EZ86Kl3pn9vy3sulo0QF3C0W1TtZghxJh9rkfdz1xmLT/A
dxc3ulDWNFtpdNhXUHS0nMcq2gldDDHtJIyFDD5cqvQHpST0T8v0TH1/ru/6+Z2H/CG6X/z9a5/4
Pb3/AOPUf8Ibpf8Az9a5/wCD29/+PVN4RtL+x8IaTaaoGF9DapHMHcOQwGOWBIP1zW1VNWYI5/8A
4Q3S/wDn61z/AMHt7/8AHqP+EN0v/n61z/we3v8A8eroKKQHP/8ACG6X/wA/Wuf+D29/+PUf8Ibp
f/P1rn/g9vf/AI9XQUUAc/8A8Ibpf/P1rn/g9vf/AI9R/wAIbpf/AD9a5/4Pb3/49XQUUAc//wAI
bpf/AD9a5/4Pb3/49R/whul/8/Wuf+D29/8Aj1dBRQBz/wDwhul/8/Wuf+D29/8Aj1H/AAhul/8A
P1rn/g9vf/j1dBRQBz//AAhul/8AP1rn/g9vf/j1H/CG6X/z9a5/4Pb3/wCPV0FFAHP/APCG6X/z
9a5/4Pb3/wCPUf8ACG6X/wA/Wuf+D29/+PV0FFAHP/8ACG6X/wA/Wuf+D29/+PUf8Ibpf/P1rn/g
9vf/AI9XQUUAYdtoVppGoWs1rcamzSOY2W51O5uFI2MfuySMM5A5xmub/wCbev8AuVP/AG0rtrr/
AI+LL/rsf/Rb1xP/ADb1/wByp/7aUAcxb/8AHtH/ALortvAn/MQ/7Z/+zVxNv/x7R/7ortvAn/MQ
/wC2f/s1XLYhbm3RRRTEFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRR
RQAUUUUAZfiT/kVtX/68pv8A0A1a0f8A5J5Yf9gqP/0UKq+JP+RW1f8A68pv/QDVrR/+SeWH/YKj
/wDRQrCX8X5HoR/3H/t/9DNW/ktfEGvppek69dsbxDdyW72YiEv2aHAXzZFbGzy88dSas/2vrX/Q
ueJf+/mnf/Hqzl1i40fxFrLRQNcx3OvLbtbxRbpZGOnQMuwlgq8pyW4wckjGa228VI0MIt9I1K5v
HLiSyjWNZYdhAbeXcJwSuMMd2QVyOas5LFX+19a/6FzxL/3807/49R/a+tf9C54l/wC/mnf/AB6r
M/i22RI5bXT9RvYfIW4nkt4lH2eM5wXV2VieG+VQzDb05GbX2y9HiS3gE9rJp1zaySxqsLCRWQx8
79+CpDnjaOnU07CMz+19a/6FzxL/AN/NO/8Aj1H9r61/0LniX/v5p3/x6ksPiDoepeJP7EglBnMk
kUb/AGiBg7pncuxZDIv3W5ZADjryMlh4+0zUk1T7NBNJNp0Rmkgjnt5XdRnONkrBTx0cqfbrSuFu
hJDqOoT3MEV5ouvW0DSpmW4eyKKdw27vLkLYzgcDvWdpeozwRXcWk6L4jubRdQvP3qPYhWk+0SeZ
t3yBtvmbwMjOAK2LXXF1i2ZW0+9sZY5LeTyrtUDMjuNrjYzDB2sMEgjByBWN4X1WeHUbfSlSMwXN
1rM7sQdwaO/YDBzjHznPHpTtrYFqrov/ANr61/0LniX/AL+ad/8AHqP7X1r/AKFzxL/3807/AOPV
p3HibSbXVRps1y63BdI2IgkMaO/3UeQLsRmyMKxBORgcjORrHj3SbO0vktbtvtkMEzxSS2Ny9uxj
wGO9EIdVYjdsJxzSGlrYk/tfWv8AoXPEv/fzTv8A49R/a+tf9C54l/7+ad/8eq5/wl+jR3y2MtzJ
9pEscDstrKYklcKVUybdqlt64yRnOOtYGheM7/UvEIsmu9JuQb65tpbG2RlubSONnCzSHzGyp2qO
VXmQYPYuwulzT/tfWv8AoXPEv/fzTv8A49R/a+tf9C54l/7+ad/8eq2njLQnjuJPtcqxwxNN5j2s
qrLGvVoiVxKORym7qPUZt22v6fdS28SvcRzXEUkscVxaywuUjIDEq6gjBZeuM54zSCxk/wBr61/0
LniX/v5p3/x6qmq3iTaJcT6npuuQTJd2OyAtamZ3Fyhh2lXMeDJgHcRxnpwaW68dxwJq1/bxLd6b
aaRDqUBRHV5d5k4PBIGEX+HjJJo16+j1LSLe8iSZElvdIYLNC8TD/T06q4DD8RTsD0/r0/zLX9r6
1/0LniX/AL+ad/8AHq5zWNR1N/GfhqV9F1yOWP7V5cUj2XmSZjGdm2Qpx1O8jjpk1S8M2qweJYbx
9Os7PfqmosuowPme9ZXkH2eQbBxglxlmz5Q4B6Jaa5rviDxT4Y1C9tUsop4LuWx/dIQA0JPLJO5f
Hy8lYj7c/LhXdqafp+Z6GXr/AGiS/u1P/SJHY/2vrX/QueJf+/mnf/HqP7X1r/oXPEv/AH807/49
WT4P13WE03wza6jdQXf27SpbozmN1kygi2hmZ23H52JPGeOB3m8PeKtb1+4tABp8MJ0q21CdvJdi
xkMgZF+cYHyjBOcc8HPG8la/l/wf8mcFna/9f1qaH9r61/0LniX/AL+ad/8AHqP7X1r/AKFzxL/3
807/AOPVj6b4q8T3dnYuIdNubnVNIkvrSGKF4/LlTy/kYtIQ4Pmf7GMYzzkdToV7/bOiut7JDdSq
7290gtGgVWBwyNGzP0BwfmIPUHBFDTX9edhbGd/a+tf9C54l/wC/mnf/AB6j+19a/wChc8S/9/NO
/wDj1c5aafpXhk+OdZ0zRNLivNLkZ7Vhaovl4tY22jaAQpJOQCOp9a6WLWtVg1nTbK+Nky3lncXR
MUTJ5ewxbUyXO7AdsnAzgcCl0v5X/C47Mb/a+tf9C54l/wC/mnf/AB6j+19a/wChc8S/9/NO/wDj
1c7/AMJ74ju7Gym0/S7eVhpUOo3bERiM793AaS4j8tRsPz4kxnpxz0njOaRfD9nKYIGU6hZ+ZFMG
brMgGCjLhgxBB5HGCDmnZ3t52/Gwhv8Aa+tf9C54l/7+ad/8eo/tfWv+hc8S/wDfzTv/AI9UHgC3
ma21XUr02ct9cajcRyXENsY3dY5WRVYlmLAY+UZ+UYHPU0P+E8voNY1JXtPtOmxWl3cWrpAIXkNu
yqyjMrswySNxRORwGB4X+V/wuO2rS72Nb+19a/6FzxL/AN/NO/8Aj1H9r61/0LniX/v5p3/x6luN
Y1jStClvLyXTru4kMAgW2heNYvNcIC4LsWUE53DbnB4HWoNb1vX9F0+zt0Wz1HVbu8+zI9tbhEQe
WZOY5J1y2FIx5oznP+yR6CWupN/a+tf9C54l/wC/mnf/AB6j+19a/wChc8S/9/NO/wDj1UF8TeIU
s9Ovb+C0sLISSRahcGEXGxllCKNsU58vdzk5kCHhuATWtoWralcavfWGsNbw3KZlgtY7ZlPkbyqv
5vmMsgOB0CkHqoyKAbsQf2vrX/QueJf+/mnf/HqP7X1r/oXPEv8A3807/wCPVhf2nqmjeIfEV9bP
ZvZHWrSCaCWFjI/mRwJlZA4C43A4KtnHarC+MNcutcv7DT7SG5R7e6fTnkgEO+SF1QqczEuNzEZK
xAkcEg5AtUn/AFtcbVjV/tfWv+hc8S/9/NO/+PUf2vrX/QueJf8Av5p3/wAeq/ompSanocsk9xHN
dRNJDcbLZrfZIvVCjO5BHHO4g9QcEVxXhvxJqXhzwVpn2oWt/F/YUl9bw28TQyRrCqfK7M7Bgd4G
4BcY6HPB3/ru/wBASvsdN/a+tf8AQueJf+/mnf8Ax6j+19a/6FzxL/3807/49WN/wmPiay0m+k1D
SYjdKLb7Nt8mPJmk8sFkFzJ8oPIYugbkfLjNTReJvE7LZ2Vxa2Vpfz6kbIyTRKwC+Q0oYxRTvtII
AwZORzxnh2YjT/tfWv8AoXPEv/fzTv8A49R/a+tf9C54l/7+ad/8eq74e1i71Pw/LdXMULXkE1xA
4iyiSNFIyZG4naDtBwScZ6muRt/G3id9Nk1A2lrJbt9jERewntgJJpgjR7nc+YFUgiRRtJIPtS62
/rUDof7X1r/oXPEv/fzTv/j1H9r61/0LniX/AL+ad/8AHqoa14q1fRNVsbP/AEe8CPbrqDR2RjRB
NL5aFXafIPX5Qsh+XkqDwun+KNZm1Kwe5+wGwvNUutOEUcDrKnlGXa+8uQciIAjaOuc9qaV/6/ru
HS/9d/0L39r61/0LniX/AL+ad/8AHqP7X1r/AKFzxL/3807/AOPVzlj4h8S6fofyPHqd3e61c2lt
+45iCvKTnzJ1DjCYVdyYH97GDqR+I9ev4NP04RWVhqVyt000syCeMLAwQgJHNgMSwyPMbbgg5qW7
K/8AW1x21t/X9aF/+19a/wChc8S/9/NO/wDj1H9r61/0LniX/v5p3/x6ofDF+ml/CbTL+aQRpb6U
kjP5ZkxhM52ggn6AjPrWXZeMfEV35NhJBZ2upNqv2CR57b5VU2xmDGNJ2wegx5h49CcC3G0nFdP8
7C6XNr+19a/6FzxL/wB/NO/+PUf2vrX/AELniX/v5p3/AMerOg8UazqkFnp0DWFvqMzXqzXMlu8k
JFvJ5Z2RiRSC25Tyx289ak0TUZ9I+DFnqVuiPPaaMJkVwSpZY8jIBzjj1qejf9df8ilFtpF3+19a
/wChc8S/9/NO/wDj1H9r61/0LniX/v5p3/x6oNQ8Q64+o3tho9tazTQ2dpcrlN5AlkcOdpkQNhUy
BuXvyeBWXfeONakaMaHbQX8MFgl5c3JhSFJMs4IxNcRtCoMbZJEmM8j5eXYla/1/Xc2/7X1r/oXP
Ev8A3807/wCPUf2vrX/QueJf+/mnf/Hqm0bVtV1TxBqsEgtILGwnWLZ5bNLIWhR/vb8DBY84ORjp
jJzvEfiXWNM1TVhZyacllpWmx38qXMDs8+WkygcSAJxHgEq3J6HpRbYaV9i3/a+tf9C54l/7+ad/
8eo/tfWv+hc8S/8AfzTv/j1Z1z4u19vEk8FlpKNptpcwW0zSmJSxkCHO9p1KH94ML5T7iMA/NxNb
634q1HSL++sIbB2ivZbWKAW7M22OcoZDmVQx2A/JlckZzztpf1/X3i6XLf8Aa+tf9C54l/7+ad/8
eo/tfWv+hc8S/wDfzTv/AI9WDb61qt5q2o3mipYX93Jp9k6XCWkkZMZllV8xPMMlSHIXKtzgkkc3
Bq+o6h4o8Nz2GrQy2U2nXMs6LaSos5R4g2IzICjckDdkr8wOc8H9fn/kPrb+un+Zpf2vrX/QueJf
+/mnf/HqP7X1r/oXPEv/AH807/49XPWvjvxK+iXerXGlW8Vu+lzX9pvMQ2lACF+W4dpR8wBbZHjj
I+bA05fFesadJqNteJZXM8cVpLbyQQvEi/aJWjAcF2JCkAkgjI7CnZhbr/XT/Mvf2vrX/QueJf8A
v5p3/wAeo/tfWv8AoXPEv/fzTv8A49UOt63r+i6fZ26LZ6jqt3efZke2twiIPLMnMck65bCkY80Z
zn/ZOz4b1C+1PRkn1K2S3uxJJFIiOjDKMVzhHcKeOV3NtORk4pCKmn395dajAl9pOs2igkxyXb2h
QttPH7qRmzjd2xxWB/zb1/3Kn/tpXbXX/HxZf9dj/wCi3rif+bev+5U/9tKAOYt/+PaP/dFdt4E/
5iH/AGz/APZq4m3/AOPaP/dFdt4E/wCYh/2z/wDZquWxC3NuiiimIKKKKACiiigAooooAKKKKACi
iigAooooAKKKKACiiigAooooAKKKKACiiigAooooAy/En/Irav8A9eU3/oBq1o//ACTyw/7BUf8A
6KFVfEn/ACK2r/8AXlN/6AataP8A8k8sP+wVH/6KFYS/i/I9CP8AuP8A2/8AoZUGhjWde8QP/aF5
ZSWetLNE9qYwd5sLdQTvVgcBm46HPINa58MbYojbazqVteIXMl7GIWln3kFt4eNk6quMKMYwMDim
+Hv+Q54s/wCwrH/6RWtdBVnGYE3hWNo447XVNQsovIW3mSAxH7Qgz98vGxB+ZuVKnn2GJJ/D0sus
wajFrmo26wLsjtIkt/KCHbuX5oi2DsGfmyOxFbdFFwMaDw+1veSPHrGoCxdnY6efJMPz5LAN5fmA
ZJIw/HQccVRi8GCNZFOv6s6NZtZIjC3CxRHGAoEQ5GOCc++cDHT0UAYC6K1hcG8bU725Mi2tuY5h
EFAjkGG+RFO4lmJ5x8xwAMAYGjaJqN55OraZqNraT2t/q8BW5s2nV1kvnOflkQgjYO5612l//wAe
6f8AXaL/ANGLWT4N/wCQHc/9hXUv/S2ai+twWhVn8JXlxeys+qwizu7mC8vIVtCHeaIJjy3LnYhM
SZUhj1wwzxzNv4P1a61XWLOWza3sLyG8hS7uEH7hZWyPKRbp15OMgRxZAyTng+oUUDuzlpfB3mw6
hH9vx9sv7W9z5P3PJEXy/e5z5XXtu6HHL7Xwj9jWF4r7E8d5cTNJ5XEkM8jO8JGenIwc9VBx1FdN
RQ3fT+un+QuljiNH+Hlvo0E8UEeht/ozWsLHRUDOhx/x8MGzKcAA7SgOTkHjEsHg3U7QWU9vrkP2
22+0R7pbN3hEUpU+XGhl3IF2Lty7AcjGMAdlRQ9QONtvAK2+ltp7aiXim0ZNJuGEOGbZu2yL82F+
+2QQc8cjBy3XILy20iGG+uILi4S+0kGSCAxKR9vTHyl2I49/yrtK5bxd/wAe4/6/9J/9Lkptt7g9
f6/rsLoOueH9aMunhNMhvIb2dvsAkjaTdHMw87ZgEEkbs46nqetc1qN/4PsvHmgapp13ocEXmXn2
+7t5IVXf5Yx5rr/Flj945yfetu38I30K6b++tVe11m61BmBJ+SUTbcccsPMXIPHB5NcNe+D9YtfG
uhSX5ivr67idfn1a4G+SEM5k83YTFkuGCIu0FcdDmsavwq/dfmv6/rT0MB/Hlb+Wp/6RP/hz0DWb
Hwta+Er3WItB0e/s4o5NRVVgiMczhc7w20jJA+9zV/SNQ8MzaY+paZcaQLSGFYppraSMpCijcEZl
4AUMTg8DPvUN5pGraj4AutIvbuCfVrmxeB5z8qGRlIycKOOeoUZ67R0rGvfCWsa3a30l+bO1uZIr
SKGC1u5Sj+RIZMvKFR13E4+UZXGQTnFbd1/X/BODon/XT/gm20vhCfQVvXk0OTRoojbLOWiNukZI
BjDfdCkhQV6ZAqSHVfC2g6Ta+Tf6Pp2myIZLfZNFDCykjLJghSMsOR3b3rnJvA13LpscixpHfJqA
vGgGs3jeZiIxYN0f3gbByCFAwAuD96r2l+EJ7G/025226JBbXizRi4lmPmTuj8PJln+6csSMnnaM
4CfX+ul/zDTQ6b7Hp89vcH7NayQXg3TnYpWcFQMt2b5QBzngCsq4u/B/iDTfPubjQtSsLWUL5kjw
zRQyHAAychW5AHfmorbwzOfhvH4YuLhEn/s37E80RJUHZtyOhI/Lj0rEj8D30ljN5sNtBdPNZ/e1
S6vd0cMwkPzzfdzzhAvB6sc8Npc1ugumptzTeB5tLstTnl8PPp1m4js7p2hMUDDHEbnhTwOAe3tR
d+KNDfxH/YOpy6eitBb3Vq1zOmLh2dtoRW6kFFIIJ5I6Vn6j4W1mS51N7O6jWC91Jbp4EvJbYyRC
BYyDJGu5TvUNhfvAAEjJrMg8F+IrSwfT4v7KliudFh0maeS4kzFsMg8xU8s7/lcHaWXkYz3oX9fd
/n1Hp/Xr/kdRZ67plm2tpOtppdnpt2I5J3kWON2kRJC5yAFJaTHU5PPeiWfwlpVuPEDNolsly3mJ
fkxRiZ2U8iT+IkZ5zyM1hap4Iv7i+uZ7eSOWP7dFfRI1/NbO7C38hlaSIbkwAGDAtnJBA61PF4V1
PTE0y602GykubdboS2txfTlMzsGLiZ1kdmG3BJUbtxPy9KmW2n9af5ho2rmp4VtdFvvClvd2Wh2F
hbarbrNPawwoEcOvIbCgNwccjmtBfD2iJpTaUuj6eunMdzWgtkEJOc5KYx1GelUfDGmavoumaXpl
y1k1pa6fHDI0RcuZ1wDgkAbMewOa6Crla7tsJMzX8PaJK1k0mj6e7WIAtC1shNuBgjy+PlxgdMdK
lsdG0vS5ribT9Ns7SW5bdO9vAsZlPJyxAG48nr6mrtFSBWfTbGTzd9lbt5sizSZiU73XG1jxyw2r
g9RgelVZPDehSvO8mi6c73BLTM1qhMpIwS3HORwc1p0UAVrLT7LTbNLOxtLe1tUztggjCIuTk4UD
AyST+NV9O0DRtHMp0vSbCxMwAlNrbJFvx03bQM9T19a0aKAM+10HR7GxnsbTSbC3s7jPnW8VsiRy
ZGDuUDByOOafbaNpdlb29va6bZwQ2zmSCOKBVWJjkFlAGFJ3Hkep9au0UAQxWkFvC8VvDHCjszER
oFBZiSzYxjJJJPqa5vQvAGjaFcXEyKLlpggKyWltEo2tuB2wxICwbBBYEjHBHOeqooWjuD10KN3o
ulX9ytzeaZZ3M6oY1lmgV2CnkqCRnHtUq6bYp5e2yt18uVpkxEo2SNnc444Y7myepyfWrNFAGbN4
e0S4N2Z9H0+U3pU3W+2RvP2/d35HzY7ZziludA0a90+HT7rSbCeygx5VtLbI0ceBgbVIwMDjitGi
gCBLK0isRYx2sKWYj8oW6xgRhMY27emMcYqtbaFo9l5X2TSrGDyiGj8q3RdhAIBGBxgMw+jH1rQo
oAzrrQNGvrT7JeaRYXFt5pm8ma2R08wkkvtIxuJJyevJq3DaW1vZpZw28UVqieWsKIFRVxjaFHAG
O1TUUAYyeEfDUdpLaJ4e0lbaXb5kK2UYR8HIyNuDgkkfWrEugaNOLITaRYSCxx9kD2yH7PjGPLyP
lxgdMdBWjRQBFFbQQSTSRQxxvM2+VkUAyNgDLHucADnsBWVceFNGvfEX9uXtlDd3gijiiNxEkgh2
MzBkyMq2W6g9h6VtUUAUpdH0yfU4tTl060k1CFdsV08CmVBzwHxkDk9D3NJcaLpV3YvY3OmWU1o7
mR4JIFaNnJ3FipGCcknPrzV6igDNm8O6JcW32afR9Plt/LSLyntUZdiZ2LgjGFycDtnipJdF0qaC
0gl0yykisyrWsbwKVgK8KUGPlI7Yxir1FFwM6LQNGhN4YtJsIzfZ+1lLZB9oznPmcfN1PXPU1Yk0
6yl87zLO3fz4hBLuiU+ZGM4RuOV+Y8Hjk+tWaKAuZq+HtETSm0pdH09dOY7mtBbIISc5yUxjqM9K
u29tBZ20dtbQxwQRKEjiiUKqKOgAHAFS0UAVbr/j4sv+ux/9FvXE/wDNvX/cqf8AtpXbXX/HxZf9
dj/6LeuJ/wCbev8AuVP/AG0oA5i3/wCPaP8A3RXbeBP+Yh/2z/8AZq4m3/49o/8AdFdt4E/5iH/b
P/2arlsQtzbooopiCiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAK
KKKAMvxJ/wAitq//AF5Tf+gGrWj/APJPLD/sFR/+ihVXxJ/yK2r/APXlN/6Aa0fDUaTeC9IikGUf
ToVYeoMYrCX8X5HoR/3H/t/9Cto7NZ634mM8Fyqz6kkkTC3cq6/ZLdcggYI3Kw+oNbH2+H+5c/8A
gNJ/8TWT/wAIbpf/AD9a5/4Pb3/49R/whul/8/Wuf+D29/8Aj1WcZrfb4f7lz/4DSf8AxNH2+H+5
c/8AgNJ/8TWT/wAIbpf/AD9a5/4Pb3/49R/whul/8/Wuf+D29/8Aj1AGt9vh/uXP/gNJ/wDE0fb4
f7lz/wCA0n/xNZP/AAhul/8AP1rn/g9vf/j1H/CG6X/z9a5/4Pb3/wCPUAaFzcpPGkccc5YzRnmB
wMB1J5Ix0FZnheQ2OlXMNzb3Ucn9p37gG2k5VruVlI+XkFSCD3BFP/4Q3S/+frXP/B7e/wDx6j/h
DdL/AOfrXP8Awe3v/wAeoA1vt8P9y5/8BpP/AImj7fD/AHLn/wABpP8A4msn/hDdL/5+tc/8Ht7/
APHqP+EN0v8A5+tc/wDB7e//AB6gDW+3w/3Ln/wGk/8AiaPt8P8Acuf/AAGk/wDiayf+EN0v/n61
z/we3v8A8eo/4Q3S/wDn61z/AMHt7/8AHqANb7fD/cuf/AaT/wCJo+3w/wBy5/8AAaT/AOJrJ/4Q
3S/+frXP/B7e/wDx6j/hDdL/AOfrXP8Awe3v/wAeoA1vt8P9y5/8BpP/AImsDxKst5Zl7e3uZAt7
pjECB92EvEdyBjJAXk+gqz/whul/8/Wuf+D29/8Aj1H/AAhul/8AP1rn/g9vf/j1AGt9vh/uXP8A
4DSf/E1yuvXcbeP/AAi4WbC/bM5gcHmIdBjJ/CtT/hDdL/5+tc/8Ht7/APHq5rWvDVhB428L2qXG
qmO4+17y+rXTuNsYI2uZCye+0jPQ5FZVvh+a/NHdl38Z/wCCp/6RI7v7fD/cuf8AwGk/+Jo+3w/3
Ln/wGk/+JrJ/4Q3S/wDn61z/AMHt7/8AHqP+EN0v/n61z/we3v8A8erU4TW+3w/3Ln/wGk/+Jo+3
w/3Ln/wGk/8Aiayf+EN0v/n61z/we3v/AMeo/wCEN0v/AJ+tc/8AB7e//HqANb7fD/cuf/AaT/4m
j7fD/cuf/AaT/wCJrJ/4Q3S/+frXP/B7e/8Ax6j/AIQ3S/8An61z/wAHt7/8eoA1vt8P9y5/8BpP
/iaPt8P9y5/8BpP/AImsn/hDdL/5+tc/8Ht7/wDHqP8AhDdL/wCfrXP/AAe3v/x6gDW+3w/3Ln/w
Gk/+Jo+3w/3Ln/wGk/8Aiayf+EN0v/n61z/we3v/AMeo/wCEN0v/AJ+tc/8AB7e//HqANb7fD/cu
f/AaT/4mj7fD/cuf/AaT/wCJrJ/4Q3S/+frXP/B7e/8Ax6j/AIQ3S/8An61z/wAHt7/8eoA1vt8P
9y5/8BpP/iaPt8P9y5/8BpP/AImsn/hDdL/5+tc/8Ht7/wDHqP8AhDdL/wCfrXP/AAe3v/x6gDW+
3w/3Ln/wGk/+Jo+3w/3Ln/wGk/8Aiayf+EN0v/n61z/we3v/AMeo/wCEN0v/AJ+tc/8AB7e//HqA
Nb7fD/cuf/AaT/4mj7fD/cuf/AaT/wCJrJ/4Q3S/+frXP/B7e/8Ax6j/AIQ3S/8An61z/wAHt7/8
eoA1vt8P9y5/8BpP/iaPt8P9y5/8BpP/AImsn/hDdL/5+tc/8Ht7/wDHqP8AhDdL/wCfrXP/AAe3
v/x6gDW+3w/3Ln/wGk/+Jo+3w/3Ln/wGk/8Aiayf+EN0v/n61z/we3v/AMeo/wCEN0v/AJ+tc/8A
B7e//HqANb7fD/cuf/AaT/4mj7fD/cuf/AaT/wCJrJ/4Q3S/+frXP/B7e/8Ax6j/AIQ3S/8An61z
/wAHt7/8eoA1vt8P9y5/8BpP/iaPt8P9y5/8BpP/AImsn/hDdL/5+tc/8Ht7/wDHqP8AhDdL/wCf
rXP/AAe3v/x6gDW+3w/3Ln/wGk/+Jo+3w/3Ln/wGk/8Aiayf+EN0v/n61z/we3v/AMeo/wCEN0v/
AJ+tc/8AB7e//HqANb7fD/cuf/AaT/4mj7fD/cuf/AaT/wCJrJ/4Q3S/+frXP/B7e/8Ax6j/AIQ3
S/8An61z/wAHt7/8eoA1vt8P9y5/8BpP/iaPt8P9y5/8BpP/AImsn/hDdL/5+tc/8Ht7/wDHqP8A
hDdL/wCfrXP/AAe3v/x6gDW+3w/3Ln/wGk/+Jo+3w/3Ln/wGk/8Aiayf+EN0v/n61z/we3v/AMeo
/wCEN0v/AJ+tc/8AB7e//HqANb7fD/cuf/AaT/4mj7fD/cuf/AaT/wCJrJ/4Q3S/+frXP/B7e/8A
x6j/AIQ3S/8An61z/wAHt7/8eoA1vt8P9y5/8BpP/iaPt8P9y5/8BpP/AImsn/hDdL/5+tc/8Ht7
/wDHqP8AhDdL/wCfrXP/AAe3v/x6gDW+3w/3Ln/wGk/+Jo+3w/3Ln/wGk/8Aiayf+EN0v/n61z/w
e3v/AMeo/wCEN0v/AJ+tc/8AB7e//HqANb7fD/cuf/AaT/4mj7fD/cuf/AaT/wCJrJ/4Q3S/+frX
P/B7e/8Ax6j/AIQ3S/8An61z/wAHt7/8eoA0nnW4urQRxzfLKWYtC6gDYw6kDuRXG/8ANvX/AHKn
/tpXQf8ACG6X/wA/Wuf+D29/+PVX8WWNvpnws1yws4/LtbXRLiGFNxO1FgYKMnk4AHWgDgLf/j2j
/wB0V23gT/mIf9s//Zq4m3/49o/90V23gT/mIf8AbP8A9mq5bELc26KKKYgooooAKKKKACiiigAo
oooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigDL8Sf8itq//XlN/wCgGtTwt/yKGi/9
eEH/AKLWsvxJ/wAitq//AF5Tf+gGtLwy6xeDNHkc4RdPhZj6ARiueTtV+R6Ef9x/7f8A0NiisKLx
VbPpb6lLZXsFrsR4XkVD5+84UIFYnJOODg8jNWrLWobua6gmt57K4tlEkkNxtyEOcMCrMpHBHXjH
NVzxOZ05LoadFYbeKrD/AIRqLXoo55rWUqqIgXeSz7AMEgdferumatFqf2hBDNb3FtJ5c0E4AZDg
EfdJBBBByCaFJN2B05JXaL9FYVp4ptru+jtvsd3Eks8ttFPIE2SSR53AYYsPunkgdK3acZKSuhSi
4uzCiiimSFFFQWt7b3omNvJv8mVoZOCMOvUc0X6BbqT0UUUAFFUk1SB9al0oLJ58UCzsxA27WJAA
Oc54Pas+XxTbQ6lNaPZ3YjhuI7aS5AQxrI4BUY3budwGdvep51p5/wDDFqnJ9DdoooqiArjfF8lx
ZeKfDOqR6bf30Fp9q81bKAysu5FUe3U9z2NdlRUTjzKx0YWv7CpztX0at5NNP8zkv+E7/wCpU8Uf
+C7/AOyo/wCE7/6lTxR/4Lv/ALKutoqeSf8AN+Bt7fC/8+f/ACZnJf8ACd/9Sp4o/wDBd/8AZUf8
J3/1Knij/wAF3/2VdbRRyT/m/APb4X/nz/5Mzkv+E7/6lTxR/wCC7/7Kj/hO/wDqVPFH/gu/+yrr
aKOSf834B7fC/wDPn/yZnJf8J3/1Knij/wAF3/2VH/Cd/wDUqeKP/Bd/9lXW0Uck/wCb8A9vhf8A
nz/5Mzkv+E7/AOpU8Uf+C7/7Kj/hO/8AqVPFH/gu/wDsq62ijkn/ADfgHt8L/wA+f/Jmcl/wnf8A
1Knij/wXf/ZUf8J3/wBSp4o/8F3/ANlXW0Uck/5vwD2+F/58/wDkzOS/4Tv/AKlTxR/4Lv8A7Kj/
AITv/qVPFH/gu/8Asq62ijkn/N+Ae3wv/Pn/AMmZyX/Cd/8AUqeKP/Bd/wDZUf8ACd/9Sp4o/wDB
d/8AZV1tFHJP+b8A9vhf+fP/AJMzkv8AhO/+pU8Uf+C7/wCyo/4Tv/qVPFH/AILv/sq62ijkn/N+
Ae3wv/Pn/wAmZyX/AAnf/UqeKP8AwXf/AGVH/Cd/9Sp4o/8ABd/9lXW0Uck/5vwD2+F/58/+TM5L
/hO/+pU8Uf8Agu/+yo/4Tv8A6lTxR/4Lv/sq62ijkn/N+Ae3wv8Az5/8mZyX/Cd/9Sp4o/8ABd/9
lR/wnf8A1Knij/wXf/ZV1tFHJP8Am/APb4X/AJ8/+TM5L/hO/wDqVPFH/gu/+yo/4Tv/AKlTxR/4
Lv8A7Kutoo5J/wA34B7fC/8APn/yZnJf8J3/ANSp4o/8F3/2VH/Cd/8AUqeKP/Bd/wDZV1tFHJP+
b8A9vhf+fP8A5Mzkv+E7/wCpU8Uf+C7/AOyo/wCE7/6lTxR/4Lv/ALKutoo5J/zfgHt8L/z5/wDJ
mcl/wnf/AFKnij/wXf8A2VH/AAnf/UqeKP8AwXf/AGVdbRRyT/m/APb4X/nz/wCTM5L/AITv/qVP
FH/gu/8AsqP+E7/6lTxR/wCC7/7Kutoo5J/zfgHt8L/z5/8AJmcl/wAJ3/1Knij/AMF3/wBlR/wn
f/UqeKP/AAXf/ZV1tFHJP+b8A9vhf+fP/kzOS/4Tv/qVPFH/AILv/sqP+E7/AOpU8Uf+C7/7Kuto
o5J/zfgHt8L/AM+f/Jmcl/wnf/UqeKP/AAXf/ZUf8J3/ANSp4o/8F3/2VdbRRyT/AJvwD2+F/wCf
P/kzOS/4Tv8A6lTxR/4Lv/sqP+E7/wCpU8Uf+C7/AOyrraKOSf8AN+Ae3wv/AD5/8mZyX/Cd/wDU
qeKP/Bd/9lWX4i8X2+s+FPFGl/2ZqljdLoV3cbb6ARZTYVyPmJ6n07GvQa8y8d/8hvxL/wBiZdf+
hNUvni1r1Naf1atGaVOzUW73b2MW3/49o/8AdFdt4E/5iH/bP/2auJt/+PaP/dFdt4E/5iH/AGz/
APZq6pbHkrc26KKKYgooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKA
CiiigDL8Sf8AIrav/wBeU3/oBrS8M8+DNHGzf/xL4fl9f3Y4rN8Sf8itq/8A15Tf+gGtTwt/yKGi
/wDXhB/6LWueSvU+R6Ef9x/7f/Q5dfDuqCOdtPsprKzieC6g025nRh5ySb2EZVmCKw9xyegFWtT0
vWNXnv7qK0ksmvIItPVZJEZo4t5aSRgr46MQAGJ+ldpRS9jG1un9fpp6Gf1iV721/wCG/wAjg7rw
3rMek6lpcSRSRTXUF1BJbKsSofMBkUKzNjG3dzkHJ+ldbpmlRaZ9oYTTXE9xJ5k08xXe5wAPugAA
AAAACr9FVGmo6oidWUlZnCWnhzVbG9jv4Y3aVru7DxSTBliWRmKToC21SBjIHJDHvVbT/CWqR2dy
yG8s9U+xyQtcNLAqTyN/FmNd7ZIzuc7hnuc16JRWaoRSt5W/Cxp9anvp/TueXnSZH1e9tdO0M2M0
dnZym0zEpkKT7mIKsVJIXqSCcc1fvND1rUZry5ksLiG1n1BZpLPfbvJLGIlQHDFozhhna34cgV6D
RR7BWs3/AFe4fWpXul/VrHBHwxc2i6TJZ2NxPcQSFlS9NvLDAjOCQQNuwjqDEDjGORitrw1pJ0m+
1VG0tIPOunljuoxHtkjJyq8HcMZPBGPSujoq40oxd1/W3+REq8pR5WcNdaNrM3jFNS+x4VLor5sQ
gVWtzEVGT/rGIPUE46YFVrbwnqllpNnFp1sljdvpU0N1JEyqTMdhTcVOSfvfNzjNehUVHsI23L+t
T00Wn6HI+G9HlsvENxdpon9lWr2UUOzMXzSBiWOI2OeCOTyar3nh7URrd7q8MDzMmoxTx2pnHl3E
YjVSdpYKHU5IJwcr9K7air9krJdv87ke3lzOXdWOCsPC16dXa41BL43KzSyNdwyW6LKhztUMF808
EDaxCjHB4FZsulS6euj2V1oiy2Y1M+TbPFbiadfJbmQK3lsR0ySCdvPPX0+io+rxSSXl+DT/AEL+
tSvdr+tf8zgIPDt/Etu19pH9oWA+0+XpnmRt9m3uDHwzBDtXK5BON3GRTG8IahJZ3P2u1iu76PR4
4LadmVmW4UuflZuQRlfm4+tehUUewja39bNfqH1qd7/1vc4S40DWDqGpvptuYJry1YSXl15W9ZMK
AIpEJkCnHRhgYyPStPwnoR0ua4uTbXdp5kaIYJjbhSRkltsChe+NxOT3AwK6iirjSSlzL+v6uRKv
KUeVhRRRWhiFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAF
FFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABXmXjv8A5DfiX/sTLr/0Jq9NrzLx3/yG/Ev/AGJl
1/6E1ZVenqd2B/5ef4H+hi2//HtH/uiu28Cf8xD/ALZ/+zVxNv8A8e0f+6K7bwJ/zEP+2f8A7NXR
LY85bm3RRRTEFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUA
ZfiT/kVtX/68pv8A0A1qeFv+RQ0X/rwg/wDRa1l+JP8AkVtX/wCvKb/0A1p+Fv8AkUNF/wCvCD/0
WtYS/i/I9CP+4/8Ab/6GvRXk2h2drPpurXnh620eBLcXaPNodwHu5laRtqsiINpCjKfMxyFxjNaE
jeEls9QXRb7TrHQpLaOO7nhUNaCcyKIxIAQpJGRICQSpXcRwas5D0mivKZLDwmfAmtz3cPhyS1he
X7PdWoVLOWYwgAxozsqOPu4UnkE8EkD0bRLXSbTSol0OO1TTnzLELQjyiGOSVxxgk9uKdhGhRXAe
JL6DTfEes39trttptxaaXDcTxAQ7rgq8mxZC4JC8heMH51wRxm1PqMNr4zaS48WXcVvcx20lnYJ5
Lpc7i4IjXyy7D7pJU5AOScAYSB6Ha0VxVjdCDxTqWn3Pi3UGu5bl1t9OKwMVRolYOFEW5UU5wxOz
IwcknMPg3XrjUZdOD+JY9Wubi18y+sxHEhs2AGCFVQy8nBD5ySCu0DFC1B6Hd0Vzmja1Evhq71Gb
VzqqQXE6mZbXyTlXIEQXuQcID/Eee9SgS6HoJJKvqd5LknqHuJDx/wABXgeyp7Ur/wBeoG9RXC+K
7xvDGkaZpthr1npcpV28y9uo7cz7QNx8x4ZVLFnBK7QTkkEYOUu9esrJ/CVxrXiO1t7pkSSe3u/s
8O7dA+ZdrAvGd3y/KwHJHOapK+wa2v5XO7orjNR1nb4hkgl8VLpkqTRLbacIopDdxkKSwUqZHLEs
oKEAbeQcHLbC+Nn4q1Gzn8TXtzetct9m0mUQkFDErBsLFvVAcjdkLkckknKA7WivNvDPijU5Pt9x
qniHR5UisJLie3W9Waa0dcE5hSCN0VckMrF2BAGc5zFpup61qnhzxIT4oF0be2R4brTJ4Ljy2w5Y
CVYEGSAMrsyoIIb5uHYD06iuHuL/AEe90KH7V4gXWNGjvgt9e3jRLAybGIUuiJG6b/LBxkZOD3FZ
+q6h4XtvDOmWuqR6XcRXE1wNKhvZkS1EQchJCWOzaqFcEAtg4Uc0norjPSKK5t0t76y0nQ7e7+2W
zwRzTTh94mgTGCW5z5jbfqN9YviDXLqDV3t4fFH2O9N9b20WlpDCzNC7oGlAZS5OGY787BtwVyCa
drysv66C6HfUVxWn6s954v1Kzt/GMFybWYmPSx9nZ2G0b0JUBtqk4HQgg7i3QVbHxHdtDNLZ+Iod
YuzYyT3NoEiIsJQAQNsYDgAll2OWY7eCCDlLVXHbWx39FcHDfX2oWl+mh+LpdYW2jS4Fzai1kcuC
26DKx7PmUZHG5TgkkECoNZ1jWYtMGrWetiDTtQuwIZryWG3jtYAh2kSGBwA7DguG4KgEE0CPQ6K8
9i8SatZW2k3st9Bqy3ME0eywuI5IJWjfcZBKIgS4iD5ACqWQjC5rNvvEHiOyNgsviPT7MPaR3MUm
q3sNr9pLsxKsPszBwo2KQhQjOT94EO3QD1SivN01iO08Ta3FZa7a21wNRjMOlRJEftrtFEJMkjex
zkZQrtIJbI4qaDxDqN349a1s9fsrq1WaeNtOimjaRPLRhh4jEJIxvX75kYE4wAGGF0v5XHY9Corz
nwp4h1K+luxqvifSQn2N5Z449QheexcYyfLNunlquSCJC+CFB75l0e71XWvC0uoaf4zbUbqNVd4r
GK1JBXny/ukBnXrn+LBG0ZUu1txHoNFcFrN+r+D9Y1a98SNa2F6GOnpcpbBCgQ4QCSM7xIQThskr
jGOavav4isp7fTpoPFNtpmlTrITqcEsDI8i4AiDyBox1Y4xk7OMYNFhnX0V5jrPiTWre5sli8SaV
awfZIpYrjULlLFL1yW3HY8EhK8L8qOpAYHPzKavaz4gv/wDhOLawsfENlEq3FvDNp6zRmY7trNiF
otzjawO9ZFCjJ2kqQRK7S87C/wCHPQKKxosalr0t2Pnh04NBCvZpiAXb8BhQfdxXO6Z4iTE93P4w
juJo7OWe80428bixdRk5Ea70VOQVcsWwMHPWb6XGlrY7uivMNN8S6t/YmtTzeI7S9WP7OkN3b3cE
kNuzsQxa4ECouBjIaNtowfm3YFzTvFU934YDXXiK0gWK/a2utWgmilEUe0srb2jWP5jtUMYwuGGA
cg0+thHodFcLNrarp1h53jVbewkab/ideVBEJmUgJGGdTEeCxLKPmKHbjkVl6z4k1q3ubJYvEmlW
sH2SKWK41C5SxS9cltx2PBISvC/KjqQGBz8ymnYD06ivP9Z8QX//AAnFtYWPiGyiVbi3hm09ZozM
d21mxC0W5xtYHesihRk7SVIK2fiC+vPiGLS38Q2c9kLiaOSwhljeWMIjA74jEskYDr98yMCcYADD
CWv4/gD0/rud/RXl+meKNavZtXudP12x1aNNPmubeC3lSYRvuGzeqwpJEcE4jbzCcHnK82NO8RXj
eGdduLvxhpUi28SyQ3lpqVvcyQOc4Vz9njjAYgAAqSctz0wdLjtrb5HpFFcRBe3n9h22ux+Lm1Oy
hmWW8NnFbmMx8CRchWIRPvYB3gBgWYkYh1e9GmaDYXOveJhbyzX8dxHBfi1TdH5yHyyDGPuKQxZc
MG53YAp21sJaq6/r+v1O9orjNf1+E3SFfF0GjWj2qzWUyiGRL1mJzjeDvAAX5YyGO/ryKzZ/EOtL
40W1bW9KtIRcQxx2N5epBJcRMq5YQtbl2YlmA2yAbhgjhgRK7sD0Vz0WiuAsvEF9e/EMWdv4hs57
IXE0UlhDLG8sYRWHzxGJZIwHX75kYE4wAGGOkvPEVm2na21jM8lxpYaOdUQgxybAw5YYPBBzyB3p
N6X+Y7a2NuivNdK8YTnQNdW58TaXLPa+V5N8t7HMieYdoLSJAigbuN3lsFJOd2CBnDxNq66b5reM
7fzla7eExtbTx3CRQq4CuIk8wBsgsqrjLL1AagS1PW6K8t1XxddWenwJY+KkvNRilu42g3WytPEq
MwmY7MKY12uAAAwwDnOa9D0S5ivNEsrmDUDqMUkKst2QoM2R97CgAZ9ABijz/r+v66OxfW39f1/X
Yv0V5frS6SfFd/LJeeHliXVtPFzDNbo1w0uF2nzPMG043YBQnAbnrjT0/RvBL+O9QtLW20f+0Ibe
N9sLJ56uTMJSSDvzhl3Z9Vz2oWqv/XT/ADH1O9orz7w/p/gaO58SSabDoQ+yl4pTbmLCQGCPeHx/
BuVs7uMhu+aZ4Eax07w42uW9to1tZLZxxumj3Am+0SAdZAEQCXkLj5jlsZ6UKz18k/vE1Y9Eori/
Eljplj8P9QGvz2ytMkk8rXEwRJLllJVeSA2DgKDn7i8ZArdfxLosGjW2pnUYJLGaRII7iA+ajuzb
AAUz/Fx7d6dg7P1NevMvHf8AyG/Ev/YmXX/oTVv+Kb7w9pviPQLvVNQsLW9jnbYbq5VCkRilBKhj
wC20Egc8AngVgeOjnWvEpHT/AIQy6/8AQmrKqtIvzO7BaOov7jMW3/49o/8AdFdt4E/5iH/bP/2a
uJt/+PaP/dFdt4E/5iH/AGz/APZq3lsectzbooopiCiiigAooooAKKKKACiiigAooooAKKKKACii
igAooooAKKKKACiiigAooooAKKKKAMvxJ/yK2r/9eU3/AKAa0/C5C+D9GJzgWEB4Gf8AlmtZniT/
AJFbV/8Arym/9ANaXhglfBujMFLEafAQoxk/uxxzXPL+L8j0I/7j/wBv/oO0/wASabqk1tDatdF7
mBriLzLKaIFFbaSS6ADnHBweQcYINa1edaZoGpwQqItM1a1nn0qeKV7jURIkUpcbVUec3l5CnmMA
DK9xgTjRWXSdWj07wldaba3EMcLadFJaxvM2/wCeRVDvFkIf4/v42twBWnT+u7/r/gHJ1/ryO7kl
jhUNLIqAsFBY4yScAfUnin15xZeC4o/CM9tP4cFwF1NLyOxu47XzGQbAw2oRArEBwAu0EEZ5LGtu
7003PhWztf8AhEYljjvInj0yO6SEQIsoIkJT5cqPmKKSCeMmn/wP0/r/ACEdZRRXAa34cn1Xx1b3
7aNeH7Pc25juy9o0BjTDMdx/0hDncNqnaSASCGakt0g6NncO0dw81mwmB8sbmVXQYbI+Vxjng9Dk
cHjIqLTNNtdG06OytPOW2hGEE07ylR6bnJOB2GeKwbCKa28ZajNB4YubSG8jSOS/X7MFkdDIfMYL
JvOQygErn1Aqjo3hy389obrwikE7W0kN7qE8kTJelsbmKqzNLuOTmRQQCfUih6K67De9jsytveQR
uRFPESssZ4ZTghlYfjgg054YpHjd40Z4iWjZlBKHBGR6HBI+hNeeReGbg+Dp9Js/DC6RtS3+0fZ/
sokv2QjzAFw0bAgcGXG4nDBRk0g8NyxeDG0pNE1uS3lvg72sn9mK8S7c7kjA+zlCwGVYZyxbqAab
62EvM9EeWON0R5FVpDtRScFjgnA9eAT+FUdR1zT9LuIILuZ1km+6qQvJtGQNz7Qdi5I+ZsKPWuNT
wfBB4a0JLvwtFqbWM8zPZyx27yiOTzMD5mEQOShZVYKCPlGABWpf2mpG3eOPRGB1HTUsmjtZYjHZ
Ebx8xZkLKBJ/Ap+6eOlFlewG3ceIdMtdVTTZZ5BcuyplYJGjVm+6rSBdiMeMKxBORgcjOpXLXs+s
3HiiK1l0S9fRrd42SeGS3KzPwd8m6QOFQ87VUklQe2D1NJbB1CiiigAooooAYIYlmeZY0ErgKzhR
uYDOAT3AyfzNUrrRbO81GG+nN00sO0ogu5ViyDkExBtjEHnJUngegrQooAKKKKACiiigAooooAKK
KKACiiigAooooAKKKKAGRQxQJshjSNMltqKAMkkk8dyST9TT6KKACiiigAooooAKKKKACiiigAoo
ooAKKKKACiiigAooooAKKKKACiiigApksMU6hZY0kVWDgOoIDA5B+oIBFPooAKKKKACvMvHf/Ib8
S/8AYmXX/oTV6bXmXjv/AJDfiX/sTLr/ANCasqvT1O7A/wDLz/A/0MW3/wCPaP8A3RXbeBP+Yh/2
z/8AZq4m3/49o/8AdFdt4E/5iH/bP/2auiWx5y3NuiiimIKKKKACiiigAooooAKKKKACiiigAooo
oAKKKKACiiigAooooAKKKKACiiigAooooAy/En/Irav/ANeU3/oBrR8NSJD4L0eSQ7UTT4WY+gEY
rO8Sf8itq/8A15Tf+gGtHw1GkvgzR45FDI+nwqwPcGMVzzv7TTsejC31LX+f9CCz13VJCt1qGjQ2
WlPE0/2pr5WaGMDI81Co2kjHCs4HOTwMuPjLRFsLi9kmuoorcp5qy2M6SKHOFby2QNtJyN2NvB54
NMj0HVXtJrC81mGWw8hoYUis9ko7K0jl2DkAdlQE9fSobjw/rV7b3D3Osaeb5/KWOWPTnWNER95B
QzEkk453DAHTrnV76HF08yzceMNKt9Mj1DZqEkT3C2xSPT5zKjkgYePZvXqDyBnIxnIzPceJtNtb
W3uJRfYuFLRxJp9w820cEtEELqBkcsAOR6iqsmg6jJHqe7UrYS3N7HeWzCzbEJTYArjzPnGI1zgp
36cYo6t4Ll1hLOe/uNJ1DUIBIrSajpCzwlXYNhI96lNuAAd5OM53HBC/r8P8w/r+v6+407rxfoln
dRW8tzMWliSdXjtJZI/KY4Dl1UqF9WJwMjOKf/wk1j/b8mjeRqP2mPZl10+Zovmzj94EKgcdSQPf
g4z7nwvqMlrcW9tqGm2sM2mLYCOLTWCRkE5ZVEowuGYBe3HJxg3Z9I1VtUS7t9Xht1ljhS7VbPcz
+WWP7slyEB3EHKvx0IPNPQDZlZ0hdo08xwpKpnG49hntXMWvifVIft8+uaRa2VhYK32ie1vHumQh
Ef7ghUkbX6jONp4xzWrD4Z0C31P+04dD02O/3l/tSWkYl3HOTvAzk5OTnvVey0/U9PbV7i9nttSS
6czJbWtp5L5CKm3LylWyqKOdoznnB4n/AC/EasP1DxZo+lSbL6eeHEccpc2kxRVdtq5YLgEnjBOa
B4r0k2JuhJdECXyTALKb7QHxu2+Ts8zO35vu9OenNc2+m61/wiE5XTb86nJewmKJzbPLFBDKpizm
XY2FXJ+bJZj0zkXr/wAGza3arNqs2l3WpCZZV+0aX5lsFCFdjQtKSfvMch85x2GCwNufxJpNtpMG
pzXRjtJ5UhR2icHzGbYFK43Kd3BBAwc5xitWsG30O9svD9tp2n3lhps0Uyu72GnLHCyb9zIsRZtu
4cE5JySfat6mxGN/wk1j/b8mjeRqP2mPZl10+Zovmzj94EKgcdSQPfg4kh8R6Zcak1hHJcGYFlDG
1lETsudypIV2OwweFJPyn0NR3ek6jJrP22x1RLSGVYkuENqJJGCMxGxy2FzuIOVbjpg81laf4Ii0
vXm1C1g0EJ5ssqSNo4+1qX3H/XiQZwW/u5K8E5+akgNC28ZaNex77V7yUfZ3ucLp8+diMyNxs+9u
Vht+8ccCreia7aa/Zi6tIr2NCqti6s5YD8wyMb1Ab6rke9Y+geEr/RtUuL2bVoLhr6M/2gEsjGbi
XcdsgPmHZtUhdoBBxn6T22ia3baRJYHWYpR5MdrB5dt5Pkxjhnzli0m3vlVyB8o5o/r8/wDgfnps
HX+v6/rruWl8S2kdtDc3aSwQXV59ktGWN5PNJbarHap2BiDgnjGDnnFUz4/8ODyt1zeL5qb492nX
I3DdtyMx85bCj1LKBywzb17QG1jSYNJhnhttP3ot1A0BcTQDrECGXZkDGeayLXwjrcMNvFNr1lKt
tFFHEf7NZSBHMsi5/fcjC7ex759Rb67f1/X+VtT+vx/r/g9NltblkuNIktLeKbTdRO3z3leOVCUZ
1/dFORhcHLKRnpVubWbCDWrbSJZ9t/cxPNDFsY7kTG45xgYyOprDbw9r8dvpkFrrWmolg5dfN0yR
y5w6jOJxxtf8SM8A4rZS31M681xJeoNNW2VEtkQZeUsSzsSMgAbQAD3Oe1Pt/X9f16g/L+tf8jRr
m7nxnp32a9/s8tcXVvbyXEcc0UsEc6x/eKSlCrj/AGl3DketdGyhlKnkEYNcyfD2ttpVxpZ121Fn
9le1t1GnncqkbQZD5nzkL/dCZPPtSGrX1L1p4o0u9sLi8ge5aOAKXX7HN5hDfdKps3OD2Kgg84zR
N4p0i30garPPNFZ+Z5TvJayqYWzj94pXdGPUuABkc8is/UfC+oam139p1GxeKeC3j8lrBmRmiYsf
MBl+dGLNlOOMDJwc17Xwfqdh4fn0uz1LSbfzbsXI8rSSkUYyG2LGswx8yjnPTOcn5qO5K2VzXfxX
pKafFe77to5GZFRLCdpQV65iCb1A4OSoGCPUZSTxdoscdtL9pmkiuYUnSWG1lkRI2+68jKpEannl
yBwfQ1T17w1f69Z2UN1c6LOYVbzo73R/tEMjnGHRDKGQgbh94/ePtVLUfAEN3PbToujXMsdrFbSP
q+ki8ZvLBAZTvQqTk55IOB05y1YZt/8ACTWP9vyaN5Go/aY9mXXT5mi+bOP3gQqBx1JA9+DhB4v8
NNdm0j1/TJLsMU+zRXaPKWHVQgJYt7AZoudI1BtXF3YapHaQSJFHcR/ZQ7sI2YgIxbCZDEHKtx0w
eadF4asIb8Xq3GqmUP5m19WumjznP+rMmzHtjHtSAVfEumSRq8bXThrP7cm2zmJeLjlfl5bkfIPm
GRkVDa+LNPvNBm1eK31IQQxCVkk06dHIIyNqlMv9VyPfFVtL8N6nY39rJPrEE9na20lpFbrZbG8t
ipBL7zlxsXJxgjoq9afbaFrcGi3GnnXLZ/8AR1trbNgQkSAYLOvmbncjjIZV4B29cqWztv8A8P8A
8AatdXLHhjWrzXtNa8u9PWyBbEaAzZYYByRLDER16gEH1pnijxIPDlvbyFbIec5HmX16LWIYGcby
rZc9lxzg8jFPh8PpeaNDp/iSHTNXELApusNsYAGAdjs/zdec9+lNuNAe1htE8OnT9KFt5irE1kXh
2vgtiNHjw2QOc9zxzTn15RR8zYtpxc2sNwqOiyorhXGGGRnBHY1LUNpAbWygtzI0hijVN7dWwMZN
TU3a+gltqFFFFIYUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRR
RQAV5l47/wCQ34l/7Ey6/wDQmr02vMvHf/Ib8S/9iZdf+hNWVXp6ndgf+Xn+B/oYtv8A8e0f+6K7
bwJ/zEP+2f8A7NXE2/8Ax7R/7ortvAn/ADEP+2f/ALNXRLY85bm3RRRTEFFFFABRRRQAUUUUAFFF
FABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAZfiT/kVtX/68pv/AEA1f8PS/Z/A+lTb
S3l6bC+0dTiMHFUPEn/Irav/ANeU3/oBrU8Lf8ihov8A14Qf+i1rnmr1NOx6MP8Acv8At/8AQzLY
6tYWC65e65Le2/2c3E1ktrEFLFcqsTAAqvOPnLE8fMOclz4k1mxtLkXOh2v2+IRSRwxagWjlR32f
fMYIYHsVxyMN1xoW/hXR7aSZ0gmYSxvF5ct1LJGiN95URmKxg9MKBxx0pn/CI6SbOe1b+0JEnKF3
k1K5eU7DlQJDIXABycAgZNavc4uhSutf11NNLQaVp41CLUI7OeGS+fygH2EFHEWTkOvVRjnrjBbr
fivUdFWytzowuNQnjeWWKBrmaKNVIHDxW7sScjqijrz0zqnw3pjRX0bJcst9MJ5ibyYnzBjDId+Y
yMLjZjGB6Com8JaO1pBbLFcwiBnZJYL2aKYlzl90quHbccE7ickAnkCl/X4f5h/X9f195n3XivU4
mE0GhKbNbFL6dri5aGaJDncnlGM/OMHgkA4OSOM3U1LXX8U3Ngmn6c2nQrE/nteOsoV92Ts8ogn5
TxuH15wJLnwppV2JRP8Abn821Wzk/wCJjcAtEDkA4fr6t945OScnMlz4a0q8uoLi4hmkkgVFAa5l
2yBDlPMXdiQg8guGIPNPQP6/r8QTX7O51BtOjj1RJyzJ5jaZcLGCM8iRo/Lxxwc4Pvmsyx1SXRfD
V7qGqand6nJFNc+WsscQkYRO6hUWJFySEyeCck9uK6h1DoynOGGDgkH8x0rBtfBmiWjMVjvJlZZF
Md1qFxcRkSZ3/JI7Lk5OTjPJ9aQ9DMtvGeqT6Ve3B8Oul1bPEFikNxBHMHbb8rzW8Z3A9RtxyPm5
40F17VXgMC6RbHVhcm3aD7afIXCCTd5vl7sbWH/LPO44xj5qmHhLS/sM1m0mqSQTMjMJNWunYFTl
drGQlefQjOBnOKh1LwlbXNpeLZTS295czi4+0S3NzJskxtJXbMjJlcrhGUYwOQMUP+vw/wCCJFCP
xP4hvI7B7PRNORp7y4tZIrnUXUqYt4PzLEw5ZG9eAPU7ZdR1rWtL1i6dbWO6s4rCK6uYmuVRbbmQ
P5ZEe6QkLkBsD5eq5xVyy8I2UPh610q5aR/IkeYTW0stuwkYsWKsr7xnew5Ykg8k8mpH8IaK0E0C
29xFDNapaPHDeTRr5SnIUBXAXvyME5OScnL0uHf+uv8AkX5bm+XWbe2j0/fYvC7y3nnKPLcEbU2d
TkEnI6Y96u1n/wBiaf8A2naakYWa8tIGt4ZnldiI2xkHJ+YnaOTk+9aFIDm4tTn0ay8Q3F9dXeop
YTFow0aeZtMSPsAjRc8sccE+5qjbeM9Un0q9uD4ddLq2eILFIbiCOYO235Xmt4zuB6jbjkfNzxr2
nhPSbOS6dFvZRdoyTpdahcXCSAgA5SR2UnAAzjOOKQeEtL+wzWbSapJBMyMwk1a6dgVOV2sZCV59
CM4Gc4pjZCuvaq8BgXSLY6sLk27QfbT5C4QSbvN8vdjaw/5Z53HGMfNVCPxP4hvI7B7PRNORp7y4
tZIrnUXUqYt4PzLEw5ZG9eAPU7b+peEra5tLxbKaW3vLmcXH2iW5uZNkmNpK7ZkZMrlcIyjGByBi
nWXhGyh8PWulXLSP5EjzCa2llt2EjFixVlfeM72HLEkHknk0uginqOta1pesXTrax3VnFYRXVzE1
yqLbcyB/LIj3SEhcgNgfL1XOK6ysN/CGitBNAtvcRQzWqWjxw3k0a+UpyFAVwF78jBOTknJzsxRr
DEkSliqKFBdixwPUnkn3PNPQOv8AXYfRRRSAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACii
igAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACvMvHf/ACG/Ev8A
2Jl1/wChNXpteZeO/wDkN+Jf+xMuv/QmrKr09TuwP/Lz/A/0MW3/AOPaP/dFdt4E/wCYh/2z/wDZ
q4m3/wCPaP8A3RXbeBP+Yh/2z/8AZq6JbHnLc26KKKYgooooAKKKKACiiigAooooAKKKKACiiigA
ooooAKKKKACiiigAooooAKKKKACiiigDL8Sf8itq/wD15Tf+gGtPwuwXwdozHgDT4Cf+/a1meJP+
RW1f/rym/wDQDR4b8SaFB4W0iGbWtOjljsoVdHukDKQgBBBPBrmm0qmr6Hp0qc54K0E37/T0OR0+
PSi9/PoF5peqTyafM5u9IQx3yKSpPnbXbzJWBOGIVgynA5OJNUu/B9tpeoRaLHpUulXVslu8MRh+
zyXbOBHgORGZQNzNkg4VCxHFd9/wlPh7/oPaX/4GR/40f8JT4e/6D2l/+Bkf+NXzw7/1/X46mH1a
vq+R/czz++1TQm8Hy6RfW2lxNpWqQxR6fq91AFiQuGRXKmRVAQuvGTtU5HWjWLbTY7bSdLOnafPf
jz9QtrfTp7dvsUW0lGheZovk3bXyoH3TxgV6B/wlPh7/AKD2l/8AgZH/AI0f8JT4e/6D2l/+Bkf+
NHtI99f+G/VXF9VrfyP7mcrdeLrfU7e1u08W2+h28tms1uy+RKtxMSQ6HeDv2EAFIyG+bryKty3y
2PjE/bvFV/Ak8Vs1tpxjixcEllZVjMRk64LbTkZ5IAGN/wD4Snw9/wBB7S//AAMj/wAaP+Ep8Pf9
B7S//AyP/Gj2kL7oPqte1uR/czGsdb0tPHOrWcevWV5eSwRiO1MtuJUdWl3RDaA5xjOGLFcnpmsm
LxHKdPu5o/F8V1N/Z8s92ii3H9myqAQAAvyDcSu2XcTjrwc9f/wlPh7/AKD2l/8AgZH/AI0f8JT4
e/6D2l/+Bkf+NJzja1x/Vq978j+5mNoGs75L+xk8TRalLHYw3gmxCXi8xWyQsYAKABGGQThxycit
rw1dfbvDOnXX9pf2n5sCv9t8jyfPyPv7P4c+lJ/wlPh7/oPaX/4GR/40f8JT4e/6D2l/+Bkf+NN1
IX3JWFrq3uP7mN8QeGdO8TQQxagshWHzNhQgEb4njPY/wuSPcCuS1qW00DWNTlsNct9MfTdHt5JI
QId0+xpBGshYE7eVXjB+dcEcA9f/AMJT4e/6D2l/+Bkf+NH/AAlPh7/oPaX/AOBkf+NCqRXUr6rX
as4P7n3T/QwJ9RhtfGbSXHiy7it7mO2ks7BPJdLncXBEa+WXYfdJKnIByTgDBY3Qg8U6lp9z4t1B
ruW5dbfTisDFUaJWDhRFuVFOcMTsyMHJJzv/APCU+Hv+g9pf/gZH/jTJfEvhyaF4m1/TQrqVJS+R
Tg+hDZB9xzSc420Yvqtf+R/cznfBuvXGoy6cH8Sx6tc3Fr5l9ZiOJDZsAMEKqhl5OCHzkkFdoGK2
NG1qJfDV3qM2rnVUguJ1My2vknKuQIgvcg4QH+I896XS9W8KaPp8VjZ69Yi3iGEE2p+cVHpudycD
sM8VYl8SeGZ1Cy61pEiqwcB7qMgMDkHr1BAIpupBvRh9Vr/yP7mRgS6HoJJKvqd5LknqHuJDx/wF
eB7KntWfq7xaBa6Zpz+IP7DsBG5fUHMIaSUYwpaVWQFtzueMkg4I5rUfxJ4ZkeN31rSGeIlo2a6j
JQ4IyOeDgkfQmpP+Ep8Pf9B7S/8AwMj/AMaOePcFha/8j+5nD6z4k1q3ubJYvEmlWsH2SKWK41C5
SxS9cltx2PBISvC/KjqQGBz8ympPFWsQfb1XUfENpby2+qWnl6RKISDGJIz52WHmZwWbeCFAGCOC
a7T/AISnw9/0HtL/APAyP/Gj/hKfD3/Qe0v/AMDI/wDGmqkE07h9Vr/yP7mYGn6s954v1Kzt/GMF
ybWYmPSx9nZ2G0b0JUBtqk4HQgg7i3QYt14omj0x5ofHEDzvCJLobbbGnyb0AXG3KglmQpISxxww
IOe5/wCEp8Pf9B7S/wDwMj/xo/4Snw9/0HtL/wDAyP8AxqVOPcbw1d/Yf3M5vQNb1OS9vrOPWLbW
L1Q4ht7qWOADy53jY5ijJztCM3ykZYYCgirfiLWdV0/w6JL+60rQrya5WKGX+0MxEYLEGWS3KoxC
t96NhxjOSMbP/CU+Hv8AoPaX/wCBkf8AjR/wlPh7/oPaX/4GR/40c8bbh9Wr3b5H9zOOttYvrmy0
JLzxotjLcw3csssYtf3yRtlXUvHgqFGd4UBlBO1c8WZ/FWkOfCWp33iXToGmVZZLeSW3EZ3QyAyA
sC64YFcqwHJBzXUf8JT4e/6D2l/+Bkf+NH/CU+Hv+g9pf/gZH/jVe0je91/VxfVa9vgf3MsPrFhH
q9vpTXA+23MLTxRhSdyKQGO7GP4h371zNvrLy+ITE/idVvhcyRtoIiiY+Wu4JwF81cgK5ckrg9AC
Mb3/AAlPh7/oPaX/AOBkf+NH/CU+Hv8AoPaX/wCBkf8AjU88e4fVq/8AI/uZw114omj0x5ofHEDz
vCJLobbbGnyb0AXG3KglmQpISxxwwIOdTQvErWtzqS6lr41LyY5CkREKuDFM8eFCKCWYCMn3cYCg
gV0v/CU+Hv8AoPaX/wCBkf8AjUcviTwzOoWXWtIkVWDgPdRkBgcg9eoIBFP2ke4/q1f+R/czH1ye
Xw54VjLavaabqF7dBpbq5mWJGlbLsvmNHIq4VdoLIRhQOCQaoW+u3Z8O6RJq3ipNNiuBOz6qPICy
sr4jRXdPLKlSWDBQXC5AXkV1f/CU+Hv+g9pf/gZH/jR/wlPh7/oPaX/4GR/40e0j3F9Vr/yP7n/k
cReapFa3d9qsHii2gurbRoLm4kEEURvWDybDIrgsqHIAAwfnXDdMz3fiTVD4y8lNf0ezszPEsFrc
ajHGbiBlU70QwFnJ3NtKyhcgDHBB7D/hKfD3/Qe0v/wMj/xo/wCEp8Pf9B7S/wDwMj/xo9pG+4fV
a/8AI/ufY4bRvFN0t7YzXPjBL+1fY3lhLYeaHaZMZRQTho4wNuMuxHQhRd8HeLZrzWbq21DXLG6i
a1N0qLeRSvBtPzK2yGMKQCMqS5GB83r1n/CU+Hv+g9pf/gZH/jUc3iTwzcQvDNrWkSxOCro91Gys
D1BBPIpc8e4PC139h/czB16HTJPAmt6pri2oXUIWlUXwUKgCkQIN3RhwcddzNinXXibRDYQ2mh65
YabpVvKkM2oWbwGG3UozKiE5jUkqB8wI5wBkgjoP+Ep8Pf8AQe0v/wADI/8AGj/hKfD3/Qe0v/wM
j/xp88e4fVq/8j+5nMS6/IbCza68WxafaHz/ACNTEcOL4owCcsChyMkhAC+MrtHFQJ4htbe18HX2
veJbaG7mjWee3vDbRf6yGQ+ZhlDpg/ICpHHBySc9DqWreFtVt1guPEVsiK24G21c27Z92jdSRz0z
irMHiPwzbW8cEOt6UkUShEUXkeFUDAHWmqkO/wDWofVa+vuP7mc5eeIfsfiC+nfxdCttbX9rb/YH
NuEAl27gzbd/Qsy/MPunORwN+HwhpVv4jOuxpIL0yyyk7ht3SRxxtxj0jGPq3rVj/hKfD3/Qe0v/
AMDI/wDGj/hKfD3/AEHtL/8AAyP/ABpKcV1/rQPqtf8Akf3M1qKyf+Ep8Pf9B7S//AyP/Gj/AISn
w9/0HtL/APAyP/Gjnj3D6rX/AJH9zNaisn/hKfD3/Qe0v/wMj/xo/wCEp8Pf9B7S/wDwMj/xo549
w+q1/wCR/czWorJ/4Snw9/0HtL/8DI/8aP8AhKfD3/Qe0v8A8DI/8aOePcPqtf8Akf3M1qKyf+Ep
8Pf9B7S//AyP/Gj/AISnw9/0HtL/APAyP/Gjnj3D6rX/AJH9zNaisn/hKfD3/Qe0v/wMj/xo/wCE
p8Pf9B7S/wDwMj/xo549w+q1/wCR/czWorJ/4Snw9/0HtL/8DI/8aP8AhKfD3/Qe0v8A8DI/8aOe
PcPqtf8Akf3M1qKyf+Ep8Pf9B7S//AyP/Gj/AISnw9/0HtL/APAyP/Gjnj3D6rX/AJH9zNaisn/h
KfD3/Qe0v/wMj/xo/wCEp8Pf9B7S/wDwMj/xo549w+q1/wCR/czWorJ/4Snw9/0HtL/8DI/8aP8A
hKfD3/Qe0v8A8DI/8aOePcPqtf8Akf3M1q8y8d/8hvxL/wBiZdf+hNXb/wDCU+Hv+g9pf/gZH/jX
AeLtQstR1XxPNY3cF1Evg66UvBIHUHcxxkHryPzrOpKLtZ9TswlCrBVHKLS5X09DNt/+PaP/AHRX
beBP+Yh/2z/9mrzXxfrfg7wfrLWN/wCCrbY2TDNHpVs0cg74JI5GcEEZ6diCe++F9xpt/pt1qGma
Emkw3AjKqLSKBpV+bDEJ1HJxn6jg5PS9jykan/CSaF/0GtO/8Ck/xo/4STQv+g1p3/gUn+NfO1Fe
p9Qj3PE/tOf8qPon/hJNC/6DWnf+BSf40f8ACSaF/wBBrTv/AAKT/Gvnaij6hHuH9pz/AJUfRP8A
wkmhf9BrTv8AwKT/ABo/4STQv+g1p3/gUn+NfO1FH1CPcP7Tn/Kj6J/4STQv+g1p3/gUn+NH/CSa
F/0GtO/8Ck/xr52oo+oR7h/ac/5UfRP/AAkmhf8AQa07/wACk/xo/wCEk0L/AKDWnf8AgUn+NfO1
FH1CPcP7Tn/Kj6J/4STQv+g1p3/gUn+NH/CSaF/0GtO/8Ck/xr52oo+oR7h/ac/5UfRP/CSaF/0G
tO/8Ck/xo/4STQv+g1p3/gUn+NfO1FH1CPcP7Tn/ACo+if8AhJNC/wCg1p3/AIFJ/jR/wkmhf9Br
Tv8AwKT/ABr52oo+oR7h/ac/5UfRP/CSaF/0GtO/8Ck/xo/4STQv+g1p3/gUn+NfO1FH1CPcP7Tn
/Kj6J/4STQv+g1p3/gUn+NH/AAkmhf8AQa07/wACk/xr52oo+oR7h/ac/wCVH0T/AMJJoX/Qa07/
AMCk/wAaP+Ek0L/oNad/4FJ/jXztRR9Qj3D+05/yo+if+Ek0L/oNad/4FJ/jR/wkmhf9BrTv/ApP
8a+dqKPqEe4f2nP+VH0T/wAJJoX/AEGtO/8AApP8aP8AhJNC/wCg1p3/AIFJ/jXztRR9Qj3D+05/
yo+hpfEHh6aJ4pdX0uSN1KujXMZDA9QRnkUyP/hXvlrn/hGM4Gc/Z6+fKKmWW05bs0p51Xp/Bp6N
n0L/AMW8/wCpX/8AJej/AIt5/wBSv/5L189UVP8AZdLv+Br/AG/iu7+9n0L/AMW8/wCpX/8AJej/
AIt5/wBSv/5L189UUf2XS7/gH9v4ru/vZ9C/8W8/6lf/AMl6P+Lef9Sv/wCS9fPVFH9l0u/4B/b+
K7v72fQv/FvP+pX/APJej/i3n/Ur/wDkvXz1RR/ZdLv+Af2/iu7+9n0L/wAW8/6lf/yXo/4t5/1K
/wD5L189UUf2XS7/AIB/b+K7v72fQv8Axbz/AKlf/wAl6P8Ai3n/AFK//kvXz1RR/ZdLv+Af2/iu
7+9n0L/xbz/qV/8AyXo/4t5/1K//AJL189UUf2XS7/gH9v4ru/vZ9C/8W8/6lf8A8l6P+Lef9Sv/
AOS9fPVFH9l0u/4B/b+K7v72fQv/ABbz/qV//Jej/i3n/Ur/APkvXz1RR/ZdLv8AgH9v4ru/vZ9C
/wDFvP8AqV//ACXo/wCLef8AUr/+S9fPVFH9l0u/4B/b+K7v72fQv/FvP+pX/wDJej/i3n/Ur/8A
kvXz1RR/ZdLv+Af2/iu7+9n0L/xbz/qV/wDyXo/4t5/1K/8A5L189UUf2XS7/gH9v4ru/vZ9C/8A
FvP+pX/8l6P+Lef9Sv8A+S9fPVFH9l0u/wCAf2/iu7+9n0L/AMW8/wCpX/8AJej/AIt5/wBSv/5L
189UUf2XS7/gH9v4ru/vZ9C/8W8/6lf/AMl6P+Lef9Sv/wCS9fPVFH9l0u/4B/b+K7v72fQv/FvP
+pX/APJej/i3n/Ur/wDkvXz1RR/ZdLv+Af2/iu7+9n0L/wAW8/6lf/yXo/4t5/1K/wD5L189UUf2
XS7/AIB/b+K7v72fQv8Axbz/AKlf/wAl6P8Ai3n/AFK//kvXz1RR/ZdLv+Af2/iu7+9n0L/xbz/q
V/8AyXo/4t5/1K//AJL189UUf2XS7/gH9v4ru/vZ9C/8W8/6lf8A8l6P+Lef9Sv/AOS9fPVFH9l0
u/4B/b+K7v72fQv/ABbz/qV//Jej/i3n/Ur/APkvXz1RR/ZdLv8AgH9v4ru/vZ9C/wDFvP8AqV//
ACXo/wCLef8AUr/+S9fPVFH9l0u/4B/b+K7v72fQv/FvP+pX/wDJej/i3n/Ur/8AkvXz1RR/ZdLv
+Af2/iu7+9n0L/xbz/qV/wDyXo/4t5/1K/8A5L189UUf2XS7/gH9v4ru/vZ9C/8AFvP+pX/8l6P+
Lef9Sv8A+S9fPVPiikmlWKJGeRztVVGST6AUf2XS7/gH9v4ru/vZ9Bf8W8/6lf8A8l6P+Lef9Sv/
AOS9eNv4L1ZVmUC3e6hj82SzSUGZV9Sv9OtMHhHUxYW15M1rbw3S74TPOqFx7ZqPqGH/AJvyNP7Z
x3n97PZ/+Lef9Sv/AOS9H/FvP+pX/wDJevGk8Hao9lFeM1pHbTSGOKWS4VVkIJHBPXoaji8I63Nr
R0gWZW7CGTaxwCo7g9CKP7Pw/wDN+Qf21jvP72e0/wDFvP8AqV//ACXo/wCLef8AUr/+S9eJXvhn
U7KwS+Mcc1q7+WJbdxIobOMHHerUfgnV3ZYT9mS9aPzFsnlAnZcZ+59O1H9n0N+b8g/trG3tr97P
Y/8Ai3n/AFK//kvR/wAW8/6lf/yXrxC38Napc6Rd6olvi1tGKTMxwVIxkY/GjR/Dep67FcS2EAeO
3XdK7NtC9T1/Cn/Z1BJu+3oJZ3jW0tdfNnt//FvP+pX/APJepILfwFcyiKCHw3LIeiRrAxP4CvBd
P0i61JZpIgiQQDMs8rbY0z0yfU9hV9PB2sy3TwQ26zFbYXQaNwVeL+8p70nl1Bbv8gjneMeqv97P
ff8AhFvDv/QB0v8A8A4/8K5vxePC2meEvEtrZDR7TUpNLuYRFD5UczFojhMD5jk4478V5Loeo+Io
t39k39zGIyqlVlO3LMFUYPHJNUtcF+NcvBqjbr7zD554+936URy2KlZtBUzytKHXXu3Y63XfGHhD
W5JIr2Ka7thMJUWWwmI3Kcg4Kf8A6wSDwSK7z4d+ILDXm1I2LSnyRFv8yF4+u/GNwGeh6V4NXrPw
T/5jn/bv/wC1KrEYRU6bkmZYbHSq1VBrf/I8mooor1DxAooooAKKKKACiiigAooooAKKKKACiiig
AooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKAC
iiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKK
KKACiiigAooooAK7b4Xxw/8ACTXV3LGHazsZbiMHswKjP5Ma4mrWnaleaTdi6sLh4JgCNy9weoIP
BHsairFzg4rqa0ZqFRSfQ2tDXxDc3l9relytHJGcTTlh/wAtD90Z6kntW/8AEmfTo9UtdIMdw72F
osUflSKFBI7gr7DvXIv4k1ZlgQXflpBKJo44okjUSA5DbVABOe5p1z4n1e8d3ubpZXfBZ2gj3HHT
nbntWTpyc1LTQ1VaCpuCvr/X+R1nju3lji8MeF7VWeWG1VmRBnc78dPwJ/Gu1nurXT5NRu/MYnRt
KSzeWPBIduSBnjIwv515G/jDX5JmnbUX89l2GUIofHpuAzVFdZ1FNNuNPF3J9kuH8yaP++3HJPXs
PyrN4aUopN7fq9TZYuEZOSW/6LQ9e8MQ2tvFoFhaqW02WCXUMTAea8ykDntgZ4x6CuM8FedrXxFf
VrhyI4Wku55CcBBzjPtyBXNR+ItXi+xeXfyp9hBFsVwDGD1HuPrRceItVubWW1e6CQTNulSGJIhI
f9raBn8aaoSXNruS8TB8unw/5I9PsJ11a81jSLcj/TtMluVU/KN8jlgfyZKzNNuI9L+H+vSWr/uI
0FlHIpyJpGx5j/TnA9h7158mt6lHdS3KXcizSw+Q7jAJjwBt+mAKadWvzpI0r7Q32ESeb5OBjd6+
tH1Z7X00D62t7a6/jsdJot5b6foaaR4g06ZtN1OQXEE8DASKR8u4DuPb61oajPceCbqFEvZLryL5
BEWP/LCNMlMduZWBHtXIQa/qdtBbQx3AKWxJg3xI5iycnaWBI554qrc311eBBczvLsLEbzk5Y5J/
EmtPZNyu9jP26UbLdbM9RtNFttO8UxSRbTp95c/2lE2f+WEcZfp7MwFeXX9099qFzdyEl5pWkJJ7
k5q3H4h1WKJIkvXVI7drZQAOI25K5x3rMp0qcou8ncmtVjNJRVgr1n4J/wDMc/7d/wD2pXk1es/B
P/mOf9u//tSoxn8CXy/M0y//AHiPz/Jnk1FFFdJxhRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRR
QAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFA
BRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAF
FFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFes/BP/mOf9u//tSiiubGfwJfL8zs
y/8A3iPz/Jn/2aBGHfBRCgEAeODceMq2/pxGaXV0UEP1y///2P/gABBKRklGAAEBAQBgAGAAAP/b
AEMAAQEBAQEBAQEBAQEBAQEBAQEBAQEBAQEBAQEBAQEBAQEBAQEBAQEBAQEBAQEBAQEBAQEBAQEB
AQEBAQEBAQEBAf/bAEMBAQEBAQEBAQEBAQEBAQEBAQEBAQEBAQEBAQEBAQEBAQEBAQEBAQEBAQEB
AQEBAQEBAQEBAQEBAQEBAQEBAQEBAf/AABEIAcMCnQMBIgACEQEDEQH/xAAfAAABBQEBAQEBAQAA
AAAAAAAAAQIDBAUGBwgJCgv/xAC1EAACAQMDAgQDBQUEBAAAAX0BAgMABBEFEiExQQYTUWEHInEU
MoGRoQgjQrHBFVLR8CQzYnKCCQoWFxgZGiUmJygpKjQ1Njc4OTpDREVGR0hJSlNUVVZXWFlaY2Rl
ZmdoaWpzdHV2d3h5eoOEhYaHiImKkpOUlZaXmJmaoqOkpaanqKmqsrO0tba3uLm6wsPExcbHyMnK
0tPU1dbX2Nna4eLj5OXm5+jp6vHy8/T19vf4+fr/xAAfAQADAQEBAQEBAQEBAAAAAAAAAQIDBAUG
BwgJCgv/xAC1EQACAQIEBAMEBwUEBAABAncAAQIDEQQFITEGEkFRB2FxEyIygQgUQpGhscEJIzNS
8BVictEKFiQ04SXxFxgZGiYnKCkqNTY3ODk6Q0RFRkdISUpTVFVWV1hZWmNkZWZnaGlqc3R1dnd4
eXqCg4SFhoeIiYqSk5SVlpeYmZqio6Slpqeoqaqys7S1tre4ubrCw8TFxsfIycrS09TV1tfY2dri
4+Tl5ufo6ery8/T19vf4+fr/2gAMAwEAAhEDEQA/AP7+KKKKACiiigAooooAKKKKACiiigAooooA
KKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAo
oooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACii
igAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKK
ACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooA
KKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAo
oooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACii
igAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKK
ACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooA
KKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAo
oooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACii
igAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKK
ACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooA
KKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAo
oooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACii
igAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKK
ACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooA
KKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAo
oooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACii
igAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKK
ACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooA
KKKKACiiigAooooAKKKKAPyD/ZR8Xf8ABUv9qH9lv9mv9piP9p79gLwIn7RPwB+Dnx0TwQ//AATx
/aJ8Uv4NT4t/Dvw54/Xwq3idf+CpHhseI28PDxANIbXh4d0EaubM6gNF0sXH2GD33/hXP/BU3/o8
j9gD/wAVp/tFf/TYqP8Agk7/AMosv+Caf/ZgH7G//rOvw5r61+KXj2/+H2h6RqOleHY/FGqa54t8
OeENN0mbWV0CKW/8S3w0+zkl1N9N1VIY0uGjD7rQrtcs0iBDny86znLuHsqx+d5tWqYfLctw88Vj
K1LC4vHVYUaduZ0sHgKGKxuJqNtRhQwuHrV6kmo06cpNI7cuy7F5tjsLluApwq4zG1o0MPTqV8Ph
oSqT2U8RiqtHDUYKzcqtetTpQScpzik2fJX/AArn/gqb/wBHkfsAf+K0/wBor/6bFR/wrn/gqb/0
eR+wB/4rT/aK/wDpsVfQ9j8XPFWleKPDfh34nfDiLwJbeLm1i10LxDY+NtL8U6MNT0XSbjXbjT9Z
k/s3QZ9Ka40mx1G6s7hYb2GU2M6zG3RWlX0iL4heAZ7PVtQh8ceD5rDQFtH12+i8S6LJZ6KmobjY
Nq1yl6YdNW9CsbRrx4Rc7W8kvg14+Vcc8LZxDFSw+afU6uCxNfCYvBZ7gsx4ZzPDV8NluHzivGtl
PEeEyrM6dOnlWKoZi68sIqDwVT6zGo6UZyj6OO4ZzzL5UFVwP1iGJo08Rh8TleJwmdYKtSrYyrl9
N08fk9fHYKcpY6jVwapqu6qxMfYuCqOMX8Yf8K5/4Km/9HkfsAf+K0/2iv8A6bFR/wAK5/4Km/8A
R5H7AH/itP8AaK/+mxV9vWvi3wpe6HJ4nsvE/h678NQpNLN4htda0240OKO3bZPJJq0Vy9giQOCs
ztcBY2G1yp4rg9F+M3hLXfF/iXQLLVNAm0Dw94Y8I+Ih41tvEumXeh30nizW/EOgwabHPD/oUU1t
f6CsAkGpTNdXN/DaJBHMgEvXjOLeGcBWyihis8y2nVz6UllEI4mnV+vU4YHG5nPFU5UXUjHAwwOX
4uvLMKsqeBj7JU3iFVq0adTDD5DnWKp5hVoZZjJ08qUf7Qk6M6f1ac8VhsFGhNVFCUsVLFYvD0lh
IKeJftHNUvZwqSh8u/8ACuf+Cpv/AEeR+wB/4rT/AGiv/psVH/Cuf+Cpv/R5H7AH/itP9or/AOmx
V95f2npv9pf2N/aFj/a/2H+0/wCyvtcH9pf2b5/2X+0PsPmfavsP2r/RvtfleR5/7nzPM+WvNvEv
xp+HPh7wb4x8a23irw/4lsPBGmXN/q9n4c8Q6FqV6JoUlNtpgEeoiGDUdQuI/sdlb3UsLz3LCKMM
/wAtb5pxHkGSYXEYzNs5y3AYfCYfMcXXnicXRhKGHyjCyxuaVI0ud1an1DCReIxcKUJzo0rSnFJq
+WCyfNcyrUcPgMuxmKq162DoUo0sPUkpVcwrrDYGDnyqnD63XapUJTlGNSd4xk2nb5W/4Vz/AMFT
f+jyP2AP/Faf7RX/ANNio/4Vz/wVN/6PI/YA/wDFaf7RX/02KvsHw748svEmpXq2L6DP4et/DOi+
IbbxBYeK9I1M3B1K51m2vre40u0LXGn2emNpDKusXExsr+dry1gCTaXeKurpPjnwTr1lqmpaH4x8
Lazp2iI8utX+k+INJ1Gy0iOOKW4kk1S6s7uaCwRIIZpne7kiVYopZCQkbsFg+JMhx1PDVcNmuDcc
Y8d9SVar9VqY2GWznHG4jB0sUqNXF4Sgqcqv1zDwqYWphnDFUq1TDVKdWRiMnzTCzrQrYHEKWH+q
/WXTg68cNPGxjLDUsROh7SFCvV54w+r1ZQrwrc1CpTjWhOnH4p/4Vz/wVN/6PI/YA/8AFaf7RX/0
2Kj/AIVz/wAFTf8Ao8j9gD/xWn+0V/8ATYq+3NM8YeEtb1S/0PRvFPhzV9a0tWfU9I0zW9Mv9U05
FkSFnv8AT7W6lu7NVlkjiZriGMCR0QkMyg+X/Fz422nwl8RfDHRr7QJNTsfiDrt3pN9rC6mtjF4W
srObR4p9ZurZrG6N/awjV1luI0ns2higd/McMdnHnfGnC3DuQ4nifN86wlDIMHjMFl+KzOg6uYYe
hjMwzbCZHhqNT+zqeLqRf9qY3DYXEScPZ4NzlWxk6GHo1qtPpy3hzPM3zSjkuAy3EVc1xGHxOLoY
KqoYStVw+EwNfM61SH1ydCDX1HDVq9KPNzYhRVPDxq1alOE/nP8A4Vz/AMFTf+jyP2AP/Faf7RX/
ANNio/4Vz/wVN/6PI/YA/wDFaf7RX/02Kvpb4ufGO2+Fl54E04aBceIb/wAa+J9M0VoYb5dPj0bS
L3WtE8PXXiC5mNnfGdLPWPEugWkdh5dubw30jLeQm32S+h3PjXwbZ69B4Vu/Fvhi18UXRiFt4bud
e0qDXrgzoZIBBo8t2uoTGaNWki8u3bzEBdNygmnT4y4XqZvnORf21g6Wa5BiMnwmbYbEynhFhsXx
BhamMybCwxGKhRwuLxOPw1KpVpUMHXxFWPLyVIQm1FqfDudwwGXZp/Z2Ingc1pZhiMBWoqOIdahl
VaGHzCvKjQlUr4ejha1SEJ1cTSpQfNzQlKKcl8Tf8K5/4Km/9HkfsAf+K0/2iv8A6bFR/wAK5/4K
m/8AR5H7AH/itP8AaK/+mxV9V/E34u+E/hp4f8T6jeatoF74j8PeGdV8S23guXxHpum6/rEGmWNx
fmG0s5WuL5VnitpNtzHp9yiKrSbHVGx02oePPB+hx6R/wkvinw14Zutbt4J9Ostd1/S9LuLwzLH+
7sk1C5tZLwpJKsWYI2JcqNoZgtaPi7hiOPzPLJ57llPGZLQwOJzaFTFU6dLL6eZYrGYLBQxeKqOO
Eo4ivisBiqSwk66xcHCEqlGEK+HlVhZBnTwuCxscrxs8PmVXFUcBKFCc54uWCoYfE4qVChFOvUo0
qOKoVHiI03QkpSUKkpUqqh8Xf8K5/wCCpv8A0eR+wB/4rT/aK/8ApsVeM/Hnxp/wUr/Zn8B6Z8Xv
F/7Rn7DXxO8J6Z8Wf2f/AAb4o8D+G/2Dfj58M/EWueHfi58evht8Idb/ALB8ean/AMFJ/idpvhnW
tN03x1c6vpeo6j8P/FliL7T4IbvRrm3mk2/rLXwB/wAFOf8Ak0TV/wDsv/7FH/ra/wCz1X0R5B9/
0UUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABR
RRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFF
FABRRRQAUUUUAFFFFABRRRQB8Af8Enf+UWX/AATT/wCzAP2N/wD1nX4c17/+0Vo93rvhvwHplnca
tZSXPxk+F6SaloYQappdu3iSFJ9TtJpbW8htZrJGM8d3PbSw2zqsrqQteAf8Enf+UWX/AATT/wCz
AP2N/wD1nX4c19/187xZw9R4s4bzjhzEYieFoZxg54KriKcZSqUqdSUXKUFGrRnzNRcU4Vqc435o
zjJJnr5Dm1TIc4y/OKVKNerl2JhiadKbSjOcE+VScoVI2u7tSpzi7WlFptHztq/wW0vS7PXfFuo+
KviF488QaN4N8XWfhseMPEK6na6JLq+hX1lqFxpWlaZp2k2R1HUbSQ2Et1c293cfZmMEDRBjnyK2
8MaX4Q8Gfsp+Ir3wtHD4F0TSdK1H4lx2ugNevb6/ffDl4vDPinxPYW9tNqF7/ZHiW+1Hz9Rure6l
0vUdY+3zNC3mSj7L8R+JdA8IaJf+I/E+r2Oh6HpiRPe6nqM6W9tCbi4itLWEMx3TXV7e3FvY2FnA
sl3f39zbWNnDPd3EML4fgn4j+DviJb6hP4U1Wa7k0m4httW03UtH1vw3r2lS3MRntDqfhzxNpuj6
9p8N9AGn0+4vNNht9QhSSWylnjjdl+BzbwZ4bxeIeLyiGFybEwpYarSqSwH9pzrZrhOIuGuIaeOz
TEYrFxx2Z4bFrhbLMkzbBTxlGrj8hj/ZsMfhKVLDuj9VgPEXOKFJUMwlXzGjKdanOEcV9RjTwFfK
M5ymWGwNKhh5YXBVsO88xuZYDExw9Snhc1l9clha9SpW9p8ba3o9t4h1vxf488PeG77UPgzP8Vvg
t4o1i3tfD+oRaZ4osvDmla9a+M/E9h4YayjvPEGmadql94Ov9W1C00u4g1f/AIRm6ni/tCPSppKq
ePDoPiq5+OPij4ceF9UutIvPB3wJ1O61XR/Dmpw2/iubwv8AFLV9W1vVNFtBaRT6wdL0KxNvcz2N
oxuH0uaOE3Lwk1+hdU7XUbC9n1G2s7y2urjSLxNO1WCCeOWXTr+XT7DVo7O9jRi1tcvpeqabqCQS
hJGs7+0uQpiuImb5bF+ANLF4bH4WXEWCpwzmfEuPzStDhahLF0s44ly/jrAVpZBiaub1HkuRYKPH
eYVMLktSOZYlKh7OWc/7fmMsT7lDxVnQrYSusoxMpZdHJcLgacs8qrD1MvybF8MYunHNaMMBFZlm
mJfC+EhXzKEsHR/e8yy7/ZcHGj8GfEfUrv4qeNPiRqnwvh1vW7e7/Zj1Xw9p+oWmk6vpcWs6lF46
tNR1TQtGutUs7BL+9utGuzaKtsZYJLm5exMjTw3cEO98S9Q+HnxC8BeN9L+FvgW61XWdP+CfxA0t
tT0vw/qHh6LwrayaXp82n+DNRs7iz06G+1jUrq3hm0vw+Uu77TH0u4vLaCATGSb7hqjBqem3UF1c
22oWNxbWNxeWl7cQXdvNBZ3WnSPDqFtdSxyNHb3FjNHJFeQzMklrJG6TqjIwHXiPBLFY5cVf2hxP
luJnxxRr0eI5/wCqFGoqEZYrMsbhp8LwzHO8xhkVZYjNK8cbiMWs7xGJoYfL3gquV4/BUswMKXiV
QwzyP6pkmMox4ZqUqmTx/wBYKkPayjQwWGqrO5YTLcHLNKbpYGlLDUqDy2lRq1sWsTDG4XEzwh8C
eLLC58bzfEnU/Cmi6xrHhnUfhZ+z5Jeafa6FqljP4k8PeHPib4xuvHXhyysLy10+8ku7nRrPU7W5
05IVvLuCZoYYJ/tsCz7XxEvvDnjrUvEmr/CbTLmbS9D/AGe/jToXjXWNL8O6no2k3n9p6NYR+DvC
GZ7CyTU9csNRs9VvYtJit3udGtzMsr2z3i2s/wBOeF/jT8NvGUfh+Xw9r9zcx+K9Si0nw2954c8U
aMus3s/h/wAS+K7dbA63ounedbXPhzwh4g1m1vx/oFzYWUU0FzINR0z7Z6nWFfwIeJw2OwtbibC2
zp4etnWIpcNKGLWKwHFXEvF+AfD2IqZ3VlkeCeZcTYvB5pg8Qs4nmGT0vqVLFYCticVi6t0vFBUa
2FrU8lr/APCaqtPLaU85cqDo4rIsl4fxX9r0o5bTjmeJWDyTD4jBYil/Z8cJmE/rFShiqdGhh6fy
tZeEtP0bxT+yrd6RoEWmyaf4f8UaTf3FjYNbNBYXfw3W6ks9TkhjTdHPq1na3GL4szahH5gP2h5C
83xz8Hp44+JnwX8O3ltO+kaxonxw0XU72O1a5i05NZ8B29jb3TuVMMNxHM4msWleNjdQoYXEiAr9
L6jqNhpGn3+rareW2naXpdndajqWoXs8dtZ2FhZQPc3l5d3MrJFb21rbxSTzzysscUSPI7BVJFbS
dc0rXYp5dLvEufsr2kN9AUlt73Tbm90rTtctrLVNPuo4b7S9QfSNX0zUG0/ULe2vYba/tnmgj81Q
frcR4TZPieHs64ZnXpLLM84q4G4lxeHhl1KnQdLgynwFRllUqFKvTjKjm9DganRrYhShLCwzKooU
q31WCreDR48zChm+W51GlUeNyzIuJsmw9aeLqTqqpxFLimoscqlSnNxqYCrxNOpTpNSjXlg4uU6f
t5ez+Db6Hxj4+8Ip438UeHtXg8SaH44+AHwxS1udOvlv2m8G/EvwvqXxG8RW8BhA/svWvFN00TXk
avFJaeFLWdpRFGHZNbj0SH4VfFD4W6n4ev7z48694q8cXulwDw3qd1q/iPxRqfie61jwV420bWjZ
yWi6PpOn3Wgzpq8eoQ2Xh230ma0mW1ktGtG/QisrStb03Wv7S/s6aWb+ydVvNEv/ADbO9s/K1Kw8
v7VDH9tt7f7VEnmx7Ly08+ynyfIuJdr7fjavgDGosVXlxZLG5jmvCmO4RzzMM5yChmc8fhM4xOcY
jOM3oU45lg1heIpQzOlhMnzKrPG0cqwWGq4Orgcxw2MnSpfRU/FVxdGmshWGweBz3C5/lmEy7Nau
ChhcRl1HLqOX4CrN4PEOvlClgZ18wwdOOGqY7E1oYiGJwdbDxnU+DPGNv4d0TwD+0f4K+IHhi51v
4leMdY8d+INDig8NahqeoeLNOudGtpvB2u6Jq9tYfZ303wlbxwW1xsvraPw62jXkV1DaNJsuDxhY
X2h/EP4lXPi7xPZ+FtP8XeGvBdn4dh1X4QzfEFfFnh6w8IRWV/4W0a9bUFFtqVlrq6y974cDW0t3
LqsGqx2yxzSSx/oRRSx30f6OMcWuIqFP6jicHPKHDJ8zwVeeEwq47hOnxNmORcV5Jm/EOMrw4/zW
pUxlDMslo1MXQo4nFYHFLF5pRx7wvitUw975RVmsTRxEcwUswwWJpRr1nwvKM8lwmaZFmWAyjD05
cKYGEcPVweZTjh6tSjRxNF0MDUwvnnwl0m+0H4ZeBNG1G41m5u9N8MaRaO/iKzi0/XUiitI1tbbV
7KHUNVS31CztfJs7qNtSvZRLAxuLiScyGvkP/gpz/wAmiav/ANl//Yo/9bX/AGeq+/6+AP8Agpz/
AMmiav8A9l//AGKP/W1/2eq/ecnyyhkuUZVk2GlUnhspy3A5Zh51Zzq1ZUMBhaWFpSq1Ks6lSpUl
TpRc51Kk5zk3Kc5Sbk/y3McbUzLMMdmNZQjWx+MxWNqxpxjCEamKrzr1FCEIwhCClUajGEIxirKM
YpJL7/ooor0jjCiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKK
ACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooA
KKKKACiiigAooooAKKKKACiiigAooooA+AP+CTv/ACiy/wCCaf8A2YB+xv8A+s6/Dmvv+vgD/gk7
/wAosv8Agmn/ANmAfsb/APrOvw5r6e+Ifx2+HXwvn1SHxbfa5GNB0XTvEPiK50Xwl4p8S2fhzSdZ
vr7TNDu9fu/D+kalBpSa1qOmaha2AunQn7Fc3VyLawie7ABT+OnhXxB4j0bwPqnhzT7zXbvwB8Uv
BXxBu/C9hd6bZ3nifS9AurqG/wBNs5dZurDSH1Cyh1H/AISHSrfUtQ061udW0SwgOoWUkkdzH5h4
3k8ffEK5ttXi+DfiXTvBNj4u+H0finS5tS8N6H8SPib4N07TviDNqOmz2ltr4jHhHwj4v1/wZr8P
h7WtfsL3xFaW/j/TRpDWupW0Gv8Aq8Px28C3javHp9r451STSPFes+CiNN+G/ju8i1TxH4cv/EWm
+IbTQbuLw+bLXLbQ7zwrrVvquqadcz6VZ3MNrZS3ov8AUtOtbrMl/aT+E0Vvpt+NW12fSdQ8E+FP
iNJrdr4N8XXOjaL4K8aX2r6b4f17xLqcOiva+G7a4vNC1ZLqLWpLK602GwvL3ULe2sbO7uYAD5k/
4Ur8Tte0jx22p6H4w0/TYvhZ8VI/g5oNz43Met+DfEU3jLXtR+F2nvcaT4quYk8SaRpctrdeHtQn
vr6LwlpN/a+F01S3WwubUa/xM+Fnj/8A4SH4gzeCPCeoabo+t/HXw/468UXNtpOmeJLHx74Sm+B9
joMZfwxB8Q/BV94lg0D4m2Vzd6r4e1XV9JEV3cWPiKz0zxBDZxRD1OH9pzRRofxDbVrabw/r/hTX
/jnoGi3up+HPGT+CdTuvhFL4tv44pvEVlo1xBdXsvhbwzL4h1XTtGlvbs29pq9vpkc+oWM2nw+gX
nx/+GemS6wmpatqUVn4bttTk8ReIrXwr4svvCGlXuh+DpfH2t6XN4mttEk0w6jpvhS3n1Sez84Tr
JGdGZR4hP9kUAfMPh74HfE290LWJvFqeLtQ8U6B8I/hzB8ONQufEzaPe6X4u0f4rfGfxRJZRWmn+
Ntf0201rR/Clz8NNGvtRvNe12abSAdFHibVY59aM/wBGeCfBk1t4c+M/he/8HT6WviTxz8SNSVrp
tIbTvF9n4xe4vLPUbJ7HVLuVYZbK6t7C7XVIdKube8gnjNvsj+0P6j4R8Y6V4106bUtJttetIbe4
S2li8QeHNb8OXJeWytNRgltotasbIahaT2N9aTx3+mveWJaV7Vrhb22u7a35fxd8ZfAPgfWLrRfE
Oo6hDc6Xpmja34hurLQNc1TSfCeieIdSv9J0XWPFms6dp9zpnh3Tb++0rVVS61O6t0gtdM1DUrv7
PptnPeIAfE3hr4GfGnRPDngHSfD2kS+FdT0HRvBQ0e8k1TS20/wn4pt/2O/jX4D1XVzb293fi3Wx
+K/i3Q7a/ktLK4+13l99vggvbGOe4jr+Hfg/8a18I+J7K/XxvaadcW/woJ8OWnh7w7apf+JNA1XW
J/EmrapoGr/G/wAVp47t2tP7ItPiBcN4k8IXfj+0XS7zTL/UNS8OeXc/Ytr8d/C22+i1PTfElpqs
fjjxv4K0bQdN8OeIvEWueI/+EEuTHrGu6Tpmk6PLeS6NBbmKa61DyTp9pc3Frpf26fUr2wt7vpPF
fxFs9B8JeGvH1gseo+E9V1jwWmo3bxXltdQeGvHGoWGh2GvW1vPDDJAml6hr2i6xrMepx2xtPDdr
rchQahBb27gHg3iTSvGVr+yhd2fifQv7G1LRby01LxLolvd6jeK3w28O/FW31nXAltq/izxzf2Ue
r/CnT7u6bwcfF2vLoEd83g7Tb57fT7SNMrxR8O9eg+I3izV4fh1r2u+BfEXxg0Lxn4ytfDOoaBbH
4geGD8C7LwloJmgfxRpc2tWHhT4k6Xd6lrvhnVI7I3E1/ofia0XVoLGaE/SPxA+KnhL4aW0l34n/
AOEgNvb6LrHiS/l0Lwp4k8Sx6V4d0BYH1nWtVl0LS7+LT7KxW5hYi5kjurlPPksba6jsr57bFj+N
Pw3s/E0fgO2m1eK8s/EOh+BxPaeDvEw8J6fr+ueEtL8YeHdDbxNBo/8AwjNvLqHhzVdNms4U1DZb
yXNpYXX2W5vLGG5APh6fwp4/uNS8TeCLvwf8RtV+IMXwEguvheLX4gwuvwp1TWfi98c5PhXceJ9X
n8X2jza/4W8OjwZpup+MdPuvEt5BaeF9bsBJqiaolvq/qeqfD74jR+KNcvvGfgrxl8QvBN3rnxtu
tM8MeFvFdlpE3/CQeILnwBJ4C8TJ5njLRpNIhXSdM8ZaboOqfb7jUvBV7qD3MMOnS35v39o8HfHH
w149+KmjeHPCOk3k+k+IPhZr3jhPGWp+Gdf0F9c0vQvFXhfSPDjeH73WNMsIdf8ADV+nivW9UtL2
0muYfLe0vrVY7PV4Lm+2L/8AaG+Gthr03hoS+LdQ1ePxFq/g+GDSPh9441WG/wDF2hWEur6t4a0q
8stAms9T1Sx0WC51q5FjPPaQ6XaXd1LdoLaZUAPBvDWjfEfwB8Udd8e614S8RXnhiC38f694r1DX
NZtdR1fSNKh0A6ppum+F/Gtr8Q9K0/x/oEt9ptlpfh7w548+G2kaj4SgmeZvE1rHpJudV+47eb7R
BBOI5oRPDHMIriMxTxeYiv5c8RyY5k3bZIzyjhlPIrxpv2gfhmbLwxqsN/r13oviyx8D6jp+vWfg
7xZcaHZ23xI1GDSPBf8Abeqx6MbLRLnWNTuYbKWx1GWC90eWSM67b6ZFNBJLBJ+0X8KbaXWhqOsa
xpFloM/xGtbvW9W8I+K7DQLq7+EzayfiDZ6NrU+jLp+uXfh2Hw9rl3LbaTPeTX1rpGqS6Yl7/Zt+
tsAe418Af8FOf+TRNX/7L/8AsUf+tr/s9V9q+EfGOleNdOm1LSbbXrSG3uEtpYvEHhzW/DlyXlsr
TUYJbaLWrGyGoWk9jfWk8d/pr3liWle1a4W9tru2t/ir/gpz/wAmiav/ANl//Yo/9bX/AGeqAPv+
iiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKK
KKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooo
oAKKKKACiiigAooooAKKKKAPgD/gk7/yiy/4Jp/9mAfsb/8ArOvw5rtfjx8JPHnjPX/GOm+DLTXL
HQ/ix4P8H+EvGWq6bq3g1dFlTRdc1tbq71y215IPEugSWfh7WHtpb3wnaeMpvF2nmLRJdP8AB91p
Fpr99xX/AASd/wCUWX/BNP8A7MA/Y3/9Z1+HNfTHxg+IGs+DP+EO0vw3Ppqa/wCLtZ1GxtLW58I+
K/Hep3dtpWhahq12ujeF/C95oaXMyywWaXupa/4u8L6JpNlLLcS3l7evZabcgHM6/wDs8adrfh7S
fD7eIEns9M+IfxR8fzab4i8N6V4p8LaxP8UfFXjHxVeWWteE9TkXTNTl8N3Pi+ePw1f3jTCyltBe
S2U8twyReb6V+zD4gsbjVfh/H431S0+Es/wF+Ffwf1OX+zPD02r+M9K8O+KPi/P4h0hnTy38N3Uf
hXxTpOiz6taacbTULPxDqD2tsNS062uNLxYv2ofiHd+DH+Idn4b8Itoeh/s7fC74v69oezWrjWdV
8S/FDUPiPoOn6Ro2pW+omw0zQNL1PwZZ6nf3V1Y61enTZbuyt/Ommh1Gz9s+DvxW8VeMx8QdP8Ze
Hn0XUvAs+kvHf32iS+BY9WstZ0V9UX7Z4a1PxN4vvfDk2nTW9zDNPea7eW99p0un6xCtqlzLZWwB
R8T/ALOGjeJvB9z4Ql8S6naQXXjv40eOpL2OztJZlu/jP4T+LfhPUbBImdUFvolt8Wb27spGZpbq
fR7VJwkd1N5ejD8DLzT59esdC+I/iPQPCHiK+1nXNR8OWGleHLm5l8Qa54UfwveXEmr6vp2ppdaJ
55i8Ur4evtLuoH8R20CT3c3hkP4bk8X0P43/ABT8Y6Vo+nXuoeGvBHjP/hKvgbqeq6RL4H8RDZ4W
8eeJ9S0zULDTtSXxpqPhXxn4e1C60lLfQfiH4O8Z3VvrlomrWmo+EfDrvYTXpqn7TfxA0bwHY/Ee
bRfBOqaV44+E3xF+JvgrQtOGspqnheTwRHpN/Z6P401L+07y31u3vNO1m2sde1fStN8N/wDCN+Kl
h0FbDVl1CC+hAPafhr8GL74To1v4U1nRYLHW/F1jrPibRNK8NWPhHwjbaLZeFLvRHtvCnhDSBd6b
o2ralqkWjanq97aXFkl89qWYJBbR6fc4nxR/Ze8D/FHxzL461W38NSahqnh7QfCuvf8ACR/DrwN4
9u/7H8OaprGpWD+Er/xhpGqHwjqtyviDVrDVbtLbVrG8tW0+eHS7PVNOTUZfOtY/aI+K3hjx1qnh
DUfB9h4ih8Da58NPDnjLU/DXhPVrbR9avPiHJpFxcX2la/qvjc23g6DQNN8SaZDpmnavp/iu68aa
1p2pada3OgSXtmlvu+A/iD8Q/HfxS+FviPU9U0PTPA3inwv8eG0vwXo76va6pDL4W8ZeDdC0648W
G51i507xNqFpZwyyi7stF0RPC9/q2paQF1Fb2K/cA9AuvghqkXiBvFXh74g3mi67ZeIvHer+Hbm4
8N6Vq1vpWlfEuLS7jxf4cvLSae2j1a1l8QaLpXiHRtQLWWqaXc2SadcXOpaRPeWVzo+Nfh14i1zw
NZfDw65qPinTdU8SfD+01bW9fl0+DV9P8G+FpvD+qeJ7jVL2zgtX1zW/FcnhnUbRbyxsLSS01rxj
BcxWtno+ju8Pmt78TPiF/wALZ8V/DvwWfDNnd6t8Utc0KHWfGK+K/E1hpVt4f/Z5+C3jyGSy0G28
T6THbw3t/wCI73T7jSdGv9B0tJbiXxO0N1rc2sL4g7bU/i/q0PwO+HXxHEeiaH4l+IWmfDJ4NPut
K8VeL7S11jx5BpF1d6Zo+g+FLYa/4ovraO8vY9JsBdaFbXb26XGra5ounx3d5CAM+N/7PelfG6RV
1nXRbWEvhLX/AAhcabqPh3RvFVnYxa/LaySeJfC1triyWnhvxtaLb/ZrXxMlrf3MNqYo4IYHhEr9
HpXwcstOj1sS69fXk+ufEbwF8R7ic2lrBs1LwL4N+HHg6GyWJCyG11OD4d21/OwKSW8+qXEUIaK2
i8zP+FXii9+Nfwx1WTxfbX2jXo8V+PvBOrf8I3f+IvAWpsfBfjTWPDaXlrLofia48SeEdQuo9Jil
vbCy8W3l3p1011ZHVJk3rXx5eaZrGk/B7xHruj+KPjBrPiK6/aym+FFvbXPx8+LyXN/4Lsf2qY/B
dj4S07VdU8c3Mfhu4v8Aw1Z23hqbxVYC0177HPczXurTNc3sk4B9hfDn4K3Hw/1bwncN441XX9C+
H/w/1f4Y+BvD95pWl2SaR4Tv9S8IXdiuo6hZKk+taxplh4L0bRRqcsVqt7ZW6XE9ouove3l9b0/4
K6Xp/iXSPEqa3fyXGkfFfxt8VYrZre3EM19428Ga14Nu9IkYHetrZW+ste29wp855rdYpU2SFk8Z
8Safrvgj4NeIvECL8R/hl440rxXoepeBtJ1n4z+PPjhdeMvFcD2tl4Y8GNDrnivVpNQ0X4galqc3
g/UfCcc9tbBrqPxMz2WoaTpusab5X8Rr/WvEf7KHxF+LuoeN/iRonxc0W71+61vTfDfxH8feCLX4
Y+MYtZ0Lw/qnw7i8O+FPE+laRe6d4SsNNs7LT7zWLPU4/ET3N54/sHA8aS3FyAesT/scaFLY+EdO
PjK5uofB+j/DDT9JvtY8K+H9c1zR7z4XapFq+nXPhLVtRWVvCFh4hvIIm8VadpVuZ9WQzxnU4knK
ru+EvgP4pvodQbxx4x1G0srH4k/tF+LPBfhzTtM8NXB8Pz/FPxb8TdO0TxJJql1b6xb61JD4F8c6
nqGmaLrGny21hfeJ72z1y3v4NPs9MsfPvHuqal8Gfjt8N59M8X+MofhV4W8HQyfEHSfFPxB8XeLL
KXSPHnjS/wDCEHibVb7xrr+t313deG/Fur+Er06ne3lxNo/hW21mztWtdNDJFhfCTxl8Rr/x/oP/
AAk3ibxOyeJ/2ofF943h/UdU1DytF8HeKf2PtG+Kvhz4fXFhJKsEen+EL3XLT/iXCFbRNfsbjVli
+3Ty3MgB9VfB74P6f8IrPxFa6dfWTxeI9TstSk0jw/4esPBvg/SZbLSrTSi2g+ENKmn0zSbnUltV
utaubV0XUbkQt5EEdtFGPmT/AIKc/wDJomr/APZf/wBij/1tf9nqvv8Ar4A/4Kc/8miav/2X/wDY
o/8AW1/2eqAPv+iiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKK
ACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooA
KKKKACiiigAooooAKKKKACiiigAooooAKKKKAPgD/gk7/wAosv8Agmn/ANmAfsb/APrOvw5r7Y8U
eCPBfje3s7Xxp4R8MeL7XTrpr3T7bxRoGla/b2N68Etq93Zw6taXcdrdNazz2zXECpK0E0sJcxyO
p+J/+CTv/KLL/gmn/wBmAfsb/wDrOvw5r71vUkksruOG3tbuaS1uEitb12isrmRonWO3u5Ut7to7
WZiI7h1tblkiZ2FvMQI2APDPAPjT9nrxbe3nhDwHD4QkfV/C72I0628GS6FpPjDwPpl3qMjw+H7q
/wBB03RfHfg7T7zxdqlwzeHbnW9BtZPFV5dFoxr8st5634Z8IeE/BWnyaT4N8L+HfCWlS3T3sume
GdE03QdPlvZILe2e7kstKtrS2e6e2tLW3e4aMytBbW8RcxwxqvwvpfgL4xxaRNoHwz0D4l+AGsPh
b8QfD9nonxS8QeBPE3h34aeJ7/wRd6X4Isvg18QbO41n4iMln4nj0aJbu61O78Lp4NsnN9Y6T4gt
9P0wZXg74MfFa9t/7L1ew8UW/gzUvGnwhk1jw7LAPh8q6bo0Xjiy+Il8bXT/AI0/ETULttU0u/8A
DOm+Kr6LWLVfGIs7aS3stTEGpalqQB9s2vwd+Edlpep6JZ/Cz4cWmi61cabdaxpFr4I8M2+l6tda
NdyX+j3Op2EWlpaX9xpV/LLe6bNdRSyWN3JJc2rRTOzm3B8Lfhla3Ov3lt8OfAlvd+LIL218U3UH
hDw/Dc+JbbUrpr7UbfX549PWXWYL+9Zry9h1FrmO6uma4nWSYlz8n+NPhR8c71fix4a8J39/puh+
G9K8ea/8GtVg8QLbahruv/Fqaz1LVNKWWLVNOvNN1PwJs+I/hrw9e6pq2jQRWHxB8OXFhrWlyaM+
p6PieCvgt8R9QuPDWl+MLfXpvh3cfGey12/8MR2n/CvLPSvDunfA34naRe3UekaJ8VPHGow6Bq3x
Cu/BSXOjtrsKajr1tda7Jocmm6pcajdAH2J4y8P/AAxsnuPij438L+EZ77wJo8+snxrq/hnTdV13
w5o/huO/1p7mw1RtPu9ZtYtKEupahbw6c/mxT3F1JaxG4uH8y9ovgX4eafrFz418P+C/B+m+ItdW
e8vvFOl+GdH0/XtVGqtFdXU99rFvYwandvfusU9211O73EiI8+50BHzj+0z8OfEvj2fVLJvB/ifx
/wCFtW+D3j7wpoOjeGfEljoP9gfErWntE03XtVF94i8OxoLzTc2Wm+IFXWm8PpaavAbewi1yWPWe
Zt/h/wDFmLxZZSReHvEtt46g+KGnapafFIeJdMbwRp3wdg0O3hl8JT6MPEcl5cxDT0ufC7+Fh4Wu
rd/HU6/EZC0KrrMYB9lp4X8Mx6s2vJ4d0JNce+n1N9ZTSNPXVn1K60fTfD11qDaiLcXjX1zoGjaR
oc92ZjPNo+labpkkjWVjawRVdT8EeC9b8O23hDWfCPhjV/CdlHpsNn4X1PQNKv8Aw7aRaMYTpEVt
ot1aS6bBHpRt7c6akVsi2JghNqIjEm34m0Hwb8RdF8O/Dm5tfhb8RYfFPhTUvhJqfxc1e68eaff3
/wAQde0W81C08Z6ho+jXHjS90vxDPJdahfeINV8T6lf6Pqer6RNpmmW9vqz2cWnaVm+IPhV8W/Fn
hPxBd3PhzxhYar/wrv8AbM1vwdpE/i21s9T0T4l+NPjNd+KvgiX/ALC8Uz6YniOz8M3nmaFfx397
p3h4q9tHqNo8aAgH3t4e8MeGvCVgdK8KeHtD8M6WZ3uTpvh7SbDRbA3MiRxyXBs9Nt7a38944YY3
l8vzGSKNWYqigZmp/D7wDrWhah4W1nwR4Q1bwzq2qXeuar4d1Pw1ot/oWp61f6pJrl9q+oaRdWUu
n3uqXutSy6xd6hc28l3capJJqE0z3btMfiz4kfB/4p6brGv2fgO11lfhtJ8QfBXiG90d5JPHEWvW
EHwx8RaNrt7ceE774heDr3xAh8ar4W1HXNOvPEVkdS1WGHxVJpuv3enSiWlp3wQ+KuoeE/Eq+KR4
yv8AxFo37PtpafDi+fxQ+jalpXxO0vxz8XvEPhSO1s9K8b69Z2fifw5ol94B0qLWrvXdeaCxMmly
eKdRhutaa6APrnw18Nvgj4T+23ngz4e/C/w63h7V/t9/P4U8H+FtMm0jxBp2jXluLuY6NpsMtprd
noHiHULVJfk1CHStcvbZCtrqU8c25p2k/Drxz4em1+z0Dwxr/h74naZoXiHUbq68PWMsHjPTpdKs
H8P3+u22oWKzaqYtIi02OxXWYJLiytbe1tljgFukUfB+CPCl3o938ebJPCVzo0nibxrqmvaZqrnS
RZ+LIdd8J6RGLuzntdSubtXt9Xh1O3vYtYttMkguZWkhjltZhOfkHw78J/ih4X8FeHdG8J/CjxNo
2k6f8OvhR4M+IHhzxV4sj8Rw+IfGGga/ptzqvi/TtB0H4oaGviiy0DS7DU7bXobjxP4VTx/YeINI
02a3utO8N3ujMAfonrHhHwp4h+3/ANv+GPD2uf2ro0vhzVP7Y0XTdT/tLw9PMbmfQr/7bbT/AGzR
prgmeXS7jzLGSYmV4C53VjeJPhf8NPGUN1beL/h34F8VW99rEXiK9t/EnhLQNchvPEEOj2nh6HXL
qLU9PukuNYi0DT7DQ4tTlV72PR7K00xJxZW0MCfA138KfjingHw1F/wivibUNf0HVfjodE8MXlxp
R8OPbeJ/GFr4g+H8M8ehfGrw/wCJPhxqEWmrDYeEvGHhf4g65J8Nooda0+5spbWXTW1D0Dwx8OPj
rb/tAf8ACS6zf6lDpx+KPizXb7WbXSba80m7+GGo6Bq0Xh/wlP4ouPibZXN9otkH0DR4PC0Pwqtp
dM8XaZH4w/frBca/qYB9t+H/AA74f8J6PZeHvC2haN4a0DTUkj07Q/D+mWWjaPYRzTy3UyWWmadB
bWVqktzPNcSLBBGsk80srAySOx+GP+CnP/Jomr/9l/8A2KP/AFtf9nqvv+vgD/gpz/yaJq//AGX/
APYo/wDW1/2eqAPv+iiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAK
KKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAoo
ooAKKKKACiiigAooooAKKKKACiiigAooooAKKKzdZ1nSPDukar4g8QarpuhaBoWm32s65rms31rp
ekaNpGl2st7qWq6rqV7LBZadpunWUE93fX13PDa2lrDLcXEscUbuAD4S/wCCTv8Ayiy/4Jp/9mAf
sb/+s6/Dmvv+vxDf4U/8G3cjtJJ8Nv8AgiG7uzO7v4O/YPZ3diWZmZtOJZmJJZiSSSSTk03/AIVN
/wAG3H/RNP8AgiD/AOEb+wd/8raAP2+or8Qf+FTf8G3H/RNP+CIP/hG/sHf/ACto/wCFTf8ABtx/
0TT/AIIg/wDhG/sHf/K2gD9vqK/EH/hU3/Btx/0TT/giD/4Rv7B3/wAraP8AhU3/AAbcf9E0/wCC
IP8A4Rv7B3/ytoA/b6ivxB/4VN/wbcf9E0/4Ig/+Eb+wd/8AK2j/AIVN/wAG3H/RNP8AgiD/AOEb
+wd/8raAP2+or8Qf+FTf8G3H/RNP+CIP/hG/sHf/ACto/wCFTf8ABtx/0TT/AIIg/wDhG/sHf/K2
gD9vqK/EH/hU3/Btx/0TT/giD/4Rv7B3/wAraP8AhU3/AAbcf9E0/wCCIP8A4Rv7B3/ytoA/b6iv
xB/4VN/wbcf9E0/4Ig/+Eb+wd/8AK2j/AIVN/wAG3H/RNP8AgiD/AOEb+wd/8raAP2+or8Qf+FTf
8G3H/RNP+CIP/hG/sHf/ACto/wCFTf8ABtx/0TT/AIIg/wDhG/sHf/K2gD9vq+AP+CnP/Jomr/8A
Zf8A9ij/ANbX/Z6r5A/4VN/wbcf9E0/4Ig/+Eb+wd/8AK2u7+F/wd/4IC3fxG8Dp8F/hZ/wR8ufi
3B4p0S/+GyfC/wAD/sWzfEaHxrpl/BqXhy98Dr4U0tvE0finT9Utba/0S50EDVrS/toLqweO4hjk
UA/YOiiigAooooAKw9c8T+GvDEUE/iXxDofh6C6kaG2m1zVrDSYriVF3vFBJf3Fuk0iJ87JGzMq/
MQBzW5X5eftSfCH4T/Gv/gon+w74Q+Mvwv8Ah38W/CVt+yt/wUF1628L/E3wV4a8e+HbfXbH4i/8
E/bKy1qDRPFWmarpkWrWdlqepWlrqMdst5b2uoX1vFMkV3cJIAfoH/wtn4V/9FL+H/8A4WXhz/5Z
Uf8AC2fhX/0Uv4f/APhZeHP/AJZV+TP7d37C/wCxL4d0D9l+Tw/+x1+yxoUmr/tz/sn+HtWk0b9n
z4SaY+qaBrPxLtLTWND1F7LwjA17o+q2rG21LTLky2V9bkw3UEsZK19z/wDDvb9gX/ox79kD/wAR
p+DH/wAxVAHv/wDwtn4V/wDRS/h//wCFl4c/+WVH/C2fhX/0Uv4f/wDhZeHP/llXgH/Dvb9gX/ox
79kD/wARp+DH/wAxVH/Dvb9gX/ox79kD/wARp+DH/wAxVAHv/wDwtn4V/wDRS/h//wCFl4c/+WVH
/C2fhX/0Uv4f/wDhZeHP/llXgH/Dvb9gX/ox79kD/wARp+DH/wAxVH/Dvb9gX/ox79kD/wARp+DH
/wAxVAHv/wDwtn4V/wDRS/h//wCFl4c/+WVH/C2fhX/0Uv4f/wDhZeHP/llXgH/Dvb9gX/ox79kD
/wARp+DH/wAxVH/Dvb9gX/ox79kD/wARp+DH/wAxVAHv/wDwtn4V/wDRS/h//wCFl4c/+WVH/C2f
hX/0Uv4f/wDhZeHP/llXgH/Dvb9gX/ox79kD/wARp+DH/wAxVH/Dvb9gX/ox79kD/wARp+DH/wAx
VAHv/wDwtn4V/wDRS/h//wCFl4c/+WVH/C2fhX/0Uv4f/wDhZeHP/llXgH/Dvb9gX/ox79kD/wAR
p+DH/wAxVH/Dvb9gX/ox79kD/wARp+DH/wAxVAHv/wDwtn4V/wDRS/h//wCFl4c/+WVH/C2fhX/0
Uv4f/wDhZeHP/llXgH/Dvb9gX/ox79kD/wARp+DH/wAxVH/Dvb9gX/ox79kD/wARp+DH/wAxVAHv
/wDwtn4V/wDRS/h//wCFl4c/+WVH/C2fhX/0Uv4f/wDhZeHP/llXgH/Dvb9gX/ox79kD/wARp+DH
/wAxVfDH/BN39hf9iXxV+x/4A1zxP+x1+yx4j1q58c/tCW9zq+vfs+fCTWNUuLfTP2jfizpemwT6
hqHhG4u5YdP0yys9OsYpJmS0sLS2s4Fjt4Io0AP2Q0bX9C8R2Z1Dw9rWk69YLM9u19o2o2eqWYuI
1RpIDc2M08ImjWSNniL70WRCygMpOtX5nfsEfDr4ffCf47/8FPPAXws8CeDfhr4G0b9sP4VTaP4L
8AeGNE8G+E9Kl1T/AIJ9/sWanqcum+HfDtjpuj2Mmo6ldXWoX72tnE15fXM93cGS4mkkb9MaACqG
p6rpeiWNxqms6lYaRplqEN1qOp3lvYWNsJZUgiNxd3ckVvCJJpY4UMkih5ZEjXLuoN+vzj/4KdeF
/DPjf4L/AAN8HeNPDuheLvCPif8Abs/YS0XxJ4W8T6Rp+v8AhzxDo19+1F8NYr3Sdc0PVbe70zVt
MvIiYrqwv7W4tbiMlJonU4oA+3P+Fs/Cv/opfw//APCy8Of/ACyo/wCFs/Cv/opfw/8A/Cy8Of8A
yyr8tv8Agox+wn+xD4X/AOCe/wC3d4m8M/sb/sq+HfEnh39jX9p/XfD/AIg0L9nn4R6Rreha3pHw
S8cahpWs6Nqun+ELe/0zVdMv7e3vdP1CyuILuyu4Ibm2mimiR1+rfC//AAT6/YJm8M+HZZv2Iv2Q
5ZZdC0iSWWT9mv4MvJJI+n27PJI7eCyzu7EszMSzMSSSSTQB9Of8LZ+Ff/RS/h//AOFl4c/+WVH/
AAtn4V/9FL+H/wD4WXhz/wCWVeAf8O9v2Bf+jHv2QP8AxGn4Mf8AzFUf8O9v2Bf+jHv2QP8AxGn4
Mf8AzFUAe/8A/C2fhX/0Uv4f/wDhZeHP/llR/wALZ+Ff/RS/h/8A+Fl4c/8AllXgH/Dvb9gX/ox7
9kD/AMRp+DH/AMxVH/Dvb9gX/ox79kD/AMRp+DH/AMxVAHv/APwtn4V/9FL+H/8A4WXhz/5ZUf8A
C2fhX/0Uv4f/APhZeHP/AJZV4B/w72/YF/6Me/ZA/wDEafgx/wDMVR/w72/YF/6Me/ZA/wDEafgx
/wDMVQB7/wD8LZ+Ff/RS/h//AOFl4c/+WVH/AAtn4V/9FL+H/wD4WXhz/wCWVeAf8O9v2Bf+jHv2
QP8AxGn4Mf8AzFUf8O9v2Bf+jHv2QP8AxGn4Mf8AzFUAe/8A/C2fhX/0Uv4f/wDhZeHP/llR/wAL
Z+Ff/RS/h/8A+Fl4c/8AllXgH/Dvb9gX/ox79kD/AMRp+DH/AMxVH/Dvb9gX/ox79kD/AMRp+DH/
AMxVAHv/APwtn4V/9FL+H/8A4WXhz/5ZUf8AC2fhX/0Uv4f/APhZeHP/AJZV4B/w72/YF/6Me/ZA
/wDEafgx/wDMVR/w72/YF/6Me/ZA/wDEafgx/wDMVQB7/wD8LZ+Ff/RS/h//AOFl4c/+WVH/AAtn
4V/9FL+H/wD4WXhz/wCWVeAf8O9v2Bf+jHv2QP8AxGn4Mf8AzFV8Mfsz/sL/ALEurftVf8FHtH1X
9jr9ljU9I8LfHP4F6d4Y0rUP2fPhJeab4c0/Uf2PPgJrmoWOg2Nz4RktdIs77WtS1HWLy20+K3hu
dUv73UJ0e7up5pAD9hND8X+E/FD3MfhrxR4d8RPZrE92mh63purPapMXWFrlbC5uDAspjkETShRI
Y3CklWx0VflT4N+A3wN+BH/BUP4bWHwP+DHwn+DVj4m/YI/aGu/Eln8Kvh14Q+Hlp4gu9J/aG/Za
h0u51u38I6Po8Oq3Gmw6hfxafNfpcSWcd9eJbNGtzMH/AFWoAKKKKACiiigAooooAKKKKACiiigA
ooooAKKKKACiiigAooooAKKKKACvgD9rn/i/fxJ+Ef7Dmnf6V4c+IWPjV+1N5fzwWn7MXw216w8j
4d6rjMY/4aT+KY8PfDC50a9Ecfin4N6P+0KLKT7X4ebb9/18AfsH/wDF2LP4x/tsah+/n/a38bQX
3wrnf94bH9k34RvrPgr9mq0064PzPoPxA0y58aftM2ds436bq/7RXiDT8stspIB9f/8ACpvhX/0T
T4f/APhG+HP/AJW0f8Km+Ff/AETT4f8A/hG+HP8A5W16BRQB5/8A8Km+Ff8A0TT4f/8AhG+HP/lb
R/wqb4V/9E0+H/8A4Rvhz/5W16BRQB5//wAKm+Ff/RNPh/8A+Eb4c/8AlbR/wqb4V/8ARNPh/wD+
Eb4c/wDlbXoFFAHn/wDwqb4V/wDRNPh//wCEb4c/+VtH/CpvhX/0TT4f/wDhG+HP/lbXoFFAHn//
AAqb4V/9E0+H/wD4Rvhz/wCVtH/CpvhX/wBE0+H/AP4Rvhz/AOVtegUUAef/APCpvhX/ANE0+H//
AIRvhz/5W0f8Km+Ff/RNPh//AOEb4c/+VtegUUAef/8ACpvhX/0TT4f/APhG+HP/AJW0f8Km+Ff/
AETT4f8A/hG+HP8A5W16BRQB5/8A8Km+Ff8A0TT4f/8AhG+HP/lbR/wqb4V/9E0+H/8A4Rvhz/5W
16BRQB5//wAKm+Ff/RNPh/8A+Eb4c/8AlbX5dftD/sz/AAz/AG6P2hNf/Z4stG03wJ8MP2T/AAjF
418V+PfAWiaTofibS/2yvif4Ru5P2epfD2p2NrbOuvfsxfD7V5f2h5dL1ES6c3j74kfs3+LLRnu/
B95An6ffGH4qeEPgZ8Jvib8aviBeS2Hgb4SeAPF/xJ8X3lvEJ7qDw34J0C/8R6y1nbF4/tV6dP06
dbK0V1e7umht4zvlWvDv2I/hX4v+GPwE0fUvinZxWnxy+M/iHxN+0D8fIopTcLYfFr4wak3irW/B
1tdskTXeifCfR7jQPg14QuJIo5z4J+HfhuO5D3Mc0sgBu/sifGnxB8b/AIK6TrHj+w0/Q/jN4D1z
xJ8H/j74a0vzF0zQPjd8LtUm8K/EBdESf/ST4P8AEmo2Ufjn4d3lyFm1j4b+K/CGuFQupoK+m6+A
B/xYH9v8Iv8Aovw6/b48EvJsHy2lj+1h+zh4SHmSjO1pNa+Mv7MGnRh1Uzw2+lfslCQJZz300mo/
f9ABRRRQAV8AfFf/AJSa/sR/9mgf8FD/AP1Z/wDwTvr7/r4A+K//ACk1/Yj/AOzQP+Ch/wD6s/8A
4J30AH/BQf8A5F39k7/s/wD/AGPf/VpWdff9fAH/AAUH/wCRd/ZO/wCz/wD9j3/1aVnX3/QAUUUU
AFFFFABRXgeq/HCy8C+IPHWg/E62t9COiWD+KfBN1phuLw+PPCbvbWS2ekWsoWW48Z6drVzBo1/o
UDlriW/0u9sx9ju2eGrrHxN+I1hZ/Dbw+PDPhHSfiV8TY/Ed5a6f4i1zUbfw14YttDhtb8adqV3Y
2N1qOs6+bPUtPtnsdOhtLebUV1HyLpbS0Saf87r+KfB1BY+LxuLq4rKqqwuZ5fh8sx9fMcvx9fiL
D8K5Zl+OwdOg6uExme53iqeH4fp4hU4Z1hY1s1y+pXyjD18dT+upcD8Q1XhZLDYenQx0PbYLF1sb
haWExeFp5RVzzGYvDYidVQr4bK8tozq5tOi5yy6u6eBxUKePq08LL6Gor5o8T/F34j+A/A3xC1fx
h4H0iDxD4HTwlcWGo6TeavdeBvFtp4n1m10uVtLv72w0/ULW/wBFMsseqaZOsskEr2M8VxcWt2GT
6Xr3Mh4vybiPF4vAZe8fSx+Ay7AZnjsFmOWY7LMVhMPmOa8RZLh416OOoUJqt/aPCud0ZRipRlSw
9HF0p1cHjMHiK/mZpw/mOUUKGKxX1WeFxWLxWCw2JweNwuNoV6uDwOT5lVdOphqtWLp/U89y2opN
qSnVqYepGGIw+IpUyiiivqDxAooooAK+AP8Agl//AMmV/Dr/ALH/APaR/wDWnPjHX3/XwB/wS/8A
+TK/h1/2P/7SP/rTnxjoAP2R/wDk6P8A4Kn/APZ3/wAHP/Xdv7Etff8AXwB+yP8A8nR/8FT/APs7
/wCDn/ru39iWvv8AoAK+AP8Agon/AMk6/Zx/7P8A/wBgj/1qb4aV9/18Af8ABRP/AJJ1+zj/ANn/
AP7BH/rU3w0oA6D/AIKa/wDKNz/goN/2ZB+1f/6obx9X1/4S/wCRV8M/9i/o3/putq+QP+Cmv/KN
z/goN/2ZB+1f/wCqG8fV9f8AhL/kVfDP/Yv6N/6bragDoKKKKAK11e2dkIDeXdtaC6uYbK2N1PFb
i4vLlilvaQGV0865uGBWGCPdLKwIRGPFFxeWlobdbu6trU3lylnaC4nihN1dyJJJHa24kZTPcyJF
K6QRbpXSORlUhGI5D4keFvC3jLwR4i0Hxm8dt4en06e6vdTa5Syl0JtOU39v4htNQfC6bfaDPbx6
raagSFtJ7VJZN0SujfL/AOz1r198TfFM3iP4m6m9x4t+HHh6ytPAmkX+n3WipfeD9etii/Gj7FfP
i71Hx7bWotmubeNIPDlrDc6biOTVpAfzPiPj7E5Bxrw3wZ/ZuDr1uMIwlkWOqZnDDUqP9mVKuI4p
jmtCdJ1aU8Lk8aWL4dhg/rc8+zB4vL8RHKMNgK+Zy+0yfhWhmvDeccR/XcRSp8POSzTDQwUq06n1
2FOlkksDVjNU5xr5hKpQzeWI9hHK8KsPiqTx9bFUsEvr9/Efh6LV08Pya9o0evSIJY9EfVLFNXkj
KhxImmtOLxkKEOHWEqVIYHBBrRjvLSW5uLOK6t5Lu0SCS7tY54nubVLoSG2e4gVjLAlwIZTA0qqJ
hFIYywRsfn3eeBLLwn4E1238e/B/Rfil4Kmk8Q+Jpfj98ONV8PX3xDl0rVNUuvENr4ylt761s9eX
W9GjuftrX+geINbgitrCIWqX1spt5voH4WX1lqfxg+MGpabfPqmnah4K+BV9YanKMSajZXei+Mbi
1vpB5Nvh7uCSO4cfZ4MNIf3MX3F+X4X8Wc2zjPMiyPOOH8Hk2Oz3McLh3l88TnVHM8sw+I4Y4zz+
s50s0yHLcFnuFwuJ4VoZfQ4k4ax2acPZrPHYqWGxFD6jh3mXt53wHl+X5ZmeZ5dm2IzHDZZg61X6
3Gjl1TBY2tSzrhzK6ajUwOaYzE5ZWr0c9q4upk+c4XA5vgY4agq1Gr9aqrB/RdcvJ448FRO8UvjD
wtHJG7RyRyeINJR43QlXR0a7DK6sCrKwBUgggEVl6l8TPBmkeKrPwXqGpXsPiO/lsYbWzj8PeI7m
1kk1Jglmr6va6RPo0IlZgHafUI0gz/pDRAGvjv4M+HLTUfB9hJcfsv8AhfxvDc+K/HKT+OtSb4YN
dajGfiF4limvJ7fWvM1yQaeoa0RLkGeWGyTyEEbQoPW4t8TJZbxBlPDnC6yrPsZisPxJUzd4anxB
n9XJcXw/i+GcI8vx2X8GZPxBj8DXrPiL2latmVDBYbCLCxp1qntcVRi/PyHgtYzKsfm+d/Xsrw9G
rk8cAq0spyqGY0M2oZzXWLwuL4izHKcJiqVNZTy06eDqYmtX9u6kIezoVJH3Xq+vaH4ftBf69rOk
6JYl1jF7q+o2em2hkf7kYubyaGEu/wDCofc3YGr9vcW93BFc2s8NzbTxrLBcW8qTQTROMpJFLGzR
yRsCCroxVgcgkV8x+C/Cnhz4ifE34zav4+0HSfEN14O8Vad4E8JeH9fsl1XS/DPhO28KeHtXivdM
0fUrd9KtrnxNqOo3t9PqdrBJdyQQxaeLpLa28g6vw40y08E/Gj4l+AfC0f2bwTN4U8H+OY9CtvNX
R/B/ibWtS8R6Zqen6Pbf8emmWviC00uz1p9IsxDa2c0MlxbW8Ud8yLvlnH+c4zMMmxGIybLKPDHE
XFWe8H5XiKOaYqrn1DH5FLiSm8fj8uqZbRw31PMK3DOMprCYfFzx2V062FxGNjOP9oU8szxvCuXY
fCZhSo5jjamd5RkWV8Q42jUwNCGV1cLmkcnmsJhMZDGVK31nCU86w8nXrYeOGxs6delhnFrCTxv0
bRRRX6ufCBXwB+yv/wAnd/8ABTv/ALL/APs//wDrFH7O9ff9fAH7K/8Ayd3/AMFO/wDsv/7P/wD6
xR+zvQAeI/8AlKb8G/8AswD9pX/1or9k+vv+vgDxH/ylN+Df/ZgH7Sv/AK0V+yfX3/QAUUV4fq37
Tf7NugapqOh67+0J8D9F1rR7660zV9H1b4seAtO1TS9SsZ3tb7TtR0+81+G7sb6zuYpLe6tLmGK4
t543imjSRGUAHuFFfP8A/wANZfssf9HL/s//APh5fh1/80dH/DWX7LH/AEcv+z//AOHl+HX/AM0d
AH0BRXz/AP8ADWX7LH/Ry/7P/wD4eX4df/NHR/w1l+yx/wBHL/s//wDh5fh1/wDNHQB9AUV8/wD/
AA1l+yx/0cv+z/8A+Hl+HX/zR0f8NZfssf8ARy/7P/8A4eX4df8AzR0AfQFFfP8A/wANZfssf9HL
/s//APh5fh1/80dH/DWX7LH/AEcv+z//AOHl+HX/AM0dAH0BRXz/AP8ADWX7LH/Ry/7P/wD4eX4d
f/NHR/w1l+yx/wBHL/s//wDh5fh1/wDNHQB9AUV8/wD/AA1l+yx/0cv+z/8A+Hl+HX/zR0f8NZfs
sf8ARy/7P/8A4eX4df8AzR0AfQFFfP8A/wANZfssf9HL/s//APh5fh1/80dH/DWX7LH/AEcv+z//
AOHl+HX/AM0dAH0BRXz/AP8ADWX7LH/Ry/7P/wD4eX4df/NHR/w1l+yx/wBHL/s//wDh5fh1/wDN
HQB9AUV8/wD/AA1l+yx/0cv+z/8A+Hl+HX/zR1oWH7Tf7Nuqeb/Zn7QnwP1HyNnn/YPix4Cu/J83
f5Xm/Z9fk8vzPLk2b8b9j7c7WwAeK/8ABQrxf4j0L9l7xd4E8B6rc6J8T/2jNf8ABP7K3wy1mwYD
U/Dfiv8AaM8VaZ8LLnx/p6YYyP8ACPwl4h8T/GC+VY5nTR/AGpTLb3JiFvL9a+DPCHhz4e+D/Cng
HwdpVtoXhHwP4a0Lwh4V0SzUpZ6N4c8NaXa6LoelWqEkrbafplla2kCkkrFCoJOK+Jfi/wD8XP8A
+Cgf7JHwvb9/4f8A2f8A4Z/HD9r3xJGPnW1+IGrWGm/sx/BCC7hOEe31Xwr8WP2mtWtpJC4ttU8F
WE0UDXCw3Vl9/wBAFe7uoLG1ur26k8q1s7ea6uZdrv5cFvG000myNXkfZGjNtjRnbGFVmIB/N/wR
/wAFMfCXxK8F+EPiN4B/ZK/bw8WeBPH/AIX0Dxr4K8VaT+znM+leJfCXirSbTXfDniDTHuPFlvO+
n6zo9/Z6jZNPBBM1tcxmWGNyyL+hHi3/AJFXxN/2L+s/+m65r5A/4Jlf8o3P+CfP/ZkH7KH/AKob
wDQBz3/Dff8A1ZV/wUA/8Rx//DKj/hvv/qyr/goB/wCI4/8A4ZV+gFFAH5//APDff/VlX/BQD/xH
H/8ADKj/AIb7/wCrKv8AgoB/4jj/APhlX6AUUAeT/Av4z+C/2iPhB8Pvjd8O21g+C/iV4bsvE2gR
+IdIudB162tbsvHLY6zo93mbTtU0+7huLG/ti80aXNvL9nuLiAxTyesV8Af8Esf+Uff7L3/YgXH/
AKlHiCvv+gD82PCn7dnxs+J0PinXvg3/AME/Pj38Svh9oHxS+Mvwq0vx5B8Xf2TfCVn4p1X4HfFv
xt8F/F+rab4f8Y/HXRvFGn6TP4y8A+IBpH9uaTp1/daYlpey2duLlY16j/hqj9rv/pGJ8f8A/wAS
A/Yo/wDoiKP+CZn/ACa5rH/Z3/8AwUc/9eJftTV9/wBAHwB/w1R+13/0jE+P/wD4kB+xR/8AREUf
8NUftd/9IxPj/wD+JAfsUf8A0RFff9FAHwB/w1R+13/0jE+P/wD4kB+xR/8AREV7h+y7+0RH+0r8
P/EHi+f4b+MPhH4i8GfFD4kfCHxr8PvG+o+DdZ1rw/4y+GPiW68N67AuteAPEvizwrq+nzy28d1Z
X+mazPHJHMY3RXiLP9H18Af8E+P+Rd/ax/7P/wD2wv8A1aV5QB9/0UUUAfAH7cn/ABczX/2V/wBk
qD97a/tCfHrRfFnxOgT5pIvgH+zFHD8efHououfO0Lxt4+8M/B74G+JYWULLonxkvI/NikeNq+/6
+APh/wD8XR/4KOftA+NZ/wB/o37K3wB+GH7OnhIt85074g/HvUh+0B8eY1JysS6l4D8N/siOiR7Z
nawuHuS0TWQT7/oA+Fv+Ci2haxH+zNrvxo8Iaddap8Q/2SPE3hn9rrwJp+nxmbVdbuPgRdT+JvH/
AIG0qMYL33xZ+DD/ABO+DyhWjcQ/ECcxTQyhJk+09A13R/FOhaL4m8O6ja6x4f8AEWk6druh6tYy
Cay1TR9Xs4dQ0zUbOYcS2t9ZXEFzbyDh4pUYcGr13aWl/a3Nhf21ve2N7bzWl5Z3cMdza3dpcxtD
cW1zbzK8M9vPC7xTQyo8csbsjqysQfhD/gmvd3ek/staR8FNTubi61b9k74ifFr9kZ5ryaS5vrnw
p+zz8Qtf+H/wg1fULqdnuLnUPFHwM074YeLr2a6klunudfl+0T3Uwe6mAPveiiigAr4A+K//ACk1
/Yj/AOzQP+Ch/wD6s/8A4J319/18AfFf/lJr+xH/ANmgf8FD/wD1Z/8AwTvoAP8AgoP/AMi7+yd/
2f8A/se/+rSs6+/6+AP+Cg//ACLv7J3/AGf/APse/wDq0rOvqnx78bvhf8MNRg0rx14pTQb6400a
vFFJpGv3yHTWnurYXT3Ol6VfWsSCazuVZJZkkQRGR0WNkdvIzvP8h4ZwE814jzvKOH8rpTp0qmZZ
3mWDyrAU6lV8tKnPGY+th8PCdWXu04SqKU3pFNnoZZlOaZ1i44DJ8tzDNsdOM5wweWYPEY/FzhTV
5zjh8LTq1pRgtZyUGorVtI9WorzfwD8Xfh58UH1KPwL4hGutpEdpNqGNK1vThBHfm4W0cNq+m2Cz
iY2s+Ps7SlAmZAgdC3pFaZPneTcQ5dQzfh/N8szzKcU6qw2Z5Pj8LmeXYl0K1TD11QxuCq18NWdG
vSq0Kqp1ZezrU6lOdpwlFRmGW5jlGLq5fmuAxuWY+hyOvgswwtfBYuiqtOFak6uGxNOlWp+0pVIV
Yc8Fz05wnG8ZJsooor0ziPkLxz4B8Z/HTxJfeJbU6l4Cj+EOpO/wZfXtHFu3iLx/Yz2F/eeMNcsN
Qtjer4Md7GLw1pdoIVk1CzudU8QJiRNLiW14u8TTeNPDng27+J/wK1fXvA2oWmp2/jbRW8Iaxrfj
DwD470qe0FpqemabBGdV1Pwre2w1cWviTwvaT3SxLZyG6UXklifoHxT4/wDCXgu80DT/ABHqrWWo
eKLySw0Cwt9N1XVb3UrmF7WOfyrXSLG/njt7Z76zW6vJ44rO2+0wm4njEik9lX4j/wAQ2yjHY/jC
nl/GMcTn+dywj8QsJiqGU59hMwxyxOFzLh2Ge8MYuVbC4DA0OHYS4apZeqeFr5vwlWwnt8bVzPLs
tzvDfpf+uWPwuF4fni+HnRyrLVXXCdehVx+VYjCYZ0a2DzeWV51QjTr4rE1c3azmeL569PAZ/Tr+
yw8MFi8Zltb86vEvhPX734c/GHTPhp4d+Kh+F974e+Hx8K+FfGFj4pvNZl8U2/jaz1TXJvBOheI0
u/GsHh2LQPsTXcN9HHA99BM2mQPbQSvH9seGfiHpXinUX02z0Lx7pkyWst19o8TfD3xl4X05kieK
Nok1LXdFsLFrpjMGjthP58qJK8aMInx3tFerwd4Y1+Cc0nmGVZ/ReHxuWZblWZ5XPJI08BTwmV5/
xfn2EwnDdGhmdKHD2W4apxjjsDgsucMzo4PA4PA0qcpShVnV4OIeNKXEmBjhMflVX22GxuMx2Cx0
czlPFTxGNyrh/Kq+IzipVwc5ZtjK0OHcNisTi1LBVMRisRipyilKnGmUUVi6h4i0LS7ie0v9Vsra
9t9F1DxFNYNOr366Fpbwxahqq2MZe7ksrWW5ghlnjhdfOmjhUtK6of1LEYrDYSm62LxFDC0VKMXV
xFWnRpqUnaMXUqSjHmk9Iq929Emz4ijRrYifs6FGrWqWcuSjTnUnyxV5PlgpSslq3ayW5tUVnaPq
2na/pOl67pFyt7pOtadY6tpl4iSxrd6dqNtFeWVysc6RTRrPbTRSqk0ccqBwsiI4KjRqqNajiaNL
EYerSr4evSp1qFejUjVo1qNWKnSq0qsHKFSlUhKM6dSEpRnGSlFtNMmpTqUalSlVpzpVaU5U6tKp
GUKlOpCTjOnUhJKUJwknGUZJSjJNNJpoK+AP+CX/APyZX8Ov+x//AGkf/WnPjHX3/XwB/wAEv/8A
kyv4df8AY/8A7SP/AK058Y61ID9kf/k6P/gqf/2d/wDBz/13b+xLX3/XwB+yP/ydH/wVP/7O/wDg
5/67t/Ylr7/oAK+AP+Cif/JOv2cf+z//ANgj/wBam+Glff8AXwB/wUT/AOSdfs4/9n//ALBH/rU3
w0oA6D/gpr/yjc/4KDf9mQftX/8AqhvH1fX/AIS/5FXwz/2L+jf+m62r5A/4Ka/8o3P+Cg3/AGZB
+1f/AOqG8fV9B3/h/wAceIPBfgqLwR8Qv+FfXNvo+lyX13/wiekeK/7RgfSrVYrfyNXmhjtPJkBl
86Es8m7YwCgGvPzXG4nL8vxOMwmU5hnuIoRhKllOVVMqo5hjHKpCDhhqmd5nk+VxlTjKVabxeZYW
Dp05qEp1nTpVOvA4aji8XRw+Ix+EyujVclPH46GOqYTDpQlJSrQy3BZjjpKcoqnH6vg68lOcXKMa
anOPrlFfH3ws8TfEu38CSfGf4mfF86x4P0SHx7ca74Wtfh54c015LPwrrPiLQYrqLWNPmjvVlH9k
xamYUhSN5GNpJIIN01eqf8L38OSafp15a+FfiLeXuu6hqdr4Z8Pw+ELqHX/E2naRaaffXfifSLK+
ntIh4X+zarYNDq+o3OnpLLcparF9qDQL+f5F4t8L5rk+XZvmsMbwe83yvAZ7leVcS18inm+NyLNY
4VZTm1LC8N51xFShh8zxWLhl2BwtfEUczr5lCeCWAVaeHVb6vM+As7wOYYvAYGWG4gWAxuKyzG4/
JqWZxy/DZngXXePwE6+cZblE5VcFRoSxeKrUqVTBUsHKOJeKdONV0u38eeBNK+Iuj2/h7XrzV4dD
GrabqeqaZpd1DZweIrfTLhbtNC1uR7We5l0K7uY4JNQtLGewnvEgS3ku/sslxBNDrnw70HW/FPg/
xmsl9o3iPwWbu307UdFeytmv9C1CJYtQ8LazFc2N5FfeHrto4LkWipBdWN7bw3mlXthch5X41P2g
PADaJpWssniWKfVvF+qeAIvDz+HNQbxPbeNtIsb6+uvDN3o8KSypqLLZeTA0Lz2Uj3VrO12li095
A+P48eEm0W91GbSPGNnrdj4ntPBsngS68PuvjiTxLqOnnV9N02HSIrqW1ZdR0dJdWtNRbUU0l9Pt
7i4e/jEEirhi+JfCDM8RiMZi854YxuKx1DI8xrYqWLjVxEo8PNcRcOqnXjJ1cPisvqYirnGUYChO
ljPrE8djMJhp11jZrWhk3iDgqNHD0MuzrDUMLVzPCU6Cw8qdKMs2X9k5u50pRUKtDFwpU8vzDFVY
zw/so4bD4itGn9Wi8Mfs66Tb6bfeFtL+IfxN0f4eal/acd38PrDXNKGiR2OrTme90bTtUuNCuPFe
laJN5lzC1hY+IIilvd3EEE8MbIqdBN8FdOt9f1DX/C3jXxz4EfU9H8NaDc6Z4Ul8IrpP9m+EbO5s
NBght9e8Ia9cQCytbu4jAju1VhJgphEC+ffEj436lL4O0t/BOneNfDfiDVviJoPgLVzfeDILrxD4
Snu7rSLi7iGj6nLPpF5qmpaVqlq+gMH1TStRSecRXAuLdjB2E3xw8NeG7drLUovG3iaDwpbWOn+P
/HOmeEWn0Tw3q8Wn2U+oHxO2l+XHbajDHcxX+uaf4b0/VIdA+0GK9jsVhaOP4uhjPArC5hisDSw9
DLMPk+FyTHYbPlmmMy/A5f8AWMJn1LB5NkGJp5vTzjJ8PlGUyzuvmWWZbg8vyDJsvxGPeLdCVLMK
WH+jq4fxPr4Ship1auNrZjXzLDVsr+pYfF4nF+xxGVTr5lmtGeXzy/Ma2YY9ZZSweNxmIxea5ji6
OF9gqinhJ1vZtIsJ9L0yz0+51XUtcntIRFJq2r/2f/ad8QSRNef2VYaXp5mwQhNtp9sjBQTGXLO2
J4H8G6Z4B8NWnhbR57+50+zvNbvoptTlt5rxpde13UvEF4sklra2cBjjvNUuIrYLboyWqQpK80qv
NJwOr/HrwZpWveINAi07xbrcnhSw/tXxPqvh/wAPT6p4f0HSpPC0Pi+x1HUdailSxittV0qWRdMK
SSS3d3a3UKxLGiTSZcP7Rvgy4u9Ks4fDnxFebxPpc+reBgPBl/jx9bWiWk16vhUeZvnaytL231C4
m1RNJsv7LZ9Viu5dNje6H3s+PfCzB5jh6lXifI/7TySOY8L0MRVx9TE4rC+2zHLMDmWWvEzlWlXq
V86yvKcsrzqVK1WvntHCZX7WeaV4Yar8tHhXjjEYSrGGSZn9SzOWEzurShhYUKNfkwmNxODxioxj
TjShTy3HY/G0owhTp08sqV8dyRwNKVan1vib4WWeseIpPGPh7xN4l8AeLLqxg0zVtX8KSaSYfEVl
aE/2fH4j0bXNK1jR9VuNLjkuIdL1JrOHVLOG4a2W9ezjhtU1/A3w80PwFFq76fcavrGteIr9dT8S
+KPEd/8A2p4i8QXsUQtrR9QvFhtreO20+0VLPTdN0+zsdL0+3VltLKFpZ3l49Pjz4Pn0LRdWsdK8
Y6lquva1rvhyy8E2Xhu4fxpFrvhYzjxLpt/pMs0Ntp76EbdhqF5d6hFpqmW1EF7Oby1E3E+Mf2io
7PRvBGp+E/DviG5n1n4uaR8OPFekap4du49b8OzL5V3rOiSWQvIYV8S3VlcWbaN5NzqGnXUM880U
0jwgL4OJ4q8GMixWI4up4/Ka2NpUVncJZfVxOOjCvn1LBKvmGWZbCpPLcLnua4PN8JiM0r4LD4fO
sVluYPGZlOeCxNSrP1KOR+I2aUKOQTwuPp4adT+zZLF06OGlKllc8Q6WExuNlCONr5XgcRl9ejga
WJq1ctoYzCLD4KMcRRhCP1DRXgOm/GPQtHsvFNxrGv6z4svh8WPEvgTw74f0zwklt4gk1TTbaC9P
g/RdNsLiY67Ho1mlzdzeJb+WwiktxLLqD2ixRmTQl+P/AIEtNLW+1O28U6TqUfinS/Bl/wCE7/w5
ejxfpniHXLC61PQrO60O1+1TXEeuWdoz6Pe6VJqNlqTyxw2k8sy3EcH11LxP4FlSjUxfEmU5bP2V
StVo43Msuvh1TdRunXxOExeLy+OJlh6U8dHCRxk8V9QjPGSoxoUq06fgVOCeJ1NxoZPj8ZH2kKcK
mGweL/euaglOnQxFChi3RjVqRw0sRLDxofWnHDxqSqzpxn7dXwB+yv8A8nd/8FO/+y//ALP/AP6x
R+zvX174F+JOjePLnxDptrpfiPw9rvhW4sIdd8PeK9IbSdXsotWtpLvSL4Ik93ZXVhqcEFy1rcWl
7P8APa3ENwsE0Rjr5C/ZX/5O7/4Kd/8AZf8A9n//ANYo/Z3r63Kc3y3PcBRzPKMZRx+ArzxFKnia
Dbj7bB4mtgsZh6kZKNSjicHjcPiMHi8NVhCvhcVQrYevTp1qU4R8HH5fjcrxVTBZhh6mFxVKNGc6
NVJS9niKFPE4erFpuFSjiMNWpYjD1qcpUq9CrTrUpzpzjJniP/lKb8G/+zAP2lf/AFor9k+vv+vg
DxH/AMpTfg3/ANmAftK/+tFfsn19/wBeicYV+Tn/AATq/Z0/Z88ZfsvweJvF/wACfg34r8Sat+0H
+2nNqniDxJ8MPBOu63qUsP7aH7QFrFLqGrapod1f3kkVtBBbxvcXEjJBDFCpEcaKP1jr4A/4Jjf8
miaR/wBl/wD21/8A1tf9oWgD3/8A4ZN/ZY/6No/Z/wD/AAzXw6/+Zyj/AIZN/ZY/6No/Z/8A/DNf
Dr/5nK+gKKAPn/8A4ZN/ZY/6No/Z/wD/AAzXw6/+Zyj/AIZN/ZY/6No/Z/8A/DNfDr/5nK9Y8ZeN
PDHw/wBAufFHi/VU0bQrOeytri/ktr27CT6jdw2FlEtvp9td3cr3F5cQwRrFA53yAthcsON8G/HX
4S/EDVk0Hwp4107UdbmiuJrbSbi31LR9QvYrSMTXb6faa3Y6dPqH2WE+dcixS4aCEPNKEjR2X53G
8YcJZbnWD4bzHijh3AcRZhChUwGQY3O8swudY6niq1XD4WeDyqviqeOxMMTiKFahQlRoTjWrUatK
m5TpzivYw3D2f43LcRnODyPOMXlGElVhi81w2WY2vluFnQp061eOIx1KhPC0ZUaVWlVqxqVYunTq
U5zSjOLfM/8ADJv7LH/RtH7P/wD4Zr4df/M5R/wyb+yx/wBG0fs//wDhmvh1/wDM5T9O/ai+AmqX
cFnbfEfS4nuZkgiuNS0/XdH04yyzLbxrJq2r6VY6XCJJnWJGmvI0Z2ADGup8dfGz4YfDXVbXQ/Gv
ihNF1W909dVtrP8AsnXtSkk097m4s0uS+k6XfxRo1zazxBZZEk3Rk7NpVj5VLxN8N6+WYvOqHiDw
RWybAVsNhsdm1LivIamWYLEY1zWDoYvHwx8sLhq2LdOosNSrVYTrunNUozcJW7qnBfGNLG0Mtq8J
8TU8xxVOtWwuAqZDmkMbiaOGUXiKtDCywqr1qdBTg606dOUaSnFzceZX5P8A4ZN/ZY/6No/Z/wD/
AAzXw6/+Zyj/AIZN/ZY/6No/Z/8A/DNfDr/5nK9P8D+P/CPxH0ibXvBmrf2zpVvfzaXLdfYNT07Z
fW8FtczQeRqtlY3LbIby2fzVhaFvM2rIzpIq+TSftY/s/RTC2k+IMaTt5uyFvDPjESOIComKL/wj
2XWIugdkDKu9MkblzrmPiL4fZRgMqzXNuOuDcsyvPadSrkmZZjxPkmCwGc0qLoxq1MqxmJx1LD5h
TpSxGHjUnhKlaMHXoqTTqw5s8JwhxZj8VjsDgOF+IsbjsrlCGZ4PCZLmWJxWXTqKo6cMdh6OGnWw
kpqlVcI4iFNyVKo4pqErWv8Ahk39lj/o2j9n/wD8M18Ov/mco/4ZN/ZY/wCjaP2f/wDwzXw6/wDm
cr2zRNa0zxHo+ma/o1z9s0nWbG21LTbvybi3+02V3Es1vN5F3FBcw+ZE6t5c8MUqZ2vGrAgalfW4
fEUMVQo4rC1qWJw2JpU8Rh8Rh6kK1CvQrQjUo1qNanKVOrSq05RnTqQlKE4SjKMnFpng1aVWhVqU
K9OpRrUak6VajVhKnVpVacnCpTqU5pThUhNOM4SSlGScZJNNHz//AMMm/ssf9G0fs/8A/hmvh1/8
zlH/AAyb+yx/0bR+z/8A+Ga+HX/zOV7H4a8S6J4w0Sy8ReHL5dS0bUftP2O9WC5tlm+yXc9jcYhv
Ibe5Ty7q2nhPmQpuMZdN0bK7F/4l0TS9b0Dw7f3y2+s+KP7V/sGyMFzI1/8A2JaJfaptmihe2g+y
2siTH7VNB5obZB5sgKDljmuVywOEzSOZYCWW4/8As76hmMcZh3gcb/a9bD4fKfqmLVR4fE/2piMX
hKGXexqT+u1sVh6WG9rOtTjLZ4HGxxWIwTweKWMwv1v61hHh6yxWG+oU61bH/WMO4e1o/UqWHr1c
X7SEfq1OjWnW5I05uPjn/DJv7LH/AEbR+z//AOGa+HX/AMzlH/DJv7LH/RtH7P8A/wCGa+HX/wAz
lfQFFd5ynz//AMMm/ssf9G0fs/8A/hmvh1/8zlH/AAyb+yx/0bR+z/8A+Ga+HX/zOV9AUUAfP/8A
wyb+yx/0bR+z/wD+Ga+HX/zOV/FL/wAHc3wp+F3wv8T/ALB8fw0+G3gH4dx61oP7Rr6wngbwd4d8
JJqz2GofBNbB9TXQNO09b9rJby7Fo10JTbC6uRCUE8u7+9qv4Y/+DyD/AJGr/gn5/wBi/wDtMf8A
px+BVAH9Tv7OH/Fbftt/8FEfijN+9/4QbXP2Zv2QtImPMa6V8Kfgnb/tNX4tM4XnxN+2nrdjqE8S
N513pCWVxczPpEdrp/3/AF8Af8E6/wDic/Db9ob4jy/Ne/E39vX9u2+uZuv2mz+FP7TvxG/Zt8MX
Kscs8M3gv4IeGntZC8ivaGBojHAYoIvv+gDn/Fv/ACKvib/sX9Z/9N1zXyB/wTK/5Ruf8E+f+zIP
2UP/AFQ3gGvtm4t4bu3ntbmNZre5hlt54nyUlhmRo5Y2AIJV0ZlbBBwTzX42+HLfSf2aPD2heAv2
Nf8Agpj+zNpvwi8H6NpfhTwj8Av2t9W8HfHXwz8N/Cnh+xg0jQfCXws+Kfgn4yfBv40aBo2hafaW
lpZ2/wAXvEnx+kttPtRoulHQ7P7E+lgH7MVBdXVtY21xe3txBaWdpBNdXd3dTR29ta21vG0s9xcT
yskUEEESPLNNK6xxxqzuyqpI/If/AIas/am1f/QP+GqP+CQHw98r93/wlX/Cy/iL8Y/t27n7X/wg
P/CwvgX/AGV5W/b/AGd/wsnWPtHkb/7Ttvtfl2U9r8Pv2NviNc2+u/tmft0fDT9sjWEnhvk8AePf
i78KvBv7LWhXsUizRx+Hv2W/CHiaLwD4ktLKdFuNF1X4/Xvx6+IOhyvcLp3j6K2uHtwAfQuo/wDB
Tv8AYUttQvtK0D9oLQ/ihqGmXl1p+o23wG8KfEP9ol7C9sZ3tr63u2+BPhD4ipbyWNzHJb3wldBZ
zxyQ3JikRlHonwj/AG6f2Qfjp4ti+Hvww/aF+Guv/Ee4tZ723+GV9rY8KfE65s7QB7y6tvhx4wh0
Dxvc29jE0E9/NBoMkdjbXmnXN20NvqVhJc9Hp37UP7JGkafY6TpP7RH7Oel6Vpdnbadpmmad8W/h
nZafp2n2UCW1nY2NnbeIIra0s7S2ijt7a2t444III0iiRI0VR538XPiN/wAE+fj34Sl8CfGr4mfs
k/FLwjJdQahHoXjj4hfCfxDZ2OrWZL2GuaR/aOtzTaL4g0uYi50jxBpEtlrWkXiR3mmX1pdRRzIA
ch/wSx/5R9/svf8AYgXH/qUeIK+/68n+BXw++E3wq+Dvw4+HnwJs9Lsfg54V8J6Vpvw3t9F8Q3/i
3Sf+ET8gXGlT2HinVNW13UvEVveQzi7TW77WtUudT883k1/cvMZW9YoA+AP+CZn/ACa5rH/Z3/8A
wUc/9eJftTV9/wBfhZ4++K3/AAT2+FXxC+I8n7O//BTrw9+x78Rz8R/iA/xW+Hvh74leD/il8EtQ
+KFz4x1uT4onxD8BPipD4u8H+BPGb+PJvEmoeML/AOCl78IfEOqePv7QvPHV74jn/tbTb3lP+G8r
i4/4ll5/wW4/4J22uhL9zV/D37IOp2HxLbfxJ9o8Ra9+214q+HUmwSSm1+z/AAftfLkjsWuftqQ3
sepAH7161rWjeG9I1LX/ABFq2maDoWjWVxqWsa3rV/a6XpGladZxNPd3+palfSwWdjZWsKPNcXV1
NFBBErSSyKikj4Wk/wCCk/7OGtSSJ8H9G/aJ/aVti7pYeKf2bv2Wf2g/i58JNdKMYy3hv9obQfh2
P2c/EKCYwRs2j/Fq8EUd1BfT+Vpnm30Xwhovxa/4JL+ItW03xh+1J/wUB+H/AO2l440u9t9V0x/2
hPiR4Pv/AIR+F9VtJVubC98D/s0+D9H8Lfs+aBqOh3aRzeHfGWpfDzxH8VdP+z2kt78R9V1C3GoP
90x/8FUP+Cb8MccUX7Zf7PsUUSLHFFH470pI440UKkcaKwVERQFVVAVVAAAAAoAuWX/BSX9mOxvL
Sw+K5+N/7NL3VzBYnXf2pP2avj9+z/8ADK31G7lS2s9Mn+PPxH+Hei/s/tqd/fOun6bp9t8U7i81
O+ktoNOhujf6cbvN/wCCdl7Z6j4R/am1DT7u2v7C/wD29v2u72xvrKeK6s72zuvibdT213aXMDyQ
3FtcQuk0E8LvFNE6SRuyMCS9/wCCpH/BNfUbO70/UP2xP2d7+wv7aeyvrG98baNdWd7Z3UTwXNpd
20/mQ3FtcQu8M8EyPFNE7xyIyMQfdf2Trn9k29+Dmn3/AOxVB8Ebf4FX/ibxne2Cfs/ab4S0j4et
4vufEuoy+O5U07wZa2ekW3iCXxQ2oyeIUe1hvzqLSNdpkoSAfSdFFY3iPXLHwx4e13xLqcgi03w9
o2qa5qEpOBHY6TYz393ISAxAS3t5GJ2tgDOD0oA+Gf8Agnf/AMVN4A/aH+Ns/wA2oftAfts/tX+M
Jbg8m98PfCf4pal+yh8L9REgwssOo/Bv9nT4dXtmygBLGe2hLSNE0sn3/Xwz/wAEx9CvtA/4J2/s
Rw6xGY/EWs/sv/Bbxp4vyMNJ44+IPgPRfHfji4cZbL3Xi7xHrVy7FmZmlLMSxJr7moAK+AP2ef8A
iif25/8AgoN8LY/3dl41t/2Vf2vLOA/LGt38W/hv4r/Zq1wWanpG15+xZbanfRwkRLqOsz3ksSXO
pSz3X3/XwBr3/FM/8FS/ha8f7pPjR+wN8dbe/fot3cfs2ftC/s9XGhQOwyGmtIP2qPFE9rFIUdoZ
9QktlmSG9a3APv8AooooAK+APiv/AMpNf2I/+zQP+Ch//qz/APgnfX3/AF8AfFf/AJSa/sR/9mgf
8FD/AP1Z/wDwTvoAP+Cg/wDyLv7J3/Z//wCx7/6tKzr6z+NX/JHPiz/2TPx5/wCotqtfJn/BQf8A
5F39k7/s/wD/AGPf/VpWdfd2saTp2v6TqmhavbLe6TrWnX2k6nZu8sa3enajbS2d7bNJA8U0az20
0sTPDJHKgctG6OAw8biLLq2b8P57lOHnSp4jNMmzPLqFSs5RowrY3BV8NSnVcIVJqlGdWMqjhTnJ
RTcYSdk/RyjF08vzbLMfVjOdLBZjgsXVhTUXUlTw2JpVpxpqUoxc5Rg1FSlGLk1eSV2vmf4jar4g
sPhn8AtO8PeIdV8MS+LPGnwt8H6nqmivbx6imi+IPD1/a6glrJdW91bx3CgR3FrLLbzJBdwW85ik
EWxuH8Yf2zZ3fjnQvDvjf48eM5fhf4a0+MXOga/4V0DTvDGrDSbnxBLc+OPFGua3pNz461i5truy
1G6sbfSL200/RobLT306S7mubib651DwX4Y1Wy8NadqGlR3Nl4P1XRtb8NwNcXijS9U8PxPBo93G
8dwkk72UUjoiXb3EUu4meOVsEc5rnwf+HPiPXr7xJrPhwXeqatFZQ60F1XW7XS/EEWmwm2sF8R6B
Z6lb6D4i+yWxFvA2t6bftHAkUKkRwwqn4jxR4VcWZvLEVMBmuDUq9Lh7L4RqcQ5/lqwOWZbwvmWA
x/1GlRy7NMpjia3Ec8nzOMMbkmPo4rD4KVZywGa4bLMZhP0rI+Oshy+NGGKwOIapVM2xc5QynKsY
8TjMZneCxWF+szqYzBY90aeTxzHBSlhsywtSjWxKppYrAVsbh8R4L4bvvF3xU8T+DtG1nx74t0LS
tX/Zt+Gnj/V4fB97beHru+8W6zqmsRXWpR6jbWb3WnQyIzfaLHTTaW94YrGO4DWtmLaXltO8QfFH
xd4V+GH2rWPFHim3t9C8Yr4wsPht4v8ADvgz4mXt14d8aXHhnSvGM1hqEunvrejNYaZPbXdjpd9p
sNx4gvFe5hnjaGK2+vtB8A+EvDF1YX2iaSLO70zwrpngixna+1K7kt/Cuj3M93pejg3t5ch4LKe5
maGaUPdBHELTtCkca89e/Bf4a39lo9jJ4de1Tw+dYGj3ek654i0PWLCLxBfyaprVrFrujavYa21j
qeoStd3dhJqD2UsyxMbf9zCI+Gt4R8cVcupurxI8Rm+JwmY0M7qLivPKNLM3U4h4NzTKaUq2PyPP
MI8LgcFlHEmGq0q+Q1o1FneKw9KnSeb47H4Xpp8fcM08XPkyZUsvo18HVyyDyLLKk8EoZRxDgcfU
VPCZnlmI9vicTj8mrQnTzSnKLy2hVnOay/C4Wv8ANKarc6jc/CXx7beLfG3ijU9A+E3xq1BhqFtD
4Z1PVtX+HuueD/O0XX/D9iJYIL6+vom0PxTFaXHk60dNtLi2mjiMckm9pl54u8NeGvgh8TpfiR4p
8Sa18S/Evw20nxZour3dlL4Pv7P4iRxHUIdC8OwW0cXh+fQHuVu9KuNIuEm8nTpYNVN/BPcFfpzS
PAnhHQP+EdGi6FZaYvhPS9V0bw8lp5sUenafrk+nXWsRLEsvl3E2p3elWN3e3l2txe3F1HJcyXBn
urqSfndH+DPwz0DXLTxDpXheC21HTbq+vdHifUdYu9I0C71ITLfXPhvw7eajceH/AA3NcpcTxu+h
aZp7CKeWJSscjqaoeEnGmGxFLGUs3y54zEwyWeLxFLiPirDRynOcFkfAeWY7iXBU6tHH1uIsfOpw
7ndGjhM9xlGVfL8bToYrNFHN85opVePeHK1Kph55fjFh6M8xjQozyjIqzx+XYnM+KMbhsmxM4VML
TyjCxjm+W1KmIyvD1FSxeHlUoYK+X5dVPlC2v/iHF8Irb4nL8VfGr+JvFXxK0jwRa288+n3Hh3w/
o8/x4g8KRz2GiS2LJc6omm20kM95fXMyXttdz2FxbmyWGGLtf+EV8UzfEL4m/DlPi78UYfD3h3wH
4U8daRONftn1+DxDr83i3TphP4gbT/7Tn0S3bw1FeRaAk0GmPcXtwssLQR28UX0mnw48FJ4bsvCK
6FB/wjmna3B4jstMNzftHBrVt4kPi6C/E7XZunkj8RE6mI5J3gMh8loja/uK118LaAmuat4kXToh
reu6Pp2gatf+bceZeaRpU2pT6fZPGZvIRLaXWNSdZIYo5nN0wlkdUiEeuX+CucU3w1HMs8rYqjgM
m4XwWfQXFXF0v7Sx+EyDjXDcXV4OVem6tHPs/wA64czGXtnReKo5NBYmjR/s/L8NOMV4kZfL+2ZY
PLKdCpisyzvE5XJ5HkC+p4WvmvDVbIaUkqUlCpleVZbnOETpqp7CrmUnRqVPreLrR+NT4w8R/EDT
dLuYte+LWu63pfwo+HfiHWrD4ZXnhfwB4f8ADHiLxL4WXxDfal4q8Qa1rulDXbzVYJ7fU7XRtP0+
50nSdMhjhbT5ri+lZcbwzqmveK9d+H/xC1LxHrcPia+/ZA1LxjeXGnXUdjaz6zb3vhnzN1nFB5KW
V7dznU7yyhEcD6hFBLEIYolhr6qn+BvwsuJ7K4fwpGn2LRNG8OG1g1bXrXTdU0Pw/bfYtG03xHpV
tqkOmeKrewssWcX/AAk1pqztaKltK7wIkazP8Ffhi9v4VtT4WiWHwTpWoaF4Y8rU9bhl0zRNUWJb
3SPtEOpJcXumyLBCI7HUJbu2tRFH9ljh2jHgPwc8S8ViqeLzPPMnx1WlWw2KqwqcUcRzoZhjsv4j
ynF5XmlX2/D9bH4XMMvyGnm1HnrZjm2Hnj61LC5XQyHKcTKlgPVXiHwZRoyoYPLMxw0J061CEoZJ
lEauEwuKyfG4fG4KHss2p4WvhMXmksDU5aeDwFWOFpzr46rmuPoqpivC/AF54l+Ld54f0HXPH/jD
w5a+Hvgj8IPFMkHhjVbfRNZ8Xa/450u/udT8T6jqq28upXFlp02jCwWxh26bNf3l3JfLM4hhGF4S
8VePfiT4h+GnhHVvHHiDStOvdB+O9r4g1fwybPRtQ8YRfDn4j6F4T0DWre9gtXXR57+2KXlze6J5
bMzX1tYz21rfzxj6W1X4O/DnWbPQLK88PNFH4Y0OHwxok+l6zr+h6jaeHYIYIItDk1bRdV0/Vb7S
hHbxBrDULy6tpHDyyRtLLK77ul+APBmiXXh280fw9p+lzeEtCv8Awz4cFgj2lvpOhapPp1zqGn21
pDIlp5d1caTp80kkkEk/mW+9ZVMs5l9zB+FHHTqZfRzPiGhWoUquDWf5hR4o4oli+K8BDi3hLOVl
uOy54Shhsvw+ScPZPnPDOBeGxtdZzhszq1cfTy+Oa5xSq+ZiOO+GFDF1MFlNWnVnTxH9lYSpkeRr
D5FipZFnuXPGYXFrEVa2Lq5lm2YZdnWJ9thqTy6tgqcMLPFvA5fOnxfwQ1PWbzw14j0rWtYvvEE3
hD4h+OfBtjrOrOk2sX+keH9cmttMl1i6jSKO91GO1ZLee8WCA3IhSWWMzNJI/wAyf8Ev/wDkyv4d
f9j/APtI/wDrTnxjr7m0Xw9o/h5NSj0aySxTV9Z1LxDqKpLPKLnWNYn+06let58spje6n/eNFCY4
EJIiijBxXwz/AMEv/wDkyv4df9j/APtI/wDrTnxjr9w4TyvHZJw3k2UZjivruMy3BUsHVxX1jEYr
2saF4UW8Ti1HFV5RoKnCVXEXqzlFynKcm5y/M8+x2GzPOMxzDB0Pq2HxmJniIUfZUaHI6tpVEqOH
boUk6rnJU6VqcU0oqKSij9kf/k6P/gqf/wBnf/Bz/wBd2/sS19/18Afsj/8AJ0f/AAVP/wCzv/g5
/wCu7f2Ja+/6+hPJCvgD/gon/wAk6/Zx/wCz/wD9gj/1qb4aV9/18Af8FE/+Sdfs4/8AZ/8A+wR/
61N8NKAOg/4Ka/8AKNz/AIKDf9mQftX/APqhvH1fX/hL/kVfDP8A2L+jf+m62r5A/wCCmv8Ayjc/
4KDf9mQftX/+qG8fV9e+FnSPwl4ckkdY44/DujvJI7BERE0y3ZndmIVVVQSzEgAAkkAUm0k22kkm
227JJattvRJLdgk27JXb0SW7fY+fYvhl4xH7LvjL4Ztp0K+MdY0P4qWVhpxv7EwyXHijxL4q1LRk
e/W4axiFzaapZSO73CpbtK0c5jeORV3viR4e+IF5qfgAadp/ijXfBOnaNqNr4p8OeBvHEXgLxBNr
zR6XHpN7eau+s6A+q6BDbR6pbz6ZY67pdxFdTQ3jDU49lvb/AEHHLHNGssMiSxONySRuskbr6q6k
qw9wSKSKaGdS8EsUyBmQvFIsih0OHQshIDKeGUnKnggGvzCXhZw88owuT4fNM7w1GjwvwXwrRr0M
VllSvVyfgXH18wyxV6WKyvE4DG/X3jK2GzulisDXwGOwdX2MMHh3Lnf20eOM2WPrZjVwOW1qk874
kzypSqUcbClTzDijC0cJjXTqUMdRxeG+qrDU62W1KGJpYvC4mHtJYislyr4t8BfBrx7oeo+E577Q
bfTbbSv2jvGnxJuoF8TJr5s/CfiP4baro9g/9rX8/wDams3ttq+oQ6Xey3cS6ldXEU+pPE9pIt0/
V+Nfhl4j1XXfidqNx4D0fxxoHiHxn8Otbt9Fu9c/sXW77S/D/g2LRtQ1DwjrFrqumNoHirStXWNr
SbU77S7e80walbJeR/aomf3j/hN9Lbx3Z+AYormbUbzwjqfjFNQiNu+mLY6Xrmm6BPaGRZzOb03m
pKwQQGFI4ZQ8wlxHXXzTQ28bTXEsUESY3yzSLFGu5gq7ncqq7mZVGSMsQByQK+byjwg4BeQY3h3L
s0zPE5fl3EVfG42VX+wsTDD5rHgyfCtTB18JichlktfAU8jzKFeWBrZbXwNSvKmq8KuC9rgp+zj/
ABB4rWa4bNsXgcFRxeMyilhsPGmszoyq4GXEUM8hXpV6GaRzKlip5ngXSjiaeMpYqFJTdKVPE+zx
MfkPRvhv8UZtLsrfUItfGiWPxt+Hfizwz4c8ZeM7Lxh4p8MeEPDz2T+IG1PxM15eLexzXkM93pej
x6zr11aWxCC+mmuJIINDUPB/xO0DRPjF8PdB8G23iaw+KPiDxxrGheMP+Eh0fRtK0CD4jwOmpweK
dPvJ2155vD15c3s9tJoOmawur2P2OA/2fcCYp9WySRxKXldI0BALyMqKCzBVBZiACzEKMnliAOSK
QzQrKsDSxCd1Z0hMiiV0XhnWMneyqfvMAQO5FejDwZ4dw2GjQw/EHFOFxSwmIy6WZRxuTVMbLLcx
pZlhsVlsaOLyPEZbQwOIp5g6OGw+Fy+hHLqWBy/C5N/Z+GwvsJ8cvEXOK1Z1auVZJXoe3o4xYN4b
MYYZYzBzwVahjJVMPmVLGVcTRlg1OtWr4urLGTxWLr5j9br1/ax+W9D+EXibw74c+PPhq3hS9i8T
+BfDHhXwZevc2UDa5LoXwc0/wQ01xD9pb+yzLq9m0bC9aKNVbzkke3AlOpp/w58WW+t/stXsunxL
b/DHwd4h0jxi4vrJjpt/f/D/AEfQbWKFBOW1BZNTtJ4DLYi4jRUEzssLK5+kGliR44nljSSYuIY2
dVeUxrvcRoSGkKICzhQdqjccDmhpoUkiheWJJZ9/kxNIqyTeUoaTykJDSeWpDPsB2KQWwOa7aHhH
wjhKeFo4fEZrQoYDMcDjMPRWNwzhRq4TxKoeKOEwrlUwc6kqK4ghRwahOcq9TJ5Rw3tnjZrMHzVe
P8/xEq9SrSwNSpisJicPWqPDV1KpTxHBtXgjEVkoYiMFUeUyqYhyjFUoZinWVNYaLwh8e3ngL4sa
VqG+20vxHqXg+9+Kvxa8T+IfDXgfxxZeC/E+sWfiK9tbrwTqg19fEGgudJgVdRGp6JDruj6gJ7qz
uJlu0t2tk5+1+EHxH0nwtObLwgH1LR/2lvD/AMY9L8ON41g1i41Twxb6Ho9lLpqeKvEF6bibWrKW
O5jv59ckhSaa0maxuL+CS0lm+4mmhSSKF5Ykln3+TE0irJN5ShpPKQkNJ5akM+wHYpBbA5oaaFJI
oXliSWff5MTSKsk3lKGk8pCQ0nlqQz7AdikFsDmvCxPgPwjiKtarUz3ibmUZ4fDOWJ4fq1MqniMr
wOWwp4DFYnh+tjaFFSwuFzSllVXE1spnm9SrjJ5dU+uYilW9Sj4pZ/RhShDK8ltzRq1kqObU4Y6N
LHYnGuWLoUc2p4arU5a1bAzx0KNPHxy+FPDRxkPq9GdP470r4VfEHw74guPiHbaCmp6pofx0+Knj
Ox8Irrel2lx4h8GfEbQ9P0M3djfyXLaVba5pzW6XltYaxc6fDNBHewS3tnLLbmZur/DD4keLfGNv
8Qr3w3b6DJqHxj+DWuN4Zm1zSb7UtI8GfDWw8TQXus6te2dy+lS6nfXfiKVk0fR7vUzBawW+y6up
pZkh+stM1S41C8121m0bVNMj0fU4tPtr2/W0W112GTTNP1BtT0g291cSvYxTXsumu13FazC+sLtR
CY1R21IpYp0EsMsc0bFgskTrIjFGKMA6EqSrqysAflZSpwQRVUPBPg7E4OODo5vxQssWeYjPp5dO
tltCFfiXCZfV4Vr53UlXyKGZOrHKIrKo0KWJhklXD08Pj6WAnjKkcwqqr4lcQ0cQ8RUy/JHjf7Mp
ZXHGRp4yrOlk1fF088pZbFUs0lg1TeYN451Z0ZZlCtOthamKjh4vCU/PtF8PapZfE/x94mnt0TSN
e8K/DrTNOuVmhZ577w/eePZdUjeBXM8Qt4tb0wpLNGscwmKws5hlCfIv7K//ACd3/wAFO/8Asv8A
+z//AOsUfs7199xSxTxrLBLHNE4JSWJ1kjcAkEq6EqwBBBIJ5BHUV8Cfsr/8nd/8FO/+y/8A7P8A
/wCsUfs71+vZTlmFynCVMNg51KlGvmOcZs51ZwqSdfPc3x2d4tQlThTj7GOKzCtHDrlco4dUozqV
ZqVWf5/j8bXx+IhWxEYQqUsHl2AUacZQSpZXl+GyzDuUZSk/aOhhKbrO6UqrnKMYRahE8R/8pTfg
3/2YB+0r/wCtFfsn19/18AeI/wDlKb8G/wDswD9pX/1or9k+vv8Ar0ziCvgD/gmN/wAmiaR/2X/9
tf8A9bX/AGha+/6+AP8AgmN/yaJpH/Zf/wBtf/1tf9oWgD7/AKKKKAPnn9pxrxfhrprafHbTX6/F
D4PNYw3s8ttZy3g+J3hY20d3cwW93Nb2zzbFnnhtbmWKIvJHbzOojaW88FfE/wAb+NPh9rXjiHwB
4e0H4fa5d+KbeDwnquueIfEGrazJo2paLaWTanrHhnw5Ho+iiPVJbnU4bWO7m1Q20FpJ5URMkfs3
iDw3onimxh03X7CPUbK31TSNZht5ZJ4lTU9B1O11jSLsNbywyF7LUrK1ukRnMUjRBJo5ImeNtuvz
LMfDxZ3xjm2e5pmWM/sTG5fwLTp5JgsTChSxmY8G55n2e0a2a/7F9ZlhoYzH5ZUoUcJmVKnivq+J
w+PoTw0uSv8AaYPi15Zw9gcswODw/wDaWHxfE855liaLq1MPhOIssyrK6lPA/wC0+xjWlh8JjYVa
lfBznQ9tRq4WrGsual8vfBweHT+yl4b/AOEuW2bwuPh9qx19bsqIDpStqZvN7OrBW8kMY2Cs6y7D
GDIFFeI/DOP4pnxx8JV0G48MW/in/hkvw22ov43tdWvoTpDeMs2SPHod9YzrrP2ZtMN0zzNbo63k
Zi3mMx/Ttl+zZ8ErGWxkj8DW9zFpsomsrDVNa8S61o8DglhjRNY1m+0eRAxyIpbF4geicCvVP+EX
0H/hKP8AhNP7Pj/4Sf8AsD/hF/7V82583+wf7R/tX+z/ACPO+yeX/aH+k+b9n+07vk87yvkr80wn
hDxhmOE8OqGe4rI8kqeH+TcL8Oqtwvn2b4nFZ1gsp/s2pjsyq4+vw7klbAYuhUymlDJMvhSxdOhT
zPOKlXMoSxCpv7Ov4gcPYOtxdUyujmeZx4rzDO82dPO8qy+jh8uxOP8ArccLg4YSnm+Z08VQqwx1
SWZYuU8POrLBZdGGCkqLmHhpfE6aNajxjNoM/iDdcfbZPDVtqFpoxT7RL9lFrDql1eXqsLXyRcGW
dg1x5pjVY9grybxv/wAl7+BH/YvfGX/0g8EV7vWJe+HNF1DXNE8SXlik+t+HINXttFvzLcI9jBr0
dnFq0aRRzJbzC8j0+zVjcQzNH5CmAxMzlv2niPhzEZpkGWZNg8U5VMv4g4EzSWJzPEVq1avheFeL
+H8/xjr4hU6tWvjsVgsorwpTqRUa2Nq0/b1KNOU6sPzfKM3o4HNcbmGIoKMMXlXE+CVHBUqdOnSr
55w/muVYf2dFzpwpYahiMfSlOMW3Tw8J+yhUnGNOXzU17rGqfGD4232s/EfxT4a8K/B+18FeIdN0
uwuY18NRx6n4HuNU1q48TadDatqGuaTbtppvjpNvfWQkeW9ZXM80Elvw3hbxP4x0zxt8D9Qi1D4w
XWl/EnWbzTNe1P4kap4Tj0DxXbTeBfEfiGO98O+BNI1vVb/wgPt2m6fqeniO30pLSxkOl3ovGkIk
+w4fBvheHUvFWrro1pJfeN7fT7TxY9yJLuDXLXS9Pl0qxtr2yupJrI28WnTzWkkMdvHHcwyOLlZi
c1xWj/Av4W6FeaHqGneGZBfeGL2G+8N3d74g8T6rceH5ILW4slttFm1XWb19L0qS1upoLnRbFoNH
u4/KW7sZvs9v5X5DmPhXxzUzLK8dl+eYSNSjx1nnFeY4ypxLxDRxU8HjPEulxBlmXQw9fK82wVfD
UuAqFPhWeCwsMieCk62Do5ljcmxWKo1f0HCcc8MxwmNw2LyzEShU4YyvIsJh45NlNShGvh+DZ5Tj
cXKtTxuAxNKtU4pqTzyGJryzNYhKliamDw2Y0KNSn8y/DTxH47+I0fwN8P6t8QPFWn2nirwB8Zda
8VXuj3cFnrWsTeG/iFoelaOiasbeS40yS1gvEjF7YCG9FpFLZRTwxXtyz6fh/wAc+N7Lxh8OfCc/
izWNTstN8a/tKeEru71CWKbUPEGmeA9IWfwtP4hmWJI9Q1LTGkU/bFhg+0PGs00TStI7/VHh/wCG
ngfwtL4fm0DQINOl8LaXrujaA6XN/MdO0zxLqdrrOuWkf2m7mEqahqdnbXUj3AmliaIJbyRRM8bN
j+GXgWLVLTWo/D8C6nY6r4s1y1u/teolodV8cQLbeKrtY2vDCzavAipLG8bQQY3WcVuxLHhyzwg8
QcFl2QOtxfCtnuCxfAkc4zB8RcTVqeNyjhul4WSzfA0lWoNSWPxvB/FeJpxnh6EcVLiCc8XUpyzb
N1DqxviDwnicZmvs+H3TyvE0OJ5Zdg1lGS05YbH5xPjeOX4qo6dROLwuH4gyKjOUatV0Y5TGOHjN
YDL3L5e8Dah41tfCn7NnxM1D4ieLtd1n4j6n4R0LxVo+qXtu3hS60rxJ4U1m+AttCgtoY7TVNNl0
+yeHWknbUL64S5uNUkvPtbxpTstW8Y6n8LfCHxrm+KnirTPEniv4g+DbXUvDS32njwgdN1P4sad4
dufBGlaBc2amwuNP0xZLO71CCZ9evJLHU11GeaC6uIIfri38AeELTRvCPh+30WGLR/Al1pd54SsV
uL3Zo1zo1ncafpksMhuTPcG1s7q4gVb2W5SRZC0yyOFYfN1x+zzrmr+ILK61fRPhramP4g6b4w1b
xzpF54hXXdYtNE8RW/iK0+yfD+bSI/CHhrxRrTWFppviHxNp2tXVzPbTalPHDLNeMteHnnh1x7w/
lmW4DAVMx4kqYnhzEZcqeG4l4spwwnG2IyHg7LHxdUzKEa2JWPjmGVZ3isL/AGm8BlGJw+b5ti81
znK8ZWeBzn0sr4v4WzXG4zFYuGDyeFDN6OLc6+TZDKVfhulmnEONWQQwUnTovCvCY7LaFd4JYrH0
K2AwGHwOXY3D01isu+wqKKK/rc/Awr+GP/g8g/5Gr/gn5/2L/wC0x/6cfgVX9zlfwx/8HkH/ACNX
/BPz/sX/ANpj/wBOPwKoA/qd/wCCXP7/APYY+C2stzL4uvvi58QLl+hnvPiL8b/iT47vLkr1ja6u
/EU1w0JLNA0phZ3ZCx+/6+AP+CV3H/BPD9kmJubi1+EWj2WoS9Rc6tYXmoWesXqscNIt9qkF5eLN
IqTTrOJp4opneNPv+gDn/Fv/ACKvib/sX9Z/9N1zX5nf8E3f2Yf2atb/AOCd37BOs6z+zz8DdX1j
V/2Lv2W9T1bVtT+EvgG/1LU9Sv8A4HeBbu+1HUb678Py3V7fXt1LLc3d3cyy3FzcSyTTSPI7Mf0x
8W/8ir4m/wCxf1n/ANN1zXyB/wAEyv8AlG5/wT5/7Mg/ZQ/9UN4BoA9f/wCGTf2WP+jaP2f/APwz
Xw6/+Zyj/hk39lj/AKNo/Z//APDNfDr/AOZyvoCigD5//wCGTf2WP+jaP2f/APwzXw6/+Zyj/hk3
9lj/AKNo/Z//APDNfDr/AOZyvoCigD8+v+CVNvb2f/BPP9le0tIIbW1tfh1Jb21tbxJBb29vB4k1
6KGCCGJVjhhhjVY4oo1VI0VURQoAH6C18Af8Esf+Uff7L3/YgXH/AKlHiCvv+gD4A/4Jmf8AJrms
f9nf/wDBRz/14l+1NX3/AF8Af8EzP+TXNY/7O/8A+Cjn/rxL9qavv+gAoorE8Q+JvDnhLS59c8V+
INE8MaLagm61fxDqthoul2wWOSVjPqGpXFtaQhYopZCZJlAjjkc/KjEAG3XwB/wT4/5F39rH/s//
APbC/wDVpXlfdmj61o3iHTrfV/D+raZrmk3Yc2mqaPf2up6ddCORopDb3tlLPbTCOVHjcxysFkRk
bDKQPhP/AIJ8f8i7+1j/ANn/AP7YX/q0rygD7/r5W/br8QXXhL9iL9sfxVYzra3vhn9lb9oXxBZ3
LusSW91o3wj8X6jbztK+UjWGW2SRnYFUClm4Br6pr4k/4KYQy3H/AATh/wCCgUEEUk88/wCxJ+1Z
DDDCjSSzSyfAjx4kcUUaBnkkkdgiIilnYhVBJAoA+hfgR4ftfCXwP+DXhWxga1svDPwp+Hfh+ztn
Ront7XRvCGj6bbwPG5LxtDFbJGyMSyFSrHINerVzfg2aK48IeFZ4JY54J/DehzQzQuskU0UmmWrx
yxSIWSSORGV0dGKupDKSCDXSUAFfAHx9/wCJd+37/wAE99Yi+S41Twn+2b8P5pj8qyaXrvgX4WeP
LmxDn5Wkn1P4WaLerAP3jx6bLMp8u3lB+/6/Lb9u/Qfil4n/AGof+CdGi/Bn4i+Gvhb8QH+IP7SF
/Y+LvFfw5m+K+j6fpNn+zt4nh1f7V4Kt/G/w9mvEu0vLfTItQ/4Sezi0291CyleK7eSK0mAP1Jor
87tS+F3/AAU/0IWOreGf2vP2UviFeWWpWcl54N8b/sf+N/h7oWu6S7tFqNs3jPwp+0v4z1rQb6GG
T7Xp91B4Y1iGW6t0tbq2W3uJJ4tH/jaf/wBY/wD/AM2LoA/QCvgD4r/8pNf2I/8As0D/AIKH/wDq
z/8AgnfXxV/wUWu/+Czdj+xN+0Pd/Bofs5N8VIPBMT+A1/Zptfj/AH3x0bxH/b+jCwX4c2eow3Gm
XOss5K3EOqwS6TJpR1BdVRtPNyK8C/4Jz3v/AAVbv/2pP2HLj/grJpvwO034vv8Asfft6t4OX4ZS
Rr8R5tEPxF/4J9nV5PjxY+FxJ8IbHxo11/Z72Efwmum0P7A8yarZ2GqxSRMAfql/wUH/AORd/ZO/
7P8A/wBj3/1aVnV747a03gX9pHwT8WJr65tdB+G3w0t7nxvHE920EvgLxd43uPB/iG8ubW1WUzw+
Gb3VdC8bXDeRNItp4VuEiUNLkUf+Cg//ACLv7J3/AGf/APse/wDq0rOvtnxL4m8NeGLYT+I7yC0h
ubTWJFWS2munubTRtHvte1dFht4J5JUt9I069u5Iih81YvJjWSeWKJwD829B+I3xV+GFv4xtTbXt
trXxI/aU1DV/GF5dXvhC2u/BVz4n/Zv+FHxQXwHo998SfEWgeDrKfT9T1WfQbFtX1C7ml0Pw5qUG
m6PcajdR3+l+maf8dvjPqvhzVfGU8/hzRYvCXwH+HHj7WtCtdFs/EOl32q+PPGHxg8J3njeXXNM8
QXfk+CvDeieBtM+ItxpWjXuoS3ukw3dhDryoWuZ/uSwm0TxLotpqdrDa6ho3iOxsNXia4swI9RtL
20trixubm1uoVkLtaralUuohNEscUbqjRBVXXdBsfEOk6tpF3Jf2kWs6fJpt1faNqN7omswwMswj
ex1nS57XUrG4tXnlmtJ7a5jeCV3dD87hgD8/Nb/aL+I2jat4h8P6D400D4k6BB8SvBvhCz+IPh+D
4f6TJZabq3wv8R+OdStI9Y8ReI9E+Gb69Prmk2WkxX2oagbKGwnk0y10e78TT2+z2K5+Ini3xL+y
zYfEDW/EFt4F8RT3uhHUfFOg6lov9n22mad8UbHRZfECahaajrPh1NN1zw9af2pqAs9Y1PRI7TUb
q2t9TvdNVbmX3vwj8NvDfhHTdc0+IXmvN4m1Qav4ivvEstvql1q93Hp+n6TaLcQra22mW9lYaXpO
nWNjpun6fZ6fbpbG4Fsb25vLq57poYXha3eGJ7d4jC8DRo0LQshjaFoiCjRMhKGMqUKEqRjigD4U
vf2gfF8dzdanpnjTwnql9e+Mvjp4Ok+Flvp+lS614O0L4b+HfiNqvhXx5d3cOrPq0h1FPAmg6zqk
+oWr+GtV0/4iaTa6AkRbRL7W+bi+NXiLX9U+H9l/wlHg74w2F7q/wN8ZnWPDekW9rZeGPEHjCXxw
l54Ut5bS+uWV7iDRrW98LRalbyeJtGt4tTbxI97/AGlpAj+9dc0DRtW0nXbG/s1Fvrei6ho+qTWV
vjUZtMvLKS0uIIpbeGS6dxbuVt441lcOsYijZgq1W8G6Zomm+FPDtpoWnXWn6THo2kPY2up6dcaZ
q8cKabax2raxY31taX9rrKW0cMeoRahbQahBcpJDdxxzRvGoB8VQ/HrxrdfDTR/E2nfFX4f6z4t8
TaD8M/EuueFYNO0bQZ/AEnirUnTxB4a0zxRq+qXng3TdXkZn8N+FdE+KN1aX02s6LqrXmt3Es6Wm
m9t4r8cXPjv9mXQ/Fj39zdXl18TvhfpV1ey6bpuh3Utz4f8A2lfCnhe+Wa10DxN4u0GWTzNKnt59
T8PeI9S8O6/h9Z0M22j6lZ2Vv9U6RN4d1zT7i90iPT73TtQvNRgupYrRFhvbzT9QutN1EXCSQobl
4tQtLqCSWVHErxtIjyRsrtsrbwLFHbrBCsEIhEMKxoIohblGtxHGF2IIGjjaEKo8oohTaVXAB+cm
kfHjxT4WvfD9u+q6BofhKTxX4te90nw9ZeGb/X5L3VP2nviV4OuptU8J+JfEfh7X9X8P6rpenWVt
peofDS/1fxBpPiaTW9R1vw7qlgdI0u6qav8AHH4keBtMtPD2k+M4/Ess3jH9qa61jxdq2ofC6yud
I1T4f/FeTSdA8H3k/jjxV4L8OWek2elax/bmp6Hb3Nx4s/sU6db+H/7E0CwkuI/0haxsnkgleztX
ltpJpbaRreFpLeW4fzLiWByhaKSeT55njKtK/wAzljzWVMNFuNUOh3GkPPOYY/EZmm8P3UujmeK4
W0inOtPYtox1yN0R47M3v9sJaot2sAtVEoAPgmb4neLviT4h+Hs/irxR4a8GX2i/Gr4KW6fCCGC2
uNX1K21v4deFvF19r9vqj3o1q4VNe8W6vZWl2tonhx9E8PTWZhuNbL6jXp/xa8eeKPC/xc1jS/Ck
mi6XqWs+Hv2ZvDsevXujnVbyytviB8cvHng3VHED3trBcrZafcSXem282Io9QZpp/PiYw19fm1tj
cfazbwG68kW/2kwxm48gSCYQecV8zyRMBKI92wSASBdwzWDYeIvDusa/4k8OWcyXOueFf7C/t+2e
ynQ2n9q28uraH/pU0CW93mJZbqL7LNP9klJ8zyZmwQDlvhNrHiXVvDeqR+LNStNa1nQvG3jnww2r
2mnx6UNS0/w/4p1PTtIurqwgke2g1BtKhs01E2gitJb1J57e3t4pFhT5O/4Jf/8AJlfw6/7H/wDa
R/8AWnPjHX38ABwAAMk4AxySSTx3JJJPckk8mvgH/gl//wAmV/Dr/sf/ANpH/wBac+MdAB+yP/yd
H/wVP/7O/wDg5/67t/Ylr7/r8Yvhj/w2f/w2R/wU/wD+GdP+GYf+EO/4al+Cv9qf8Lr/AOFrf8JN
/wAJF/w75/Yy+0f2f/wgv/Eq/sX+z/7O8n7Tm++2fbd/7jyK+nf+Np//AFj/AP8AzYugD9AK+AP+
Cif/ACTr9nH/ALP/AP2CP/WpvhpSf8bT/wDrH/8A+bF1/NP+xBrH/BenVfgx8A2/4Kb6X4Oi/Z7T
9vH9hlPhnqHxohvNK/bNnul/at+GX9iHUNN0CBYJvBQhF5HqM/xwt9M+L0lyLG4ilv8AS3DkA/p5
/wCCmv8Ayjc/4KDf9mQftX/+qG8fV1/xd1jRrXwd8FtD1vSPDmo22vX2nPDdeP8AW5NC+GVjdaP4
OvL2JfG0qWd9HqyXW5v7B0C5iitr/WoLe5luUWw8i55D/gpr/wAo3P8AgoN/2ZB+1f8A+qG8fV9a
6BYWOpeDfDtnqNnaX9pL4f0XzbW9t4bq2kxp9sR5kE6SRPggEblODyOa+W40yDFcT8M5nkWCxuGy
/EY9YRLEYzLsPmuFdLD4/C4vE4WvgsSnRnTx2GoVcC6zjOeE+sfXKMKlahThL2+HM1oZJnWCzPE4
atiqWFeIbo4fGVcDXU6uFr0KNaliaP7yE8LWq08SqacY1/Y/V6ko06spL87rGDTdXj8XeFI7zwrc
+Gpv2k/gHbLY/DiLUNC8Fx2+vWWlWmuDwzANQnkjs9QuIbu1vNQ0+4Sz1O6t7prdUgXyI/Uvih4W
svBep/GLSPAulr4c8M6p4D+CuveMdF8K2z6XbxeHT8SPFWkfEDUdKsNEit1sri48B6bdRao9uscc
1lb3VxMPOaSR/uEWlqDkW1uD+45EMYP+indbfw/8uzcwf88TzHtNTBEDtIEUSOqI0gUB2SMu0aM2
NxVGkkKKSQpkcgAu2fxXBfR5w2HyrHYOvnuClmWKjnNHC5zhshlSxWVYLNsN4g4RYDAyr5visXHB
4bD8cxoxw7xyp1KWWOm1FYmDw36RifFuvVx2GxFLLMQsHReXVa+XVs0VShjsTgK3Cdd4rEqll9Ch
LEVqvDDqOssLzQqY1TV/YyVb5J8BWvwkt/2hrJvhM3hj7FJ8F/Eo1hPBUunS+Ghcx+MfAYsnH9js
+nLrslqxbVcN9uls/wCxprwES28klb4hN8L2/aWsIfitceGho/8AwpSC40q08bTaUnhSbVYvGmso
81zDrbrps2q2+nyXf9midH2QSajLGFmjhdfrW007T7BBHY2NnZRq07qlpawWyK91Ks10wWFEUNcz
Kss7AZmlVZJCzgEed6z4D8Nr47vfit4h1CzWysvh3L4T1Gx1mKwGg2mlWGvN4rm129u75hFb/Ymi
YyyT7La3gia5eVChI9rM/DDNaXDuDyjLcJwji6tfxIy3i7GZfHIVguFcFg4YalRxdFZJPNJTxNOn
Uw6xDdPFRqV8XWeLWE9yWHl52B41wNTN8Rj8bXz+hTpcHYzh/D4t5o8TnmJxEq06lCp/aUcFGNGc
oVXSSnQcKdCmqDxHvKqvj7wT4S0Lx54++FWjeJ9LXXvh+ugftC6l4D0rV1vJbW78EWfxF8GxeBpr
21viJru0tdOuftXh/wC2q4isk0a9tSBDaSCvrLeB4fhl8TbzW5dJT9pmz8Z+NDosbzwJ8Sbfxhbe
KruP4a2PguGF18Rp4Wl0dfDS6HbaT/xJZ9FknkuCYft7p+hen32maxZafrWlXljqunajYwX2latp
9xb31lf6ZqMUF3bXmn39s8sF1Y30H2a5guLaWS3uovImjd08tqe9hYSXkOoyWVpJqFvFJb29+9tC
15BBKcyww3TIZ4opDzJGjqjnllNeH/xLzQoZdjcPh84yavmGZYPE5di8wzHhaOIjToYnhDhbhbC5
hgqEM3p1qGccNPh7F4vhTEVMbXp5Rg8+zXKqcObE1Myl6f8AxFurVxmGrVcvzGlhMHiKGLw+Ewee
SoynUoZ/neeV8JiassvnTq5fnKzahQz2lDDUp4/E5XgcdOVqMMHH4n1N/hY938cLn48/2cPG9pro
OgrNcW6eObfwjB4V0OXwmfhPtljvre9n1b+1nsX8KtHeXHiUzrq0ktyoI8W8TOb28+OM3jnW/hjo
fia28UXTaTN8SdO12f4z6LoH2Gwl+Hdx8OjpGsQushtxaTaba+FrOVL3xX/atvqUN60s0Un6ZWze
HfEBh1azbRdbbTNQ1bT7fU7Y2OpHT9U0jULzQ9csYb2Lzjaahpmq2V/o+rW0csdxZahaXmn3iRXN
vNCmf4h1jwRomoeHJfFWqeFdI1XVtWh0HwlJ4hvtI0/UNT1y/wAi30Xw4+pSxXN7q17giHTtMMt5
c4ISF8GsuIvo+4jPqdSi8+yKnBZjmuJVWrw1i5YzOaecPiWUsZxVjMHxBgK+cZxlb4jqQy/FU5YO
Hso5xHlw8+IVUyW8o8WKWVzhUWV5nOTwmAo8lPOaCw+XSy9ZKlh8iw+IynFUsuy/G/2PGWKoTWIl
zyy981WOUuGY/APjlNF0bVfHmv8AivUvht49122s/Bt74p8NeOrTXPAvxbtNZ0vwZ4ak2fBnxDbG
XV1sNZuoVvtJsdK0a3EPiK51Owku55PtKSanxUk8J2Hi/wCKfijU3+HnimYXHh3VNU8D/ENNW8If
GPQ7ix8L+H7ix034Q+K9OmvL+e2vTHDNp0Gh6asH/CTS6raDUbstceb+hE2nafc3VtfXFhZXF7Zb
/sd5NawS3Vp5gw/2a4kjaWDeOH8p03DrmibTtPubq2vriwsri9st/wBjvJrWCW6tPMGH+zXEkbSw
bxw/lOm4dc1GP+j1iMTQz6hQz7I6cczz6OeYKWM4ZxWa1cLi6kOMIYnH5hWzLiDFVs+xNVcX13PK
8+qZnw45YfHzwWU5XLO4yyesL4tUqNXK6tXKszm8FlbyzERw+dUcDCth4y4elRwuEp4PKqFPKqMH
w/TUcblcMFnCVbCRxOPxscsazD89vF0UWveJfElhqEF0thrP7ZnwksL/AE64doZW03U/hL4bS/0q
7WCVgkdxDcT2t9BFMyMJZ1Ejbt53fiT4b0rwhr/xH0TQdLt9C+GNxrf7O2u/E3RNFt30/SLPwZf6
1450zxjd22maMkBsrO+g0Hw8PEf9mQrNcaZBfzThkMzD7zNvAx3NBCzGZbgkxoSZ0RY0nyVz5yRo
kayffVFVQwVQBzvizw3L4l0iaxste1rwrqf2jTryy8QeHrhLfUbW60q9S+tI7iKaOaz1bSZpFktt
T0XU4Liw1Cwuru3eOOSVLiHfM/AS2B4lxdLM6GZ5zmGYZ/m+CqLJsLRxc6eaZbxxhnkEq+IzOlSq
4HGVeLoQx2Gq4rAYLMKGDqYWtUwMcasZgM8F4qf7Tk2HngquCy3CYTKsvxEHmNeph4zwOM4YrLNV
So4Kc4YrDw4flLDVoUMVicJVxEK9OGKlhnhsV82/C/8A4Vh/w0P4w/4VV/wj39hf8Kl8O/2j/wAI
f5H/AAif9tf8JTqvm/2X/Zv/ABIftP8AZ/8AZ39qf2L+6+0bft3/ABMvtVec/sr/APJ3f/BTv/sv
/wCz/wD+sUfs719ZeC/hy/hrXtZ8Wa14iuvFXibV9N07QUvptL0rRLHSfD2l3N9f2ukaVpek28Uc
MUmo6ne317cXM91PczvFhokh2v8AJv7K/wDyd3/wU7/7L/8As/8A/rFH7O9fqPhfw/mXDvDeKw2a
5dl+UYrH8R8SZysryzCYXAYXA4bNM4xWJwtJYPA5jm+DoVp0JU6+IhhszxtP21Wcvaqcp04fEcbZ
rg83zijWwOLxePoYXJ8my543G4iviq+JrYHLqFCvUeIxWDy/EVacasZ0qUq2Cw8/Z04rkcVGcjxH
/wApTfg3/wBmAftK/wDrRX7J9ff9fk1+0h/w0L/w8r+A/wDwzj/wpn/hLf8Ahhr9pL+2v+F2/wDC
b/8ACO/8I7/wvz9lzzf7L/4QT/iZ/wBtf2n/AGd5f2v/AEH7D9t3f6R5Fey/8bT/APrH/wD+bF1+
inyB+gFfAH/BMb/k0TSP+y//ALa//ra/7Qtfin+1XrX/AAcpWP8AwU7+DVj+ynpPwC1f4Oz/ALPf
g+b4uwarb+M4P2JIp2+KXxSimn8X6145EPxGtPi2mmrpx1a3+BFxc+NH8K/8IXNrWlX2iJGlfsx/
wSqOtN+xV4SbxJHpcXiI/Gz9sg69Foc13caLHrJ/bN/aAOpppE9/Ba302mLe+eLCW8toLp7URNcQ
xyl0AB+idFFFABRRRQAV8baN4l8RaJ+1d47W91vVbjwV4ivvDvgCLR7vUpG0XRPE7fDTRPGmgXmn
2E0jRW9xrEOneK7G5Nqkfn3U1mZBJJJuH2TXz/4p+Cd7r0vxS1DT/FEOj65418SeAPFvhXVf7GW+
fwdr/wAPtL0Oz068aKW9jXUheT6RKtwqGzKaffXFtulLMx/KfFbJuJs0ocFY/hbD4vF4/hXjWHFl
bCYPG4bA1Mfhcp4T4tisnnUxmKwmGnS4gxuKwXD0lXm6NCWawx1b2NHCVMVh/uuBcxybA1eJMLnl
ahh8LnvDcshp18Rhq2Khha+Pz7IZPMIww9CvWjPKcNQxObJ0oqpVWBlhqftKleFCt5V4X8ZeKbz4
/eO/Fqy+INf8OXHwz8fyeC/BWn6k01pqFp8PfGPhjwtHd6Xpzzpp8eq+IfENp4mktL2VBPNp9/Zf
vjbNGtdk37Q1/o+q6ho/iXRfA9xqK+BPGvjixsfA3xIj8WXNm3grTbbVbvQPFCSeHNKfSLi7trkR
2uq20eo2c08MywQSxqzpc8Q/s6w6rpkGi6Z4puNEsbb4IXnwehltrD/TGefV/D+qjXLqSO8hW5hv
jok1vremkRyalFqN2G1BGmdqxZv2fPEurS2NxqGs/Dnw3FY+C/iP4Mi0D4f/AA/m0HRUTx5oS6R/
bTyTa7cXVzfWslrp8zWjLBaJbpc2sRaeX7dX45Syrx44dWLwmRYPNZYjHZ7R4ixeMWP4TzHK8bi+
IMyy+pxXQ9jmzjjcBhMshUx+IymNHGKmqM6GFwmV1fqletH9DnjvC7N3h8RmmIwMaOGyueUUMP8A
Vc+wmOw2HyrB4qGR1Pa4C+GxVfGShhaWPlUwzm6satevjoe3p0pdp4V+LnivWNV+G39veBLDRfDf
xa067vfCupWPimXV9U02a28NTeLLa18T6bJ4d0y0tJNW0a2u7izOm6pqJtZLVre8RZXPkpZfHNbv
wF8IfHDeGGi/4Wt4y8NeEV0tdZEn9hN4iuNTgF+16dKj/tNbT+zSxthaWBn87aJ4fLy/U2Hw3lsr
L4LWh1eOQ/CaOGKdxZMg1wRfDzWfA5aJftLGwJl1RNRCubv93C1tu3MJh5XpPwE8ZWel/Dzwhe+O
tAn8F/CrxxoPi7wxHb+FLyLxLq8WjajdXkVj4i1KTxE+mxNb2l/e2UU2l6RELuRra9nWH7PLa3X2
dWfjdltGnQoyzXPKmKwuJpwxNSjwNCpg8yrYDwuxVKri+WGWUVgcLio+KOHpulQrO88PQnTxFshm
fOU14a42rOrUWAyunQr0ZyoxqcTyjiMHTxXG1CcKHNLG1Hiq1CXBNWanUpq0KtWMqX/CpE0/Fvx4
1jwXqMlxr3hvwnpvh6PxXZ+GY9Mv/iDb2/xM1C1vPEFr4fh8S6b4K/sN7S40+d7uLUrOwPiBb650
cx6lI1rFOFi3PgPqepan/wALm/tLUL7UP7P+PXxE0yw+3Xdxd/YdNtP7H+y6faefJJ9msbbzJPs9
pDst4d7+XGu5s+aTfs0+JW0PXPCtt4m8C22n3/idPE6eLZPAU158SNflXxj/AMJkmn+LvEkuvRx3
SRXcdtYyajZ2q3d3Y28cSJYKriX374c+ApPAf/Cd+Zqaan/wmfxH8UePY9lo1p/Z8fiL7Dt0x91x
cfaXtPsZ3Xa+Qs3mDFvHt+bm4Ow3i9mPHuU5nxfgM0wvDuAwmJrxpY/F8M1HgMyzHC53hcxwEauR
PB1M0wmHlh8kWFxNfLKUVOrUq4aVejKpip7cQ1uAMHwtmGC4fxWBr5viq9Gk54XD53BYrB4TEZZX
wmKcM0WIhgsRVjVzJ16NPGzbjThTqqnUUaEPR6KKK/o8/HwooooAK/hj/wCDyD/kav8Agn5/2L/7
TH/px+BVf3OV/DH/AMHkH/I1f8E/P+xf/aY/9OPwKoA/qd/4Jf8A+jfsW/D3w8eJPAHxE/aW+FNw
g+5Dd/CH9qD4y/DC8toVGFjt7a78IzW9tEixxQ28UcUUUMaLEn3/AF8Af8E//wDiQaf+2J8KW+WX
4T/t/wD7U/mxfdMX/DQfifSv2z7fMXAi+0WX7TdrerhE89LpbxvMe5aeX7/oAo6pYpqem6jpskjR
JqNjd2LyoAzxpd28lu0ihuCyCQsoPBIAPFfl38DNa/am/YV+Cfwe/Zy+In7MfiP9pX4d/A74WfD7
4P8Agf45fsla54P1DXtf8LfDLwlpHg3Rta+KvwD+MPjH4eeJ/AviO90jQo7u9sPhV41+P2mXl4S8
F3pMl5Bo9v8AqTe3cFhZ3d9dMUtrK2nu7hwrOUgtonmlYIgLOVjRiFUFmIwASQK/Nr4ff8FH9U+K
3gLwR8Ufh3+wF+3t4p+H/wASfCHhrx94G8T2XhP9mi0s/Efg7xjo1l4h8M69aWuq/tR2Gp21tq+i
6jY6hBb6jYWV/DFcJHeWltcLJCgB1/8Aw35HqH+ieE/2L/2//FuvR/JeaB/wzVd/Dz7Hcjrbf8Jd
8avFXww+G+pYEd0ftuheNtW0pvsmE1Bm1DRl1M/sb9vX9oP59e8R+F/2DPhnefMmg+A18H/Hr9rX
ULKTmNdX8d+JdL179mn4N6oi+Zb6toXhrwP+0/FOHhutA+KOi3EDGU/4bh+Iv/SOT9v/AP8ACb/Z
Z/8AorqP+G4fiL/0jk/b/wD/AAm/2Wf/AKK6gA/4di/seat/pHxJ8G/ET486rN+91DWP2ifj/wDH
z46y6hfP88+oLpHxM+JXiPwtokkk6w3Fvp/hbw/oOh6Q1ho8Gg6TpNloGg2umn/DvH4c+B/+Jr+z
R8X/ANpH9l/xdb82d74I+OHj34l/D2eJfnGl638BP2g9Z+LnwNvtJuZBsu7rSfAXh7xpa20t4vhr
xp4avLuS/B/w3D8Rf+kcn7f/AP4Tf7LP/wBFdR/w3D8Rf+kcn7f/AP4Tf7LP/wBFdQB71+yf8CJv
2Y/2cvhF8BLnxf8A8J/d/DHwjbeHb7xoPD6+FE8TagLm6vtQ1eHw0mseIBoVvd3t5O9tpR13V2so
PLgfUbx0ad/oWvH/AIAfGzwl+0d8GPhz8c/Atn4g03wn8TfDNn4n0bTPFdhbaX4m0uG5aSGfS9e0
+xv9VsbXVtNvILixvo7DVNSsDcW8j2WoXtq0VzL7BQB+afg74Xftgfsc23inw58E/Dnwq/ar+Bfi
D4q/Gr4q6T4F13xJefAT9oD4e6p8d/i/44+NnizS7Hxne23jj4S/GfRLTxv8Qtct9EttY034A6r4
e8KC2iu9d8eaxpyrq3W/8NaftU3H/Eus/wDglr+1fa6z906p4g+NX/BPyx+Hu88Kw17Qv2xfFPj0
24LxmSQ/CpZ1RLox2srxWsd7x3gv9tb9pv4t2nirxR8GP2EdU8bfDjRPix8bvhVofi/WP2kvhT4L
vvEt58C/jH47+CXiXWf+EX1HT76+0az1DxV8PtbuNMtru7muG0x7SeUq8pRew/4aI/bt/wCkdP8A
5t18Hf8A5SUAL/wgH7dHx/8A3nxT+J/hX9jP4c3X3/ht+zZc2fxV+PWqWZ+7B4o/aO+JHhGz8DeC
Vv7c+TrXhz4XfA7UvEOiXDyHwn8fppLe21eTb8Pf8E0/2DdE1SDxPrH7LXwi+KXxBiIkn+Lfx98M
W37RPxq1K58xJnu9W+MnxyPxA+JmpXMs8UUzvdeKZEV4bdYkjitraOLD/wCGiP27f+kdP/m3Xwd/
+UlH/DRH7dv/AEjp/wDNuvg7/wDKSgDU1j/gmd+wvcajceJfA/7N/wAOvgL8Q5iksXxc/Zf0lf2Y
/i9b3UEax2dw/wASvgU3gLxXq8FoqCL+xfEWpaz4bv7GW80fWNF1LRNT1TTb3139l39m7Sf2Xfh/
4g8C6b8RfiN8V7zxV8UPiR8WPEfjv4q3HhC58Za14l+JXiW68RamL+TwN4Q8DeHWhsfPgsLaW38P
W93dR2xvNRnu7+5uJ38O/wCGiP27f+kdP/m3Xwd/+Ule1fsr/tC3n7SHw+8SeKda+HGrfCbxb4G+
K3xN+DnjjwLq3iHQvFv9j+L/AIX+KLvw1rDab4n8Ov8A2Zrmk3hghvLO9S3spP30lu9riBbicA+l
q+cv2xPCc/j39kb9qbwNaiQ3PjT9nL43+E7cQqXlM/iL4ZeJ9HhESKGZpDJeLsVVYs2AAScV9G1X
u7S3v7W5sbuJZ7S8t5rS6gfOya3uI2hmibaQ22SN2RsEHBOCDzQB4r+zD4sg8e/s1/s8+ObUxm28
afA34TeLLcwsHiMHiLwDoGsRGJ1LK0ZjvF2MrMGXBBIOa9yr4I/4JcXdx/w70/ZG8M30rT6r8Kvg
z4b+AmvTSYE0viT9nY3PwJ8SPdKoCpeNr3w71E3kagLFdedGoAUCvvegAr4A+N3/ABN/+CiX7BHh
2P8A12ifBz9ub4sSbeXFj4Yh/Zl+Fs5ZRki3F78cdNEkhARZ2tYy4eWNJPv+vgAf8VX/AMFTW2fP
/wAKG/YAX7Tt5+y/8NbftFP9h83GNn2//hinUPIznzP7OuNu3ym3AH3/AEUUUAFfAHxX/wCUmv7E
f/ZoH/BQ/wD9Wf8A8E76+/6+APiv/wApNf2I/wDs0D/gof8A+rP/AOCd9AB/wUH/AORd/ZO/7P8A
/wBj3/1aVnXuX7Qnw91HxtH4NvtI8EWfjLUtEk8dafDI58Nxaj4dHi/4e+IvD9rrVnc+JLzTkitb
fW5tFbVF0y8OqCBIry0sb+SyWEeG/wDBQf8A5F39k7/s/wD/AGPf/VpWdff9AH50+Iv2ZPGNvoH9
heB/DeneF9AvPAH7OCeMtD8MxeBYpfGPiT4eeJvG9146sbjS/EEF34Q8QaxNpOs6JPcXHjO2m0Dx
g2nWOkavqrW9slzYeo6B8H/Gelfsr/GD4Z2lprKeIfGPhr4w2vgzw5r+p+BoLrSH8YaHq1noOirD
4E0vQ/AHhK2uNUuWvxoegXGpaFoEmpzRw69cwKfs/wBi157bfFz4U3viWbwXZ/E74e3fjG31GXR7
jwnbeNPDc/iWDVoPP87S5tCi1J9Ui1GH7Nc+bZParcx/Z598Q8qTaAfL837NMej+LvE3iDwf4B8O
aK9r8e/gb4q8C3ml/wBkabNo3gLw9pPw5034kSaOsU0TaKdVhsfGVt4gsoFtb/xdA7JfxarHPZBv
nnXPhF8QPBnhfxd4v8Q/D228M2V38I49B8Yabpc/gLRtI1fxxN8VvhjrFjaaffeF9S1/xz4j042q
eJ4dM8dfEnxDrXiyQzajdXtj4fvdSuDr/wCj/iL4y/CDwhIsPiz4rfDbwvK95qGnJF4i8c+GNFkf
UNIa2XVbFU1LVLZmvNMa8tF1C1AM9k11bC5SIzxBtmw+IfgDVdI8P+INL8c+D9S0HxZqv9heFtbs
PE2i3mkeJdbM1/bjR/D+pW97JZazqpuNL1OD+z9OmubvztOv4vJ32lwsYB5L8KvAWp+HrD4uGz8E
Wvw08N+MNYiufBfw4tj4bgXRY4PBGi6DqWp3Nn4S1DVPCujXXiPW7K5uJNN0XUrq0+z21trF7JHr
Or6rDF4T8Of2bNf0jRrHWfE3g3Sm+ImheKP2U7vw9r39oaVca1pGjfD3wX8GfC/xMi0/WIL1ns7T
7Po3xB07UbCK4RPEtmXRLfU4rzTxJ+gFUdP1PTdWgkutK1Cx1O1ivtT0yW50+7gvYI9S0XUrvRtZ
0+Sa2kkjS+0nV7C+0rU7RmE9hqVld2N1HFdW80SAH563HwE8TWumeJtFHwJ0fXNOn8K/ETwn4AsY
9U8B6bpfgjxrqvjzxbrth8UNOiOrwtoeneK9E1/wctz4l0G0b4meHrr4dxWkfhl4hpV1N7v8cPh9
4u8WeHfhfoR0CL4jWWi6hLJ40uBpvgjUtae8j8IajpFp4g0rw18SdVsPhvdyXWpXlwL6XX7DxBPp
EF6ZdE0WW5aS6tfqGigD5CX4UeLLz9kzwN8KvEuhavfeKPD2hfDjS9Z0nRNe8Gy6j53grXdDnefT
pPF2n6x8PvE1tBDo0d7D4Y8WWlv4f8Qacg0XUZdFlnWay8mtv2ffiPq2l6FpOveCdBh0NYfBOkX2
iW48MaPZHwrpX7XOgfEnUtO1Tw/pGuanoNleT/DCzvtR1nR/DN3c+F1vZLjQPDoEJs9OX9FqKAPz
m+JXhPwX8JdXsYvGPhDwTffCyXVfjhd+Fvhtr+vaB4Y8K21/4m074aarp/ivRn12SDwvpM2lalbe
O7F9IsJj47sLPxjq+u/D7wprMNhr9uOO0j9nn4oap8O/h28mj6r/AGXp/hv9nO51nw1Y23w91DWP
EFv4S+AWreDNWtP+EY+K6N4Murzw54t1PS706R46s9OjBs5dW0ue31/SNLJ/UfzIzIYRIhlVFkaL
evmLG7MqSFM7gjMjqrkbWZGAJKkB9AHk/wADfCOs+BPhT4P8J6/JqDalpFpfoYNU1bTdbvdMsbrW
NRv9I0OS+0XRtB0RIvD+kXVjolrpmiaami6JaafBoukXmqadp9tql78sf8Ev/wDkyv4df9j/APtI
/wDrTnxjr7/r4A/4Jf8A/Jlfw6/7H/8AaR/9ac+MdAB+yP8A8nR/8FT/APs7/wCDn/ru39iWvv8A
r4A/ZH/5Oj/4Kn/9nf8Awc/9d2/sS19/0AFfAH/BRP8A5J1+zj/2f/8AsEf+tTfDSvv+vgD/AIKJ
/wDJOv2cf+z/AP8AYI/9am+GlAHQf8FNf+Ubn/BQb/syD9q//wBUN4+r6/8ACX/Iq+Gf+xf0b/03
W1fIH/BTX/lG5/wUG/7Mg/av/wDVDePq+vvChx4U8NE5wPD2jE4BY8abbHgAEk+gAJPQAmgDoaK8
T0T9of4R6zY6LeS+LLXw/Nrnha+8awaX4njk0XUrLwrpcfiGXU9e1aK5Bt9M0jT4/CuvNd6pc3Sa
bF9gx9rJubQXGovxz+FBsG1F/GdhbQrrtp4ZNtfWuqafqreIdR0a48QaVo0eh31hb6zLqGs6Raz3
eh20dg8mt+X9n0oXl0yQsAesV4T+0BY+KfEvhPR/h54U0qXUJ/iP4o07w54ivJhqkGg6X4Gsre98
TeNIvEmq6ZY3smlab4t0LQbr4dwzhVuG1LxlZG0WWSN1HRf8Lv8AhMbXw/fJ470Kay8TWtvfaVd2
801zbCzutUOhwXWqzwQyReH7d9cSfQ/O8QNpkaa1aX+kuy6hp97bW/A+F/2mvBGr23ivWPEctn4M
8OaP4y8X+EvD11qtzq8mv+IYvh/O1p4z8R3vhl/DdncaB4e0WdrWWfU/tmrWVjY31nN4jufD17Om
mkA+em1HxN4Ck8A/CLx9b/Ebw14a0P41eLNLsZfhFa/Eu8tPFXw51z4ceM/iV4M8OeH9T8G2EHje
/wBF8A6rjwRfW/hq1F/pVn4N0p9VW30XUbm9OPLr3xVnfVNK1DVPjm3xQ0z4DfDfW/hXoGi2/ilr
VPGOt/Er432nhHUvjBBounzeD7LUNX0Hw94EsPiCnxGhtNGWxtfFJmjfUNOafTfsfX/i38DLfV5H
8Q+L/CD6t8PRp3iBry5eO6fwqPFtppHh/SdUj1FIZobA+JLH4gaXpmnzw3CnVrPXZI7czwJemBuj
fF/4G6n4gv8AUtL8Y+E4/EN9ol9Z6vqdy/8AZVyNL+G11rd7qmhazqOpQ2cdlf8AgeTWtf1fU/DW
pT2+seH7DU7/AFq9021065kvHAPmKW2+KvhePTvDeiXXijQ4fjj8UP2gfhwLfbPYXvg+7vf2kPib
8QrD4l+H4ru4sZdPa/8Agrf/ABI1221uxXfq91pPw3mtZZrdrG4j9M/aQ8KeNr7xV8P/ABb8OtP8
U3vjHwp4J+OEvhufStR1waLZ+Kn8ASt4MXWNOF/B4UupdQ8QC3traDxPCbLWpFXTb6WSzDLH3F58
UvgdPrGl+PLaCy1/xbaav4d+Gdtqtj4Wu5vGeh2/j+6S60uCaK80638QWHhbVvs82oQ3yQ/2Zqf2
O7TTnvbuOaCtvTPjv8PW0vw9deJPEvh3w/qPiCMTxWEWsNrFpZWtx4ju/C2l32oavDYWtvpmn6vr
No+madqGsRaXZXmrx3ek2U93dWVwAAct8FZdWPi7xrDpUvxWuPhoPCvgC50ub4wWfjq119fH083i
2HxjDpDfEWxs/EsmmnRbXwZd6nDFv8L2etXc8fhpYXk1q2t/pGvLF+N3wlOraloj+P8Aw5BqOjjx
WNTS6vRZ2tlP4FM7eMbKfUbpIdOXUvDNtbT6lrOl/azqNho0Z1ye1TR2W+bqfCnjbwv43tb288Ma
qmpR6beLp+oxNbXthfadeyWVpqUNvf6bqdtZ6jZSXGnX9lqFsLm1iFzY3dtd25kt545GAOqoryK2
+PXwdurDU9Vj+IPh+PStItNG1G81S7mmsNNbSfEWsJoGh67Y399Bb2mq+HtT1iSKxtPEOlzXmiSS
ywt9vEU0Ujw6j8fvhJp/h8+In8a6Q1qbzxBpkdo5vINUTVfC1m1/4gsdR0eS0/tjRjolmYL3W7nV
tPtLbR9OvLDUtRlt7G/sp7gA9jr4A/ZX/wCTu/8Agp3/ANl//Z//APWKP2d6+0fh/wCK08eeA/BP
jmOxbTI/GfhHw34rj017gXb6eniLRrLV0sXulht1uWtFvBA1wsEImMZkEMYbYvxd+yv/AMnd/wDB
Tv8A7L/+z/8A+sUfs70AHiP/AJSm/Bv/ALMA/aV/9aK/ZPr7/r4A8R/8pTfg3/2YB+0r/wCtFfsn
19/0AFfAH/BMb/k0TSP+y/8A7a//AK2v+0LX3/XwB/wTG/5NE0j/ALL/APtr/wDra/7QtAH1p8Zf
GepfDr4U/ELx3o1vY3eq+EvCes6/p9rqcdxLp9xdabZyXMMV5Ha3FpcvbuyBZFguYJCpO2RTzXKx
/tA+ET4nufD91oni/TtOtPFHi3wTP40vtN0yPwjH4q8FeGdW8Z63pBni1qbXML4V0PU9ZtdV/sH+
wp1tpNMOqR65HLpaek+PPBulfEPwZ4n8Da5NfW+j+LNFv9C1KbTJYINQis9Rga3nezmuba8giuBG
58t5bWdFbBaJhxXHj4LeEH+0pdS6xe2158QfFvxGvLK5u7QW91qvjTwb4h8Dazpcpt7C3uF0P+xf
E2oPawRTx6lFepbTSapNDHJbzAHC6h+0DNLJ8NbjTPBnijRdI8a+L9Is3v8AxjoaW8WreC9b+H3x
G8ZWGt+GLrSdbvLSHVZZvBNqt1oXiCSz8R6NY30Ta74Z01tT0u4bbf8AaM8BjStP1SKy8TXLaz4F
+FPjvRNLt9Nsm1TWLb40eILrwv4D0GxhfVEt/wDhIr7W7X7LfQ3N1baTpkUyX13rCWEN5dWsemfs
96Lav4UGs+PfiX4utfBF3os3hbTPEOr+HotK0m00Lwz4v8JWunJp/hzwt4ftrpbjSPGeoR6jrV9H
deK759P0ZZ/ELW1i1vPjaL+y74V0fTEsJfG/xD1i5sPDnwy8L+GNY1WfwQNR8IaX8Htfn8T/AA8/
sSHS/A2l6Pd3Wha1czXMt14m0nxDJrEb/Y9c/tKzVLdQDmLD9rHSNKg1pPHfh3VtM1+Pxn8SNN0n
wlaR+HtN16z8JfDseHl1TVNck1/xnbaBe6jbXHiLT7WK38N65qNx4nku4ZvB2lazZQ3d1F6d4Y/a
B8C+NfGEPhLwlDrXiGOW10C7fxJpsWkS6Na2/inwXY+P/D13d6dJrMfjO30fVfDep6bJb+Jn8J/8
IouqXsWgza5FrcVzYQcrq37LXhLWWF/feMPGt14na+8VXd14v1Ky+Gmu61dweM/+EabXNP8AsfiD
4dar4Y0+283wnos2l3GjeHtM1PRfs8lrpmoW2m3E9jJt/wDDOfg4+LfBniqXXfFl1H4AutEvPCeg
X03hrULDR5tA8LL4SsorHX73wxP8QbLTJ7NF1HU9BsPGlroGqa295qV9pc76pqyXwB0PxF+NHh/4
Y6haW3iLQ/FL6XKugvqHii0tNHi8PaSniLXJdBsVafV9c0nUfEN7b3MEl3q2jeCdM8U67o2mPZX+
p6Zaw6vox1Db8b/Eex8F32i6NH4e8U+MPEev2Ov6vp3hrwfY6feas+g+FU0z/hItckbWNV0TS47H
S7jXNA08wHUjquoalrumWOkabqM80iQ8B8S/2cfCHxR8S6h4o1jXvFOlX+qeG/D/AIYvI9Hi8GTq
LDwzrOs69pcunX/iTwb4i13QZzqWtTyalD4f1fS9N1qO1s4dXsL6NLhbnvPG/wAN7fxlqeh6/aeK
vFngnxJ4f0zxJodh4h8Hy+H11E6F4tOiza9pE8Pijw74n0pre8vfDXh3Uo7qPTYtUs77RbOSy1C3
ie8hugDkx8fvCkmpJa2ugeN7nSJPEcHgqPxU2hQabof/AAnd3pcep2fgu5tda1LTPE+na1cyz2ug
i51Tw7Y6BbeK7qHwpf63aa+JtPix9T/ah+F+m6Zomqebq15F4j8N/DzxHokUMej2RvT8UZNe/wCE
Q0SS71rWtK0vTNZubTwr4l1TUBrGoafpWj6bol5c6nqtqWtY7i/pf7PXhjSdT06aHxX4+uvDWneL
dP8AHw8CarrOlav4ev8Axvpllbw23ijV9X1LQbnx/quonV7W28XXEN741m0y68Xwrr1xp8lwWVs+
b9l/4avoniDRYn1q3bXPihL8WrbU2/4R7Ubvw54jkSS2TTdCsda8O6p4dbwpaaZd6vpFj4b1zQ9b
0+zsNd1VrdY76W2vbUA0PDf7RXgvxjqng3RvCmleKPEOo+Lv+EqM0WlW+g3Vt4Si8DeIbDwt4vn8
U6kviEaXHBoeuanY2jS6Be6+urR3MN74f/tewliuX09f+OXhvw54q1jwze6B4wlt/DWpeDdL8U+K
rXTdNfwv4cn8fTWVp4Wm1C5m1mDVbm1vL2+jtr+fR9H1QeH0R9R8RDSdGe31Kex4H+CnhbwHq2ia
5pl/rl9qmieH/GPh5bjUDodvDfweOPE+h+K9ZvLvT9C0LRdMtbmG/wDD2m2elW2iWWkaNpulI1jb
6UEWB4eP1T4Fah4p+I3j/X/EnjHXrbwH4n1P4Y6tF4G0O70YaV4guvAK2d6V8VLqXha81mzt5tX0
zTlng8MeJdLj13SYW07XRc2ZFrQBd1L9pPwPoWs6toviPRvGHh2bT9E8VeINPk1TTNM+0+JNP8I6
5pPhy+/sfw5Ya3feMrWfVNV1zSofDEfiTw14fHieO8guNEe9gkR2zb79qLwXo9xq2k+IPDHjXw34
p0rxPoPhAeE9eHgrTtQ1HWfEPhrU/GVmLDW5fGx8Ef2fB4X0e/1a91a+8WWOmQPEmjrdSeIJotJf
j9S/Y98JWem61N4d1rXtR1h9N8epoOna/P4T0bSV1Hxzrtj4ru5tU8Q+Ffh/beL728s/Emj6HqGj
eJdcvPFWtaJcaVbTFNXt5tW03WDQv2a9S8UnxTr/AMV9av28Yap450jxN4b1uO68FeMdX0q00HwC
/gW2/tWz1b4Y6b8NZ5r611bxMr6bY/DkWdpaXem6iL2fxPHLqkAB9LeAfHXh34leEdH8beFbqS60
TWo7vyGmjEVzbXem391pOrabeRq8saX2k6vYX+l3ywTXFsLuzm+zXNzb+XPJx7/GfQYPiNpHw4vf
D/izTb3xDrOseHfD2vanZaRYaNrms6D4avfFmp2+m6fc65H4zl06LSNL1QweJpPCcXhK/urB7aw1
65e80w3+z4H8ASeAYNG0PRvEGpXHhLRtBvrE6Tqdvo81zqOv6lrkmtXPiSa80/SdLOnzlrnUIZNK
05YvDzR38EWl6LoUGkRR33A6Z+zf4R0j4hW3xGtPEPikajaePvEnxIi0trXwJ9hk8R+KdD8R+HdS
F7rEfgePxvqelw6T4q1i10vTdT8XXkGkwvZ2+n+Ra6dYW9uAfQtfwx/8HkH/ACNX/BPz/sX/ANpj
/wBOPwKr+5yv4Y/+DyD/AJGr/gn5/wBi/wDtMf8Apx+BVAH9Tvwb/wCKA/4KFftpfD2T9zYfGv4Y
/sy/tV6Gx+7qfieDRfGP7MPxNhjHLCbw74b+A/wImvHO2F4fFumJAGlhvCv3/XwB+0v/AMWx/a7/
AGF/j8n7nSfE3iD4s/sYfEG5HFvaaB+0F4Y0n4n/AA61rUF6TSQfG/8AZz+Hvw60ORVkubO8+L96
sQjsdQ1aVfv+gDn/ABb/AMir4m/7F/Wf/Tdc18gf8Eyv+Ubn/BPn/syD9lD/ANUN4Br6/wDFv/Iq
+Jv+xf1n/wBN1zXyB/wTK/5Ruf8ABPn/ALMg/ZQ/9UN4BoA+36KKoapqul6Hpt/rOt6lYaPo+lWl
xf6nquqXlvp+m6dY2sbTXV7f313JDa2dpbQo8txc3EscMMatJI6qpIAL9FfAs/8AwU8/YquJ5ofB
XxP8X/G1YJZIjefsy/AH9ov9qrSpRE7JJPaax+zd8JvippN9ZIY7p21CzvZ7ERadq8/2jydH1WSz
7z4Yft8fshfF7xjp3w58H/G/w5ZfEnWRJ/Yfw1+IWmeKfg/8SNeaHZ9pi0D4f/FzQfBHjDXZ7NZY
ZL630nRbyexiuLWa7jhiurd5QDz7/glj/wAo+/2Xv+xAuP8A1KPEFff9fAH/AASx/wCUff7L3/Yg
XH/qUeIK+/6APgD/AIJmf8muax/2d/8A8FHP/XiX7U1ff9fAH/BMz/k1zWP+zv8A/go5/wCvEv2p
q+/6ACiue8WeLvCngPw5rHjHxz4n8PeDPCPh2yk1LxB4q8Wa1pvh3w5oenQlRLf6xrmsXNnpmmWU
RZRJdXt1BAhZQ0gyK+If+HjvwX8R/vPgl8Mv2p/2ltOm50vxd8Df2Zfixq/wp8TRtxDeeC/jr410
DwL8CvHOj3DFFh8ReD/iVrnhwlmL6siW900AB9/18Af8E+P+Rd/ax/7P/wD2wv8A1aV5T4/+CkPw
C0GSNfjb4T/aL/ZdsC6x3XjD9pH9nH4ufDn4Q6MzMAD4p/aDTwzrX7Pfg6JhJbGC48WfFTRLe9e5
+zWEt1eWOrW2n5H/AATe1zRfEvgX9p7xD4c1fS/EGga1+3j+1zqeja5omoWmq6Pq2m3vxNup7PUN
M1Owmnsr+xu4HSa2u7WeW3nidZIpHRgxAP0TooooA+AP2D/+KP1P9tP4Cyfuj8F/23/jXrekwt8p
n8NftUW/hj9ta0v7RDnOlxeJP2jvF3hi2dGaGK98Lanp8IiFgbeH7/r4Aj/4tP8A8FK7hW/ceHP2
yP2WoJoWb5bOH4u/sfeN3huY1bktr3j74VftGWciRN8suh/Am4liCGyuDL9/0AFfAH7KP/FcftQ/
8FD/AI0H95Zj4zfCr9mPwndj5lv/AAl+zr8FfDHiXWZo342Lpvxx+O/xv8MyWw3iO68P3FyZN140
EH2t458Z+HPhx4K8YfEPxjqUWj+EfAfhbxB4z8VavPkw6V4c8L6Td65rmpTAc+VY6ZY3V1JjnZEc
V8pf8E7/AAZ4j8I/sf8Awi1bx1psukfEr4xweLP2l/irpNxhrrRPih+1F438R/tB+PPDE8o/1qeD
fEfxIv8AwbYFQsEOl+H7C1tIoLO3t7eIA+1qKKKACvgD4r/8pNf2I/8As0D/AIKH/wDqz/8AgnfX
3/XwB8V/+Umv7Ef/AGaB/wAFD/8A1Z//AATvoAP+Cg//ACLv7J3/AGf/APse/wDq0rOvv+vgD/go
P/yLv7J3/Z//AOx7/wCrSs6+/wCgAr82pNM1XU/h9+0D8IR4A+IE3xC8YftBfE7xD8P7u9+Gvjyx
8L6bLrHjuDUfCfxGtviVdeGo/A+n23h9UHii2v7fxKNSkj0/7PpkFzqF1bWk/wCktFAHwX8RPBvi
6/8AgZ+0Do9j4W8RXeraz+0TYa7o+mW+i6jNqGraJF8UPhvqUmr6ZZpbNcX+mLp+n316b61jltja
2dzOJTHBIy9L8ePAHxF+Mnju60fwxo+mWOn/AAw8Fwat4O8TeLZfEGj6evxj8SatBrHh7xV4Zms9
Gv4NYv8A4YW3gvTA80MsNqv/AAnuqaXLcG7hlFl9n0UAfNXjjxL4w8V/C74U+J4tB+IXhTT/ABD4
g8Faj8XPDnh3TvFFv8R/DXhe+0m/m1fQ7Sz0Oyg8cpPYeNG8O6Tr914WsU1r/hGhrWo2MkGnedfw
/OeiWXivw74Ut9Mv4f2jLDwU1j+0TrXgmfwpoHxHPxBv/iDrHx38dax4c1XxtaaLpbeIEvNQ8K6h
o+s+GU+JFpaeDNcbVtVu/FdpNcxQJbfpDRQB8Ixy/F65n8SQ+NB8ZY/i/dx6dYeErL4cx63B8KLb
TJvglpDarLqOrXcMHwths1+Jb+M7i51G91RPiXDqttoVp4blh02XQ9PuaKa38VfG1rbW+lx/GrSN
Ol8P/sb+HdanvfDvxA8E6tHqdz8R/HUfxzu7CTXdJ0nU0uI/CF5oK+MPEumqRbWkVjcPqcb2dvcR
fflFAH566tpXx+8P+H7vUfAl/wDFO/8AGF/H+1z4a0+38S33iHXtL0/S/DHiTxPZ/Ai5Gn+Ihd6V
FqEum6LoN94Y8WatFcaz4xGpu+paxr+l6lHb1Q8F2Hxr13UNF0W91r4pR+Arr4t+CYL65soPjR4b
1SDQ0+G3xTPjeCfxJ8UUsPienhnUtatPACXd1JHY6Po/iC8b/hEdZtdUmCaP+jNFAHyF8INB1rQ/
iksvilfilqV+vgzxl4O0TxF4kbxzqGlXuheDvjZ8Rbbw9/wkd/sXwlJr114Jl8LX2k63r0MWu+J9
PmfVbK+1F7y9uJ/r2iigAr4A/wCCX/8AyZX8Ov8Asf8A9pH/ANac+Mdff9fAH/BL/wD5Mr+HX/Y/
/tI/+tOfGOgA/ZH/AOTo/wDgqf8A9nf/AAc/9d2/sS19/wBfAH7I/wDydH/wVP8A+zv/AIOf+u7f
2Ja+/wCgAr4A/wCCif8AyTr9nH/s/wD/AGCP/WpvhpX3/XwB/wAFE/8AknX7OP8A2f8A/sEf+tTf
DSgDoP8Agpr/AMo3P+Cg3/ZkH7V//qhvH1fX/hL/AJFXwz/2L+jf+m62r5A/4Ka/8o3P+Cg3/ZkH
7V//AKobx9X0dqvjKz+HvwefxvqFrPfWvhjwLaavJY2rRxz3r2ukQNBZxzTFbe2N1OYoDd3TJaWi
yG5u5I7eKWRQDynRfgB4v0rSfGttF8RrKw1vXfg5Z/CLw3r2ieGLuym0CLR9d+IWp6L4lnt7nxJe
yXWoxW3jOzivILO804Pd6dPdWN1YfaLdbXN8Jfs1a1oXi+z8V6n42t78wfEPwr4+ex8jxlrN15nh
zwB8QvAkulv4j8ceOvFviDUPt6+MbDVEv769P2N7C8sYrJree1a1o+Kf2ovE/gTWtc8J+MPhbp1t
4psNc+HmjaPH4Z8ZeJ/Gmg6xH480H4keJpNRmm0H4UTeNLK20PSfhjr6XMFp4A1i9udQaAG3tNG3
64Oz+Evxg8X/ABO8XRtP4SPhbwlJ4B/tOew1t/EGm+JLbxRYeP8Axh4Ruriz0jX/AAT4e1G98La1
beHI9V8P6tqb6Ff3Wj3GnXtz4Zsbu+urOwAOY8Sfs065qN3Be+G/G2n+EtUi1PxxeW3irRNL8S6L
4w0SHxh8VfFHxIFvY6r4Z8Z6BaeINMt4/Eg0648K+ONN8R+Fpr6xbVYNNtl1XV7G92LP4D+LvDGu
3PivwV428PW2v3938a4roeJvCN7relwaT8W/iJD8QrRrG1tfE2lSxan4avLS3srsvMbDxPbuBe21
k1hp7Ralz8etQttRW+fwXZjwBc/EnxP8KLDxGfFch8TTeLPCyeIbG5uLnwdF4Zls7Xw5d+KfC+re
H7XUI/Ft1qqwPp2u3Wg2+m3F2dP5LVf2hvFGt6D4Wl8E+FNLtNa8Q+EP2YfiKF13xNLDYx6Z8cfi
dD4UvvC8lxbeEtXlD2lpaTWUmux2BkEOqyala6bFd6XBa3wBseHP2bE8LeFL7wlp3it7iyk8a/s4
+JbC5vtNL3cOm/AC3+DdotjeyR3qrd33iWD4VSM17GlvFp82soxtrxbRhcN1b9nPUrzSFstJ8djw
/q0fxE+Pnj+11208PrcXNhefGfw98S9D014YJNVhS4vfB8njuxvlnnkEerf2J9l8vT0uEkgo67+0
r4g8M6VrnifWvhnYx+FLfWvj34b8M31h48a91rWdb+Bll8RtUlXWdEk8H2kHh3SvFWnfC7xO9pqV
rrHiGXSbz+zbO90+X7fFONvxd8ZvFQ19fC/hDw9pK3+n6t8ALvU73WfEE1pb3Wg/FrxB4n07UbK2
SDwvrDx3unJ4XFssrIouodWluoprCfToor0A5rQf2cvGWiah4r19fHej3OueINR+C+p2f9q2fxA8
UwWcnwo8ReI9WuoNR1Xxl8SfEHifVhr9nriW9rKNYsYdElhASwvoUPn0Lb9lvxHpXhrxZ4N0b4g6
RHoXxJ8DWngLx3c6h4Qu7rWodMtta8a3Vxd+ELqPxPFb6Xc3uheONQ0uKDUbfUrXStXtIvElmjz3
t/YzX/jh8V/Hfw3+KGnaha26Xvw88G/A/wCK3xS1zw7Y+ILTTNQ8Xan4bvPCmj2lnfR3vgnV3ig0
1/EETaZFYeJNJjurq/uNS1SVo9BtdI1zo2+OvjPTbrVG8RfDfw/aaN4Q8f8AgH4ZePtR0T4iX+s3
mkeJ/iCPBkmnT+G9Jvvh3oD+JvD+mW/xG8Fy6rf3914Y1Rjda2NJ0LVYtKsJ9cALN/8As/tf+GZP
D8mvaTO0vxM+NfxAM2q+FoNa05rf4u6H8V9FGhXui3moLb6pZ6YvxJhbU4rieG21610q5sXhsk1B
ZrbpvhB8MfEfw40nxHpmpeMJNTttVurOXw/pFrN4o1DR/BVva6PbabLa6FL478U+M9b+y3d5A+pj
TJNUTRtPLJaafpsK/aZrvxaf9qnxr/YNx4htPhJ4dlsl+GXxH+LVrHd/FO/tbiXwr8K9XttE8UW9
0kHwwvktdevbvULCbw1YwSX1hqFm93JrGreHrm2htLzuP2ivF3ifTvDnwkbwbe+PLB/G3xO0nRtR
g+HcPg1/HF/od38P/HviE6fpP/CcpceF4Lj7do2mXV3JeSRgWtncRwXBaQJKAeeaP+yd4sieK48R
fFGPXb46D8OdFv8AULuz8a6ve6jdfD/4neCviI+ttN4t+IniVNMPiAeGtRsJPDuhQ6VoGiy39pNp
luYLaa2uPV9U+DHiOH4iav8AEnwh4p8PaVrOsXni63ns/EHhS617SU0Dxr4O+C3h/VA1rY+IdBmu
dbs9Y+Cui6taXEt2LC607U9T0e7sxM9tqtrwmmXnj/XvEvgP4Tjx18YPA0Wq+BfHfxJ13XvF1l8K
Jviref2J4s8N+FdM8KxXej+G9b8Cafpli2uNr2p3NhpmoaxJaX/hmzGpWaXGoQHx/wAW/Ff4pWXx
S8I/DWXxz8SNV07w/wDEL4weG9S134V+GPAmo+NPG9h4c8A/Bvx94Zk1nS9R8LX/AIYW68M3HxE1
Twt4lbQtG0myvZ9FuLiTT7KeSWytwD7y+HXhWTwL8PvAvgiW9j1KXwd4N8MeFZNRitvsUWoSeHtE
sdIe9jsxLMLSO6azM6W3nS+Qsgi82TZuPxl+yv8A8nd/8FO/+y//ALP/AP6xR+zvX1T8Fbjx/deA
LOf4knVX8Qvrfi0WUviGx0DTPFFx4TTxVrEfgq68Vad4Vit/Ddl4ju/Ca6Pc6tbaPa2VtFcSlJtP
0+9F1ZQfK37K/wDyd3/wU7/7L/8As/8A/rFH7O9AB4j/AOUpvwb/AOzAP2lf/Wiv2T6+/wCvgDxH
/wApTfg3/wBmAftK/wDrRX7J9ff9ABXwB/wTG/5NE0j/ALL/APtr/wDra/7Qtff9fAH/AATG/wCT
RNI/7L/+2v8A+tr/ALQtAHa/Hj4SfDHxL8aP2eNR1/wJ4Y1i+8YfETxVpPim7v8ASbW5n8QaZpHw
K+Jeo6XY6u8kZN9a6ffaNpN3aRT70guNOtJYwGgQjznU7b4R7Pj1qHxh1qx8P/EvwT4k8T2fw/Qe
ILnw94w8C+A7DRLKH4USfBjThqVnd2CaxZRW1xaXHg6yjj8T+OZ9b0O7Oq39lcWUf6GvHG7Rs8aO
0LmSFnRWaKQxyQmSMkEo5illiLqQxjkkQna7A1Z9N066urW9ubCyuLyxZ2sbue1gmurNnRo3a1uJ
I2lt2dHdHMLoWR2UkhiCAfn9YN4O8R6t44uP2vdW0fQ/FuieBPhfqHhyx8Qa43hxfDWlX3wy0W88
ZeKfh9ZQ3kEMHiNfitN470u58Q+Glutft5dF0DSBcJBZ6PDN9weDNa0rVtA0iCw1a/vry18PeHLi
+h197ePxlZx6ppEF3p83i7TFigm0vXb+2Juby3urGzDXQufLt0RCi9Fdadp97LZz3tjZ3c+nT/at
PmurWC4lsbrY0X2mzklR3tp/Ld4/OgKSbGZN21iDHb6Vp9rqOo6tBbKmo6rHYw392Xlklng01Jks
LcGR3WG2tftN1JFbwLFAs93d3Plm4uriWQA/PbT/AI8eJNG8D2Vu/wAZfDOn3PhL4JXfxEh1/wAY
Q6Xrd38TPGll4m8T6dqvga4uPtlllfBkehaNpHinTdFkTxpPe+OfD8kd1ZXFu0Go9Rc/HnxvN4q1
iBvEfhhdQt/ijoXgFvgU+k2l34og8Ma18MtC8V67rWoXq31vq5vvC11q+qa3f6pHbjw0/hvw1qWm
G1fWrqOSy+5W0+wcxF7Gzcw3LXkJa2hYxXbyGV7qIlD5dy8pMrTriVpCXLFjmsDw/wCCtA8M6p4s
1nSrVk1Hxp4gbxLrdxM4mkbUX0Pw/wCH3S1kZfMtrJ7Hw1pkjWau0X2tZpwAZAqAHxL8L/jTr0nh
Pw2Lr4heA/Ak/h/wr8GNF8M/DbU/DVzfv42s/FXwT8E+LZNet4dO1CTxjHp3/CReI9X0PTr7w9YX
ejaHZfD7XZdXj1MxarNo/sX7NXxX8Q/EWLxLpnivWLfV9c0HSfBes3Uunp4J1HRdniqLxBELnw/4
s8BeKta0zWdBvrnw5dT6XpevaB4U8Z6Fa7JdettRt9Z0meD6ZFjZLLBcLZ2ontofs9tMLeES28AB
UQQSBN8UO1ivlxsqYJG3BNOt7S1tFkS0tre1SWVp5Vt4Y4FkmcKHmkWJVDyuFUNIwLsFUEkAYAPz
dP7VvjR4PG2p6D4j0rWrdfgV8XvifoMWtaP4NsTp+t+CvE3gzTvDQsvDnhrxvrni7T/D15pfifUv
tVj8RhpPifU59GFzBbaQbbV9Ph9f134i/Enwvrn/AAguv/EPw/p1pd/Fuw8KzfFTUPDmkaZ/wj/h
68+DV38QobK4sby9Twymqap4s00+H9Mvr4SJ/ZWoR2YtL3W2t9QX7AWwsU87ZZWifaWuGuNttCvn
td+X9rabCDzWuvKi+0F9xm8qPzN2xcST2ttdRSW91bwXMEpUywzwxzRSlCjIZI5FZHKMiMpZTtKI
RgqMAHxx4I8aXXw+/ZE0DxPH4htLm9tbmLR4fE1hpVpfWd9c+JPiu3hWDU9L0/X/ABHoGlWsd/Jq
6S6VdeJfEtpoWiGe21HxHdT6RYX8c3F/Dz40fFn4n+J4vAOj+NNI0Uxa78btHPimXw/4R8S61PF4
I0T4Ja94XN+PDHiLVPA41O0vPiZqGm62+iTXunXuj2aWsMNnrbjW7X7+kiilikhlijkhlWRJYpEV
4pUlDCVJI2BV1kDMJFYEOGYMDk1FDZ2lsQbe1toCqhFMMEURCCK3hCAoq4UQ2lrEFHHlW1vHjbDG
FAPmnxL451TXvgn8C/Gupafox1bxv4w/Zl1HVbWO3uJNNsrzxf428C3OovpMc91Jcwmymv5jpclz
cXMsASJp2uGVi3j+mfGf4x6d8NfBfjDXvGHhe8b4l/CL4ReOZNVuPCEWn6d8NJvG3jzwB4b8X+IZ
IYNXjh1Dw74T8JfEBvE102uXq28d54VvNRvbzTtBu5tNs/voQQiNIRDEIYvK8qIRp5cfkMjwbI8b
U8lo0aLaB5bIhTBUEILa3EK2wghFusP2ZYBEghW32CPyFiC7BDsVU8oLs2KF24AFAH5kj4veOfBG
reMNN8LeLNO8b6d4u+PHj0ap8TNFm+HumQIfDvwZ+Dt3onh2yuvHfibQvh3Bq0731/JrTQ6jI+of
8Ih4iOg6HYC6uJdA9N0L9oL4k6x4r+CmlX9z4X0rSfiX4a+G2teP7+wtP7VtfhnrutQ6peaR4etd
Rs59T0aaz+P01pZ6b4FbWNcuNS8MRQ3zNNrGo+IvCsUf3DJpemTW/wBkl06xltN0LfZZLS3e33W6
RxW7eQ0Zi3QRwxRwnbmJIo0QqqKBZMEJ35hiPmSxzvmNDvmh8rypnyPmli8iHy5Dl08mLaR5aYAK
+nalp2sWcOo6TqFlqmn3HmfZ77TrqC9s5/JleCXybq2klgl8qeKSGTY7bJY3jbDowH8OH/B5B/yN
X/BPz/sX/wBpj/04/Aqv7m1VUAVFVVGcKoCgZOTgDAGSST7nNfwyf8HkH/I1f8E/P+xf/aY/9OPw
KoA/r5/bT+D3iL46fsx/FbwH4Glt7X4o2ul6P8RvgrqN2wS10j48/BvxPonxe+BWtXTloytnpHxc
8D+DNQvtssTSWVvcRebGJCw9H+AXxh8O/tCfA/4RfHXwlFcW3hz4vfDfwb8RtJsb1Smo6XbeL9As
Nb/sbVYXWOS11jRZLyTSdYsp44rix1Ozu7S5hhngkiT1yvgD9lb/AIsj8eP2lv2Qbr/RvDdt4gm/
ay/Z8jf5YW+FH7Q/inxFqfxU8GWDtgXNx8Mv2k7T4kajNY2ypaeFfh78Wvg7oMEMVuLbeAffU8EN
zBNbXEaTW9xFJBPDIoeOWGVDHLHIpyGSRGZWU8FSQeDX546H+x38df2etF0fwp+xN+1NH4A+F3h7
S9P0Lw38BP2pvhprf7VXwr8C+HdGtIbLSfD3wq8Uab8Wvgj+0B4L0+00+1s9F0vTfF3xn+K3gbwn
otpa2fhP4e6XBbtb3H6J0UAfAH/CPf8ABUzVv9Ab4ufsCeAlh/dnxTD+zz+0N8V5tUUfeu4/A0v7
Tfwdi8OyOItqWcnj/wAVx27agJXvLxdHNvrt/S/2Bvh94w1Kw8Wfta+NvGf7afjOyu4NVstP+N40
dfgR4W1a3lW5tLjwJ+zB4XsNI+COmT6JdJE/hjxb408L/EL4t6MkEDz/ABQ1TUDdajdfeFFAEUEE
FrBDbW0MVvbW8UcFvbwRpDBBBCgjihhijCxxRRRqqRxoqoiKFUBQBXB/E/4TfC342eDtR+Hvxj+H
Pgb4q+A9XMban4N+InhXQ/GXhm+kh3/Z57jRPENjqGnPc2xd3tbo2/2i1kPmW8scmGHoNFAHA/C3
4XeAfgp8O/B/wn+Fnhmx8G/DvwDodn4b8IeF9Ne7lstF0WxUrbWUM1/cXd9cbdzPJcXt1c3dxK8k
9xPLNI7t31FFAHw34m/Ya8OaZ4l8R+PP2afjF8YP2QvGvjDX9a8U+MofhBqvh3xF8JfG3iPxLqV1
rPibxB4l/Z8+Lvh34ifBiy8U+Jdav9Q17xL488AeEPAfxH8Ta9dPqPiXxlrCtNbT4n/ChP2/rj/i
XXn/AAUH8H22jD5RqmgfsYeCbH4hFDwzNruu/FjxR4CNwA8hjkX4VrArpamS1lSK6jvfv+igD4h8
J/sFfCI+I9H+Inx+13x3+2F8V9CvY9V0Pxx+0vqWjeLtC8HaxEG8jVPhh8EfDug+FP2fPhRq9ksk
tra+KfAHwq0Px5dWDJbeIPGGvSJ9pb7eoooAZJHHNHJFLGksUqNHLFIqvHJG6lXjkRgVdHUlWVgV
ZSQQQSK47wF8N/h38KtAPhT4X+AvBfw38Ltq2ta83hvwF4W0PwfoDa74k1O51vxFrR0fw9Y6dpx1
bX9ZvbzV9a1E232zVdTu7m/vpp7qeWV+0ooAKKKKAPgT/gohDL4K+E/gL9qrTYpDqv7E/wAYPCf7
R+rywIzTN8GLKw1z4a/tQwuIgZbuOz/Zl+Ivxa8T6bpbLJbXni3wz4WnlWKextL6y+94ZoriKKeC
WOeCeNJoZoXWSKaKRQ8csUiFkkjkRg6OjFXUhlJBBrP1zRNH8S6Lq/hzxDpljrWgeINL1DRNc0bU
7aK903VtH1W0msNT0zULOdXgu7G/sp57W7tpkeKe3lkikVkdgfij9gTW9Y8P/DHxb+y74z1O+1Tx
9+xb46uP2ebnU9ZuZbvW/Fnwo0vQ9G8U/s2/EPUb65Z7nXNQ8XfADxJ8P4fF/iQS3UF98VtC+JOl
SXkmr6DrFtaAGZ/wULJ8f/Dn4Y/sl2RMt9+2j8ZfCnwO8T2qEsD8BtLtNV+K/wC1EL+Nf9TpniL9
nz4d/ED4aQX9x/oNv4q+InhS0uY7yTULbTL/AO/QAoCqAqqAFUAAAAYAAHAAHAA4Ar4B+Ev/ABfz
9tb42/HKb/S/h/8Ast6Hc/si/BiT/WWN/wDErxBN4a+In7WXjiwkOYbyO11LTvg18DrG4jijvPDf
ij4SfGTSBe3Fv4jvLS0+/wCgAooooAK+APiv/wApNf2I/wDs0D/gof8A+rP/AOCd9ff9fAHxX/5S
a/sR/wDZoH/BQ/8A9Wf/AME76AD/AIKD/wDIu/snf9n/AP7Hv/q0rOvv+vgD/goP/wAi7+yd/wBn
/wD7Hv8A6tKzr7/oAKKKKACiiigAooooAKKKKACiiigAooooAK+AP+CX/wDyZX8Ov+x//aR/9ac+
Mdff9fAH/BL/AP5Mr+HX/Y//ALSP/rTnxjoAP2R/+To/+Cp//Z3/AMHP/Xdv7Etff9fAH7I//J0f
/BU//s7/AODn/ru39iWvv+gAr4A/4KJ/8k6/Zx/7P/8A2CP/AFqb4aV9/wBfAH/BRP8A5J1+zj/2
f/8AsEf+tTfDSgDoP+Cmv/KNz/goN/2ZB+1f/wCqG8fV9OvoH/CV/Ck+GPtMFn/wkfgBdCN1daXY
63awDVvDwsGlu9G1JJNP1a1UTk3OmXqm1voPMtZiscrMPmL/AIKa/wDKNz/goN/2ZB+1f/6obx9X
1/4S/wCRV8M/9i/o3/putqAPBPAv7MvhrQbPxX/wmF3B4o1nxTrHhfVTrOgnxp4T1LRT4K02bTfD
MujeJ7/4g+MPiVbazp8N/rFt/bZ+ITzx6LqTeGtPg07w/HJp9x6z4f8AhX4D8K6houqeHtEk0q+0
HSNV0SymtdY10LcWGuatNr+rnW4X1N7fxNf6hr1zea5c6v4ji1XV5NZv9R1U332/Ub64uPQqKAPN
ovhF8O4fFT+Mo/DqjW5NVvtfKHVNafQY/EWp6PJ4f1PxLB4SfUW8KW3ibUtFnudM1DxHb6LFrd7Z
3l7Dc38q3t353OWP7O3wg03R9T0Gz8L3kem6rpXhjQ5lk8XeNbi8stF8FamNa8HaToWqXPiKbVPD
Om+FNWH9oeHLLw7e6VbaLds82nR2zyOW7j4k3l3p/wAOvH1/YXM9nfWPgvxTeWd3bSvDc2t3baHf
TW9zbzRlZIp4JkSWKVGV45FV1IYA18JaLL8RvGH/AAhdr4P1n9oR/AfiSH4IP468Q+IY/iDoGvSa
7rUnjMeP7nw7qGt2dvqOlaFeaEdIm8S3/hCaHwBodxP4cuvAl7p2ofbLuIA+pvBf7O3gHwwdeutW
s28X6p4g8Q/FvV7mfXLvXL7SbfT/AIt+MNc8Raxpdj4Y1bXNY8P6fdf2Jqtp4T1jXdNsbHUfEthp
8s2oGKLU7uwGtp/wA+FOl2GqafZaBqqLrP8Awhx1DUJfGvjq78QSN8Pr2e/8FSQ+J7vxLP4jspfD
U9xImlzWWq28sNmItOLtp9vBaxfNl/cfGuHVbxPBS/FWT4sx+MPjjpl3ZeJ7bxXJ8IP+FeWXhz4h
j4Mz2Opa7A3wznvGutP+EJg1XStSXxnqms6l4ibxpIYJvE8Vhi+Jr34gf8Ix4bT4dz/tCf2Gdc8G
XXxSu/iPpPxnjumD+CfHkl9a+HE0LS4/jjb+f4utfBsvjZfAVrb+CLKWfw/beHJrDR5viLbAA+2/
FPw48FeNZLubxRoUOrSX/hPXfA120t1fwGbwr4lutKvdc0gizu7cLFf3WiaXM9wgW8hNoq21zCkk
yyZ+o/CT4fat4sXxtf6A0viAahousTumr67baPqOt+G4hD4d13WfDFrqcPhjXNe0GJLePRtc1jR7
7VtMWx0wWV5B/ZWnfZfiS31L496efhVqOsn4r+KtUh0jwrBJoFpoXxP8Ipcxf8LZ8TwQavea9o1n
4i8Jz63ceAW8M23jzw/8fvDWiSHRbOz1nTtb8N+ItX8U/wBjz2up/HOwm+JVlaJ8YtYlu9P1TUtQ
8Sf2V8QNM1HS9Nh+Lfhe313SdA8HeLtK1rwRN45tvhxq/jN/Aep/ArxreeH9Yt/Dsc8vg/8AtK68
JzEA+zV+Dfw0XTP7GHhe3/s3/hDvFvw/+zG/1dgfB/jq+ttS8V6KZW1AzmHV72ztp5LkyfbrYxBL
K6to2dG63UPCnh/VW8MtqGmx3LeDdWh1zw0WmuU/svVbfR9U8Pw3kYimQTsmj61qdkI7sXEJS6aU
xmeOGWP428O6Z4/1/wCKOhaVp+pfHC1+CUXjfX7zT5/ENx8SvDuvz22n+AvC+rPpevat4ogsPHR8
GHx1HcR6DL4lvYb/AFe7/wCEj0K1vL3whJbWV19t6XqVvq9jBqNpHfxW9x5vlx6ppWqaJfL5U0kD
+fpetWdhqVrl4maL7TaRedCY7iHzLeWKVwDmPGfw78I+P00v/hJdPvJLzQ7i4udE1rRNe8QeEvE2
iy3kH2a+/sfxV4S1TRPEmlxX9uEh1CCx1W3gv44oVvI5xBDszNE+EPw48OXXhO90Twva2F54IHik
+G7uO71OS6tZ/G720vi6+vbie9ll1vU/EU9pBc6rquuvqWpXV2r3b3RuZZpZPSaKACvgD9lf/k7v
/gp3/wBl/wD2f/8A1ij9nevv+vgD9lf/AJO7/wCCnf8A2X/9n/8A9Yo/Z3oAPEf/AClN+Df/AGYB
+0r/AOtFfsn19/18AeI/+Upvwb/7MA/aV/8AWiv2T6+/6ACvzO/4JsfEX4faN+ylYaZrHjvwbpWp
Wn7QP7aqXWn6l4n0SxvrZ3/bU/aClRbi0ur6KeFmikSRVkjUtG6OAVYE/pjXytr37Cn7EXirXNY8
T+J/2OP2VvEfiTxFql/rniDxDr37PXwj1jXNd1rVbqW+1TV9Y1bUPCFxf6nqmpXs895f6he3E93e
XU0txcTSSyO5APaf+Fs/Cv8A6KX8P/8AwsvDn/yyo/4Wz8K/+il/D/8A8LLw5/8ALKvAP+He37Av
/Rj37IH/AIjT8GP/AJiqP+He37Av/Rj37IH/AIjT8GP/AJiqAPf/APhbPwr/AOil/D//AMLLw5/8
sqP+Fs/Cv/opfw//APCy8Of/ACyrwD/h3t+wL/0Y9+yB/wCI0/Bj/wCYqj/h3t+wL/0Y9+yB/wCI
0/Bj/wCYqgD3/wD4Wz8K/wDopfw//wDCy8Of/LKj/hbPwr/6KX8P/wDwsvDn/wAsq8A/4d7fsC/9
GPfsgf8AiNPwY/8AmKo/4d7fsC/9GPfsgf8AiNPwY/8AmKoA9/8A+Fs/Cv8A6KX8P/8AwsvDn/yy
o/4Wz8K/+il/D/8A8LLw5/8ALKvAP+He37Av/Rj37IH/AIjT8GP/AJiqP+He37Av/Rj37IH/AIjT
8GP/AJiqAPf/APhbPwr/AOil/D//AMLLw5/8sqP+Fs/Cv/opfw//APCy8Of/ACyrwD/h3t+wL/0Y
9+yB/wCI0/Bj/wCYqj/h3t+wL/0Y9+yB/wCI0/Bj/wCYqgD3/wD4Wz8K/wDopfw//wDCy8Of/LKj
/hbPwr/6KX8P/wDwsvDn/wAsq8A/4d7fsC/9GPfsgf8AiNPwY/8AmKo/4d7fsC/9GPfsgf8AiNPw
Y/8AmKoA9/8A+Fs/Cv8A6KX8P/8AwsvDn/yyo/4Wz8K/+il/D/8A8LLw5/8ALKvAP+He37Av/Rj3
7IH/AIjT8GP/AJiqP+He37Av/Rj37IH/AIjT8GP/AJiqAPf/APhbPwr/AOil/D//AMLLw5/8sqP+
Fs/Cv/opfw//APCy8Of/ACyrwD/h3t+wL/0Y9+yB/wCI0/Bj/wCYqj/h3t+wL/0Y9+yB/wCI0/Bj
/wCYqgD3/wD4Wz8K/wDopfw//wDCy8Of/LKv4hP+DwPxX4W8UeKf2Bm8M+JdA8RLZaB+0kLxtC1j
TtXFobjUfgeYBcnT7m4EBnEMxhEuwyCKTZu8tsf1+f8ADvb9gX/ox79kD/xGn4Mf/MVW5o37Dv7F
Xhz7T/wj37H/AOy5oP2zyftn9jfs/wDwn0v7X9n837P9p+w+EoPP8jz5/J83f5XnS7NvmPkA+o6+
Jf2yvBvizSI/hX+1R8KvDet+K/ip+y54lv8AWtQ8IeFdNu9X8U/FP9njx4ul6J+0X8JdF0fTop9U
8Ra3eeGdM0L4u/D/AMJ6XA+oeK/jN8FvhboETLb6hdpL9tUUAfAH/Dyz9nX/AKJz+3//AOKnf+Cp
v/0G9H/Dyz9nX/onP7f/AP4qd/4Km/8A0G9ff9FAHwB/w8s/Z1/6Jz+3/wD+Knf+Cpv/ANBvR/w8
s/Z1/wCic/t//wDip3/gqb/9BvX3/RQB8Af8PLP2df8AonP7f/8A4qd/4Km//Qb0f8PLP2df+ic/
t/8A/ip3/gqb/wDQb19/0UAfAH/Dyz9nX/onP7f/AP4qd/4Km/8A0G9H/Dyz9nX/AKJz+3//AOKn
f+Cpv/0G9ff9FAHwB/w8s/Z1/wCic/t//wDip3/gqb/9BvR/w8s/Z1/6Jz+3/wD+Knf+Cpv/ANBv
X3/RQB8Af8PLP2df+ic/t/8A/ip3/gqb/wDQb0f8PLP2df8AonP7f/8A4qd/4Km//Qb19/0UAfAH
/Dyz9nX/AKJz+3//AOKnf+Cpv/0G9H/Dyz9nX/onP7f/AP4qd/4Km/8A0G9ff9FAHwB/w8s/Z1/6
Jz+3/wD+Knf+Cpv/ANBvR/w8s/Z1/wCic/t//wDip3/gqb/9BvX3/RQB8Af8PLP2df8AonP7f/8A
4qd/4Km//Qb18J/H/wDa91+f4++AfjB+wr8BP2wPG/xx+K/grVP2WPHvhX4of8E+v28/gR8MJbHU
08ReJf2dfjh8SPib8bv2cPhv8O9G8Mfs3/F7Vdbg8VrqvjDSruX4Q/Gz4tahpEGv+J9B8KaDd/vX
RQB43+z58FvD/wCzx8GPh98GvDd/qGt2fgnQ/suqeKdZ8tvEPjrxfqt5d6/48+I3iqWLEV14w+JH
jfVvEPjvxfeoAt94m8RareBV8/aPZKKKACiiigAr4A+K/wDyk1/Yj/7NA/4KH/8Aqz/+Cd9ff9fl
3+1J8X/hL8E/+Cin7Dni74y/FH4dfCTwpdfsq/8ABQbQrXxP8TvG3hrwF4eudbvPiN/wT8vbTRrf
WvFWp6Vps2q3Vnp2oXdtp8dy13PbWF5PFC0VrO6AHov/AAUH/wCRd/ZO/wCz/wD9j3/1aVnX3/X4
s/t3ft0fsS+ItA/Zfj8P/ti/ssa7JpH7c/7J/iHVo9G/aD+EmpvpegaN8S7S71jXNRSy8XTtZaPp
VqpudS1O5EVlY24M11PFGC1fc/8Aw8J/YF/6Ph/ZA/8AElvgx/8ANrQB9f0V8gf8PCf2Bf8Ao+H9
kD/xJb4Mf/NrR/w8J/YF/wCj4f2QP/Elvgx/82tAH1/RXyB/w8J/YF/6Ph/ZA/8AElvgx/8ANrR/
w8J/YF/6Ph/ZA/8AElvgx/8ANrQB9f0V8gf8PCf2Bf8Ao+H9kD/xJb4Mf/NrR/w8J/YF/wCj4f2Q
P/Elvgx/82tAH1/RXyB/w8J/YF/6Ph/ZA/8AElvgx/8ANrR/w8J/YF/6Ph/ZA/8AElvgx/8ANrQB
9f0V8gf8PCf2Bf8Ao+H9kD/xJb4Mf/NrR/w8J/YF/wCj4f2QP/Elvgx/82tAH1/RXyB/w8J/YF/6
Ph/ZA/8AElvgx/8ANrR/w8J/YF/6Ph/ZA/8AElvgx/8ANrQB9f18Af8ABL//AJMr+HX/AGP/AO0j
/wCtOfGOvQP+HhP7Av8A0fD+yB/4kt8GP/m1r4Y/4Ju/t0fsS+Ff2P8AwBofif8AbF/ZY8Oa1beO
f2hLi50jXv2g/hJo+qW9vqf7RvxZ1TTZ59P1Dxdb3cUOoaZe2eo2MskKpd2F3bXkDSW88UjgH1P+
yP8A8nR/8FT/APs7/wCDn/ru39iWvv8Ar8zf2B/iN8Pfix8eP+Cnvjv4WePPBnxL8D6x+2F8KY9I
8ZfD/wAUaH4y8KapJpn/AAT7/Yu0vUo9O8Q+Hb7UtIvn0/U7O706+W2vJWtL61ubScR3EEsa/plQ
AV8Af8FE/wDknX7OP/Z//wCwR/61N8NK+/6/OL/gp34q8MeB/gx8DPGHjXxHoPhDwl4a/bt/YS1n
xH4p8Uaxp/h/w7oGkWH7UPw2nvtV1vW9WuLTTNK02zgR5ru+vrqC1t4laSaVEUkAHff8FNf+Ubn/
AAUG/wCzIP2r/wD1Q3j6vr/wl/yKvhn/ALF/Rv8A03W1fkt/wUY/bs/Yh8Uf8E9/27vDPhn9sj9l
XxF4k8Rfsa/tP6F4f8P6F+0N8I9X1vXdb1f4JeONP0rRtG0rT/F9xf6nqup39xb2Wn6fZW893e3c
8NtbQyzSojfVvhf/AIKC/sEw+GfDsU37bv7IcUsWhaRHLFJ+0p8GUkjkTT7dXjkRvGgZHRgVZWAZ
WBBAIIoA+3KK+QP+HhP7Av8A0fD+yB/4kt8GP/m1o/4eE/sC/wDR8P7IH/iS3wY/+bWgD63vLO11
C0urC+toLyxvreezvLO6iSe2urW5iaG4triCRWjmgnhd4pYpFZJI2ZHUqSKLOztdPtLWwsbaCzsb
G3gs7OztYkgtrW1tolht7a3gjVY4YIIUSKKKNVSONVRFCgCvkj/h4T+wL/0fD+yB/wCJLfBj/wCb
Wj/h4T+wL/0fD+yB/wCJLfBj/wCbWgD6/or5A/4eE/sC/wDR8P7IH/iS3wY/+bWj/h4T+wL/ANHw
/sgf+JLfBj/5taAPr+ivkD/h4T+wL/0fD+yB/wCJLfBj/wCbWj/h4T+wL/0fD+yB/wCJLfBj/wCb
WgD6/or5A/4eE/sC/wDR8P7IH/iS3wY/+bWj/h4T+wL/ANHw/sgf+JLfBj/5taAPr+ivkD/h4T+w
L/0fD+yB/wCJLfBj/wCbWj/h4T+wL/0fD+yB/wCJLfBj/wCbWgD6/r4A/ZX/AOTu/wDgp3/2X/8A
Z/8A/WKP2d69A/4eE/sC/wDR8P7IH/iS3wY/+bWvhj9mf9uj9iXSf2qv+Cj2sar+2L+yxpmkeKfj
n8C9R8MarqH7Qfwks9N8R6fp37HnwE0PUL7Qb658XR2ur2djrWm6jo95c6fLcQ22qWF7p87pd2s8
MYB9T+I/+Upvwb/7MA/aV/8AWiv2T6+/6/Kfwb8fPgV8dv8AgqL8Nbv4IfGn4S/GS18N/sDftEW/
iK5+FXxG8H/EO30G41L9of8AZYl06DWpvCOs6vHpc2oR2d5JZRXzQPdJaXLwLIsEpT9WKACiiigA
ooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACi
iigAooooAKKKKACiiigAooooAKKKKACiiigArC1zwv4Z8Tx28XiXw7oXiGK0d5LWLXNI0/Vo7aSV
VWSS3S/t7hYXkVVV2jCs6qoYkAAbtFAHn/8Awqb4V/8ARNPh/wD+Eb4c/wDlbR/wqb4V/wDRNPh/
/wCEb4c/+VtegUUAef8A/CpvhX/0TT4f/wDhG+HP/lbR/wAKm+Ff/RNPh/8A+Eb4c/8AlbXoFFAH
n/8Awqb4V/8ARNPh/wD+Eb4c/wDlbR/wqb4V/wDRNPh//wCEb4c/+VtegUUAef8A/CpvhX/0TT4f
/wDhG+HP/lbR/wAKm+Ff/RNPh/8A+Eb4c/8AlbXoFFAHn/8Awqb4V/8ARNPh/wD+Eb4c/wDlbR/w
qb4V/wDRNPh//wCEb4c/+VtegUUAef8A/CpvhX/0TT4f/wDhG+HP/lbR/wAKm+Ff/RNPh/8A+Eb4
c/8AlbXoFFAHn/8Awqb4V/8ARNPh/wD+Eb4c/wDlbR/wqb4V/wDRNPh//wCEb4c/+VtegUUAef8A
/CpvhX/0TT4f/wDhG+HP/lbR/wAKm+Ff/RNPh/8A+Eb4c/8AlbXoFFAGRovh/QfDdo9h4d0TSNAs
ZJ3unstF02y0u0e5kSOOS4e2sYYIWneOGKN5ihkZIo1ZiqKBr0UUAFZ+q6TpWuWE+la3pmn6xpl1
5X2nTtVsrbULC58iaO5h8+zu45rebybiGKeLzI28uaKOVMOisNCigDz/AP4VN8K/+iafD/8A8I3w
5/8AK2j/AIVN8K/+iafD/wD8I3w5/wDK2vQKKAPP/wDhU3wr/wCiafD/AP8ACN8Of/K2j/hU3wr/
AOiafD//AMI3w5/8ra9AooA8/wD+FTfCv/omnw//APCN8Of/ACto/wCFTfCv/omnw/8A/CN8Of8A
ytr0CigDz/8A4VN8K/8Aomnw/wD/AAjfDn/yto/4VN8K/wDomnw//wDCN8Of/K2vQKKAPP8A/hU3
wr/6Jp8P/wDwjfDn/wAraP8AhU3wr/6Jp8P/APwjfDn/AMra9AooA8//AOFTfCv/AKJp8P8A/wAI
3w5/8raP+FTfCv8A6Jp8P/8AwjfDn/ytr0CigDz/AP4VN8K/+iafD/8A8I3w5/8AK2j/AIVN8K/+
iafD/wD8I3w5/wDK2vQKKAPP/wDhU3wr/wCiafD/AP8ACN8Of/K2j/hU3wr/AOiafD//AMI3w5/8
ra9AooA5vQ/BvhDwxLPP4a8K+G/D091GsNzNoeh6XpMtxEjb0inksLW3eaNH+dUkZlVvmAB5rpKK
KACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAoooo
AKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigA
ooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACi
iigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKK
KACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAoooo
AKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigA
ooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACi
iigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKK
KACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAoooo
AKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigA
ooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACi
iigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKK
KACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAoooo
AKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigA
ooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACi
iigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKK
KACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAoooo
AKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigA
ooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACi
iigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKK
KACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAoooo
AKKKKACiiigAooooAKKKKACiiigD/9kAbh7wQiIAABhknG8c7SkzfqJ7Qi5Kn0L/iVBORw0KGgoA
AAANSUhEUgAAAZQAAADpCAIAAACMbFZcAAAAAXNSR0IArs4c6QAAAAlwSFlzAAAOxAAADsMB2mqY
3AAAIdZJREFUeF7tnU2oVtXbxl/foZqgJpKKH0h4HEiKJ7AG6RkkQdGgInRQaINjDiwQHZxy6MdA
EVIodaCCA0XUSQlxCiwHKqQoKJgD0SK/sBTEnPr+6npZ//3f+/nY+5z9PGev/Vxr8LD32vda617X
2s/lvdZzvO5xz58//x8XI2AEjEBsCPxvbA7bXyNgBIzAPwiYvPweGAEjECUCJq8ol81OGwEjYPIq
+R34/fffx40bd+DAgZL7dXdGwAj8NwLjfGBf+itx+vTpd95557fffps9e3bpnbtDI2AEhECbyIsg
oln58ssvDWJDBN5++23+STBz+fUwAh1FoJxt4/r16wk3gqO//vprkvJ27dqlR2ymqOdpckqQYIof
k13Jkppg8/rrrweDZL0MRKk///wzZtx+8MEH7OMaIojPx44dC4+S3aqSp0mCzvqpEf/6668wriaY
LHiIM8masKNsOPFnz56Feu89O/rqu/PoESBGyFOuX7+uqWaN2R9R//7774dHMv7iiy+o+e6777g+
evQo1/v37+eap8lOMMtWpkZRJ3yGDnfu3BmuVR/Kn3/+ifGnn35KDWPJjWx57bXXZEPRFNRnKBhQ
SW+ptnI41Gs4jaIJ/vTTT8km3KacxwyDhhNXDxcvXpSBLlyMgBHIIlBC5HXu3Dm+bydPnkyFVCK7
ZcuW8Xn16tWyaJ5NGd/wzZs3NxyOUa5du8bnkiVL+Ozr69u2bVt2aMKl8+fP79u3T3GZ3Lt582aw
vHTpEgbcXrhwoSzP6Qfn+RweHm7Wpx7NnTuXTzxfunRpiaO7KyNQJwRKIK89e/YoSDl79mwWGn35
2ZSViJq+0leuXGnY57x586hft25dM3bj6e3bt9VWtKXIDi5j16b6M2fO8Mm8Dh06VKLnof9mfYrr
d+/eXeKg7soI1BKB0ZIXBEGE8tlnn7EFO3z4cPLLuX37ds56+N0N4AYGBlrDt3DhwnCE1BboCRMm
YPPkyRNZMoTacrrELSfl2nzRJ8dtDfni/v374ib2lRhAW+JfBWLUnDp1ihkxr2YRZQsnV6xYIX+y
7ClOXLt2bWiemviHH36IJ0DHaZ2m42IEjEBDBEZLXoq2CKyWL18Oi4WjMSp1DMRxEt/Gjz/+uHXQ
EQ7Cpk6dWnSpwpkXPqjt4OAgJ02My+6y4dDyE27C4JdffuFaZ/PaOVLDXODEl19+mdtmIV4zP8OZ
F5vWYCOG5RNi1eZRJTVxmPfHH38EOkgTEsz+dlEUHNsbgboiMCrygo+ItuAIvnKLFy8GI0UWycKj
NWvW8FVM8too0RTFzJw5s0U/EBkswM8IDJ31ih5wW5vZoaEhrhctWiQq4VMHT9QQFvGIffEoHaY5
DKuTe/040KKMHz+e0y7tZBse2I3eGfdgBGqAwKjISxEKhZiC7zlwEMi0PdYZPWr6iUB005oFkhu0
pCX7xFdeeQVihd207dWfZUFqnOWza+N6zpw57E81Qc7vR+82fMoPmnSeZz9IdAZv6kcDFyNgBLII
jJa86DH80YCChVSYwymSojOx2+gLf/3E95+/vWj2V6CMyIGRzpsUSc2fPz85rg62VIklnwobITJI
Tb8whK2fAqVs7DayiUCmQEGs14ziOaTTn8XhJMylP6dwMQJGoEzy4utHnMWpdjil0qm8KIyiA3vi
F2Ic/uCT3ZDqwxF1OGJPVTY76NGxEXs6hli1alWYTDiw1x+LQmpwhEaBiaCh5NkTrR4+fMjnrFmz
RFuwiQz0S59+YXj11VfVP70xx0IRZTiwx4HUXMAKD2Glr7/+OosGxnhO9CfcCNP83xj8pTUCzRDw
/230u2EEjECUCIxq2xjljO20ETACtUDA5FWLZfQkjEDvIWDy6r0194yNQC0QMHnVYhk9CSPQewiY
vHpvzT1jI1ALBExetVhGT8II9B4CJq/eW3PP2AjUAgGTVy2W0ZMwAr2HgMmr99bcMzYCtUDA5FWL
ZfQkjEDvIWDy6r0194yNQC0QMHnVYhk9CSPQewiYvHpvzT1jI1ALBExetVhGT8II9B4CJq/eW3PP
2AjUAgGTVy2W0ZMwAr2HgMmr99bcMzYCtUDA5FWLZfQkjEDvIWDy6r0194yNQC0QMHnVYhk9CSPQ
ewi0Jy9S2pDMhoRj3QSHxGVKSuZiBIxAvREgDxnp/kaQKKsNeanH58+fDw4OcsEtREaiaWVFVOGa
GurXr1+ftCHzIMQHB/GIT5K50ly36jY01K1YkkKetCNHjpDpmmtahXou1IRORjDVer8Bnp0RiBQB
0sI/fvx4JM5DTC0KSQ/JWkieRGz45JqLixcvkp81tCLvoQySNjLmk7Sp1Idrav7++28cJZkrDekq
PFWl+iFZrIaQGXltKVzgT9KstfN+agSMQBQI8L0WURQqbSIvMtRv3boVKiGqunPnDgmliYb6+/sJ
i8SUREakUCU3vW6xUdJW8lErtyvJU/lcsmSJDCZOnEj2WYjp1q1bNKQrOqRbHuF9Ngm2zF78t3Ax
ffp02jbLlT0S8nYbI2AE4kSg/ZkXSZ4//PBD+GXmzJmKvFQ0X54SEP3888+6xUYZs69cuTJt2rQW
mEBDIfKit0WLFp05c4adZmhy9+5drufNm6fIKzlonFDbayNgBMpEoA15cU5PZPT999/DHYRXU6ZM
0bFUYCt8OXjw4NDQkA62BgYGqOF6z549VLb2lIYbNmxQQ4IpjrEI0/TjQF9f3969e7m+evUq9YRd
2R8N8IFKhiD640LHcHTF0RgXdKJzsS6YdXOsDk2wCyh1yPMs+GP1GpQ7wRq8VGEKDb+ho6excSGG
Gn1f7sEIGAEj0DUE2m8bu+aKBzICRsAI5EfA5JUfK1saASNQIQRMXhVaDLtiBIxAfgRMXvmxsqUR
MAIVQsDkVaHFsCtGwAjkR8DklR8rWxoBI1AhBExeFVoMu2IEjEB+BExe+bGypREwAhVCwORVocWw
K0bACORHwOSVHytbGgEjUCEETF4VWgy7YgSMQH4EOkVe/O/oLouv5p+zLY2AEagBAmWSFyoOQW0C
YRyEt2oAkKdgBIxANRFoT14j07D/5ptvkPrq0Jwd1nUIWHdrBLqMAAL2CJ1KFysp55fHjRI07BlS
Gvbbt29nSHS1pPmlbWNSmR5ZH2nY4y5OpyTt6UT9SJArKV3PreTzKZcuXUKsdd26dcrQkZTVp4mA
UA8uRsAIVBwBdEZRCUSYa8GCBYj3FfO2tWh0Hg37IHLPPpHdIsKnyEYjVK9bvAnK9Dt37jx69Cgj
ovjMBZ9JSXssaYiqPT2kpOu1CaVPecvt/v37dZGU1U+ZFdLDtrERMAJjiABf8CCYnNON0WrYwzgo
RC9btowLuBOJepTmFy5cOGHCBHTuuU0q01+4cGHx4sVYEmE9efKEiyBpTyDGLcrRc+fOpYeUdP2h
Q4fWrl2L+H2KmLOy+itXrsyaFaNzWxsBI9BdBEgYxhe86EFT+zOv1hr2zJFACVbi4tGjR0+fPlXc
JO5EgT6pTA/HoW2PJSHSpEmTWuCTkq5nYjQRwamI+xrK6ncXdo9mBIzAqBDgIOiPP/4ISXzy91WC
hv2OHTs4hFISICIpbiVFz/FTSpmeRB4nTpyQ8Py7777bwks1DNL1ks8nmpN8PrezZs3imrQdDWX1
6bnTEuAMUa5m+dj2VgMN+zFPZVDuCnb6Be4CXK1fKn39cYNEFps3b9aZfX7mwtIa9oXgsrERMAJV
QaD9trEqntoPI2AEjEACAZOXXwcjYASiRMDkFeWy2WkjYARMXn4HjIARiBIBk1eUy2anjYARMHn5
HTACRiBKBExeUS6bnTYCRsDk5XfACBiBKBEweUW5bHbaCBgBk5ffASNgBKJEwOQV5bLZaSNgBHqU
vPhfr/y/cS+/ETAC8SLQcfLif5ajD9ECoLYGDdvyf9D5/+htcYeksqqqSHBcvnx5/vz5FlxtC6AN
jEB1EWgtWigpVAo6h8ic5lQ4zGNGn0WFE5PdjrJ5Hg9tYwSMQBcQQAxZDBN0AHMO2j7ykuAycoCf
fPIJcoApaXndEj0RB0k/XjLzaKWiziOBeWUV0iMZK+RBrkv1Cs2CGj2i+BhI7Z7PZIQV+hGlNnNG
T6Wmr7GSEviEY8ETbDQQheukG8nbPFFedf+BsmdGoMIIkKxnZBr27clLs0b/b8aMGciibtu2jYiJ
wgW8gBAzAy9fvhylZjZiokxUA5Fy3r17Nzao4KsHic0Tyg0NDUk1kU5oKAO6QogVA1gGOUNqEJXm
FmFoybRSoM4VK1YQANKQWyTtmzkj+76+PphXnd+4cUMS+NwePnyYHhDLxxNu7969yyM09fEtuLF3
794tW7bgDLrStCoqUFvhV8WuGYHKIcAXjfQ9RcVU85KXvuR8wkpETBQuYCtqCLiIlaAY9FQDKgSB
qKEmQULylFuUoGmYBQ8SVHP6fPjwIRfIsfK5ZMmSYMwodAsliUpSOvdJZ1L903mQwEeoemBggB6W
Ll2KJw8ePICUkb1/6aWXHj9+nBLF37hx4/DwMMgmFagrt/J2yAhEjgBRCNFD0TTVecmLkIQvObLL
SNSHsyp4ZHBwENI5fvw4rHT27NkWGBJY8RSOoweZEe8Ee9Todb6GyD3RVsN+oBiSekBhopKUzn3S
mVRzda5WCFUTP3LN3hZPpk+fnjROieLDccA6efJkmkT+eth9I1BpBF544QUlpshf2pMXGRI5D+LL
zzYwJS2vIycG27RpE6ENP+Hp8IhwJusBCvc8gukOHjzIUxhw1apVu3btkiXREJ8Y7NmzR7u5bGF0
toFEZGxLecpnUuc+6UyqbVICn8hrzZo1tO3v79f+NFlkGU7EcE8+U5/VFKdhubLlY9JbDbTSwxS6
oMveabjq8VKFNzmPjL2ytRIlkOMiP3P9Qxc6Bup0YQ7sv/Cv0wO5fyNgBHoEgfaRV48A4WkaASMQ
FwJdirziAsXeGgEjUH0EHHlVf43soREwAg0QMHn5tTACRiBKBExeUS6bnTYCRsDk5XfACBiBKBEw
eUW5bHbaCBgBk5ffASNgBKJEwOQV5bLZaSNgBExefgeMgBGIEgGTV5TLZqeNgBEwefkdMAJGIEoE
eoi8+M/rzQRRUaQoqiUU5WrbaSNQIwTGkrwKpd4oZJxdINS7UMJpJoiK4A8yhy2WVUrWNVp3T8UI
xI9ATq37nGawAEXGpeTsAODR5OnI6XZbsy+++AK56rZmNjACRqAoAh1MwFGUn5HuI8wJrUK2C23N
lA7j2LFj0g4kokll7kjaN8zTEZJuEApl02do3GCj5IwtUnsoSQdF20YslUYkZPpIZQBJpfwoCo7t
jYARSCHQ8QQc+RGHRzds2IBYs5qgEw0TE7aQoeONN96Q1jPUgGy0Um8gDI14qSK1lH02TwfdKukG
aThIxoGQdDJ9RnASAsUgpPagvllqD1IiYUk/aCWKc5VGhMwg+geEmmvXrqnnMLryjzilUP63wpZG
oAUCHU/AkRN9UmYgr0zqCiXsUKgC0XCNzDyfcAQEEY6fEJVP9py0z45I0g2lz1BXaDon02cE++QB
Fjk1SEwiNedsag9ycCxcuBBVaNTx6Y0eXn31VT5DPEh96DaV8kO9uRgBIzBKBDqbgKOQc4Qt7LaU
JUhBEKlBxGXcQm1SrFeBLMjNAbmQ64yMPil7DJJ5Oki6QS4MmEVRUor4Qp8I6pO4DMb8/PPPyamx
c+dOhVEnTpxITYQcHCHVJW6Hp4oHibAwEKnxmU35UQgWGxsBI9AMgY4k4BgZ3CTX4JCbthAHoc3V
q1cJkThggrZgMUgqdMtejNwc3BIfQUkp+1SeDnJw8KMhiddIn8GuUJk4suXcuXOKmL766itGvHnz
pg62kodxagWTktGDRzodC4U8SfjDQO+99x69kb0RVk2l/MC4aykzujlW59JYdDp7Rec8zy50N8dq
ncZixKiO+Uulr1vVE3DkYUBO8cl9xBlZHuM8NuQ3g26gP6eMzQOXbYxAXAiM5d95CSkiL4VF7One
euutUuBTyjKYi1RpZq5SIHUnRqBqCDgBR9VWxP4YASOQC4Gxj7xyuWkjI2AEjMB/I2Dy8hthBIxA
lAiYvKJcNjttBIyAycvvgBEwAlEiYPKKctnstBEwAiYvvwNGwAhEiYDJK8pls9NGwAiYvPwOGAEj
ECUCJq8ol81OGwEjYPLyO2AEjECUCIwlefHfD4tihtqX5FVdjIAR6HEESiavpHpyEFPtcYg9fSNg
BFogIOF1RIeKMkbJ5IWLyHgh+4crx48f5zboxyPmlZSrR6+Gp5jht4KppCU1mpJCLclOoJmDGXLS
miq90afEgGjr98MIGIEYEaiQhr3gQ5lr1qxZ8A4qqXDZ3r17kTaFd6QQTxk/fjxmu3fvRlMQEdiU
JY8QWUZDFVFAVAAldorAIfWI30taHrFTFOjpmVtGcWqyGF9c+2wEFLig/amcFQVK0TxFre2V84JC
Gg5UAJHTSrqSSobGI3rDjIuUJXk6qFHmDoVyKiG1Gk+VyyOUkHKt3Bm5NyNgBLqAAErx+srnLx3Z
NhIoKTkF+vGwWPCGoOns2bMNmTVlGWwkWt9sM4zA/MWLF9V/YdouwPA2NQJGoLMIVEXDHqX5rVu3
rlu3DrYijYVOrNjWkRfj8uXLuk3lDYN6kpYBJ7oipJTMvFIrJsvBgwdJs6YjMOo7JPXdObXyEauP
d86lEavyV9Clou8Dr9CIp190rC7AVUGXsi88mNdBw76zxO7ejYARqBcC5W8b64WPZ2MEjEBFETB5
VXRh7JYRMAKtETB5+Q0xAkYgSgRMXlEum502AkbA5OV3wAgYgSgRMHlFuWx22ggYAZOX3wEjYASi
RMDkFeWy2WkjYARMXn4HjIARiBIBk1eUy2anjYARMHn5HTACRiBKBExeUS6bnTYCRqAS5KX/YV90
MVCbaCtAiNSqBCdcjIARqBkC5ZNXUG1uK80c2Gfq1KkSR420ZBV+Ip2I3TYC3UegKhr2hEJoPUu1
GZkehOqDbj0uck0hFKIQEyH8umLFCkn8KPIKxEc/Cpok/sV1wBRhQgkA0ZzKZjL2dIvNwoUL1TAI
5NM8KaXPiCJZRuSC3vikf8quXbvoAbeTjkluXwZBYp+aF198kR7C7Lr/BnhEIxApAiPWsP9HiLnE
snPnTskxS6OZT2oQeKVGMq9UovusEdF3RuWZCylBQ3koo3J9/fp1bpFI5RYZexrSSXASaVYNgag0
zYOYKvXqjUJbntIVNVxgL0FXXdBb6DDITOuCoeUDBnjL6NzSSpUUXeAelvJQMaMmlZxdiai6KyNQ
bwT46vHdKTrHkreNjx8/Fv2jjCqqIk3G6tWrCVL4hJ74zpOJQ3mAUuXWrVsDAwNsIfv6+nj09OnT
GTNmkKfjpZdeCt1Sv2/fPgRauViwYAGf58+f7+/vp3/qaaI+79+/v3LlSrqaPn06t3fu3CGLBxek
/0CfGpd027DIh0mTJqFMzej4MHHiREYhtqJwIYXradOmzZ07l9tkJy1m12w41xsBI0AKHmKUrFRy
a2RKJi82U2wbJTlPAiE+IRpFXhRchJiIEvfs2SObQDdcS66endelS5e4hTIauk6wA/vwiIxBfDaT
sR8eHmbTSuiEDTSkSPDKlSuQTlJKn1Fu3LjBo3v37jVDCicVcGkW4tZU0UCp2fmlNAJGICcCY69h
T8BFyCPJ+Zs3bxLpoFsfMtFCTLAbJ1nffvst4vRwGZxCjaZHzZo1a4huiKTYxE2YMKHhtHfs2EHc
pFALg5SMvZoQPUFS9EBXuuWTJpDm0NBQUkofM4oeNUOZWXAQhmMNdfRpBa+Rlo0zsuTs4tKnZxY1
kG+PC/PWMvZdELnvNFytX6rwdbOGfU5+t5kRMAI1QaDkbWNNUPE0jIARqDwCJq/KL5EdNAJGoBEC
Ji+/F0bACESJgMkrymWz00bACJi8/A4YASMQJQImryiXzU4bASNg8vI7YASMQJQImLyiXDY7bQSM
gMnL74ARMAJRImDyinLZ7LQRMAImL78DRsAIRIlAj5IXmoJF9TeiXF47bQTqi0AlyKtzGvYsnPRR
UyuImgUihUWXdWR+Fh3F9kbACORBoHzyqoiGfWtdeTTFUBzMA5DoT5k+YtfazzlfmxmBbiIwYg37
wtKrraVaJbssDXuiGyT60LpCeRks+JSSMgYUaT1TEFwNIrCSDKTQDwYhOOI6jCu16KSZbukk2CT7
oV79yCA5rrSk5Z50XyU6qGsK/bT2ExupQgcxa008NA+3QaK6qNat7Y1ALyDA11Py7vlLyeRVEQ37
pJy8QEnK5MNHsCq0hQg9LMOndpG0SiIoIlZlUms/dCX11BR5BSV+Cd7TM1SYfz1saQR6EAFr2P9H
wz4V9CKFyo4PJkImH9V5Ugohsnry5EmJUC9duhQxaCniowHLp3a+ZDZqGDyjYU9X6L6icJ810BBB
8J6hsSEwluy1ixEwAlkErGH/HBHqJC6KjJIFkiIa0q6Wsnz58oZvEjLTRGdI79+9e1cGSa19OAvi
C2SkUTjLv337Nhco8acE7wcHB+nw+PHjfmuNgBFohoA17P+DTNCVT4JFwIUEviT2lZCxYWHzS3R2
9epVUgfxS2VWa5+doDqhOX1yS6i1YcMGbonIkoL3CuKo37Rpk7T8xXQhGWUL5Xgsa6ArH6ZQdPo5
UeqmWTfH6gJcndawbw1X+OpZw35s/kmDg2DJ/D9cjo2XHtUI1BGB8v9Uoo4oeU5GwAhUDoFx+mHO
xQgYASMQFwKOvOJaL3trBIzA/yNg8vKrYASMQJQImLyiXDY7bQSMgMnL74ARMAJRImDyinLZ7LQR
MAImL78DRsAIRImAySvKZbPTRsAImLz8DhgBIxAlAiavKJfNThsBI2Dy8jtgBIxAlAiYvKJcNjtt
BIxAR8gLTRjUMLLgIi+DQIpBNwJGwAgEBEasYV8+eaHSd+PGjR9++AHn0CSCyMLFkSNHkPFTagwp
aiHlg72851OUR5PW6TO88EbACNQGAbLhIA+BlDEKeoUmVT55nTt3bmho6MSJE1k/PvroI6nCSwAL
fVGMkRhF0VS6plAbzLVy5cpgU2gyNjYCRiBGBPjWb9++PaWE3HYiJZPXs2fPoC1U4ZctW6Z0YS0K
Njy9cOHC6tWrCbX4RKB548aNw8PDTIau2npvAyNgBGqAQCU07H/55RdtDDdv3gwHoRnPFhJw7927
J4iDKnxAHApDLV6i8syBoIzPyZMnnzlzpgar4ikYASOQB4ERaNiXnPqMHIjKEkZaCqW6UFZErpU2
UdnGlNkQAWVqQmJH1aAfz4USNSqlIxf0SaWMw1N2oEr0VopZKZ2U69KIe+scSiN2qegKsqxdG6sL
cBWdfhdcKvrCd84l5V1NZsbJmfzNSqp5/lWwjREwApVDoOQzr8rNzw4ZASNQUwRMXjVdWE/LCNQd
AZNX3VfY8zMCNUXA5FXThfW0jEDdETB51X2FPT8jUFMETF41XVhPywjUHQGTV91X2PMzAjVFwORV
04X1tIxA3REwedV9hT0/I1BTBExeNV1YT8sI1B0Bk1fdV9jzMwI1RcDkVdOF9bSMQN0RGAPyQgxa
8qqFCk1oWKiJjY2AEagxAm3I6/Tp0wcOHKjx/D01I2AEqoAAVEMp5EmxyIveERqkaBjdJhVTmynT
I04voXoKUl8oFOpawZRE69Gz55Y+ZanJyOzYsWOYbdmyhWtFbVhin7zl2jxbaO1tbAQqggDfdETh
izpTgLzIlIHGKZpkFC4Y786dO9KeT47aUJn+0KFD8+fPl8bYhAkTsIfCkENDTZB+Hj16RP3evXuh
Jx49fPiQp4sWLaIr5Ax5tGrVKurXrl3L0Ghd48knn3yCPY9oC3vSkOvBwcGi87e9ETACY4sADID4
qFRIC5UC5HXr1q3z58+/+G/hAjJiJKIkqCQ5ZENleoTqk8xKppDx48fz+fjxYxhw3759xE39/f1I
SNMVCTh4ynDIqM6ePTt0zoiIRCOwKU+wpxVtnz59Cq+RVK2tan4haGxsBIxApxHgOwszoBpP4aJh
ysRmPhQgr3nz5iHVKu1mSl9fH5EO45H+J9t7Spme27NnzzZ0YubMmUhFB+HXYMNwyNinmFFPp0+f
jicoSqsVSUcou3fvJmtRp7F2/0bACJSIgDKHScydfZjyiuUs7clr3bp1Onj6/vvvOW8i7NLpkg6k
GGbTpk3ZwQiF4FQ1hE25vXz5sm4fPHiQtId3pkyZokfJ0ImYi+HmzJnT8DDr4MGDGzZs4BEBFwTH
BZMnkRo9U6MjOZwMWSPlqvJF6qCtymbxep5FNRbMW7wPFX9bir7J+mJW4euQk6SamVnDfpQAurkR
MAJjg0D7yGts/PKoRsAIGIGWCJi8/IIYASMQJQImryiXzU4bASNg8vI7YASMQJQImLyiXDY7bQSM
gMnL74ARMAJRImDyinLZ7LQRMAImL78DRsAIRImAySvKZbPTRsAImLz8DhgBIxAlAiavKJfNThsB
IxABeSE6WEgow4tqBIxALyBQdfK6dOnSmjVrCglljGDZ0Jngv+a3bih1hBF07iZGwAh0AoGSyat0
zfulS5e21UeV6k4n0En2CYGiOtTpUdy/EehNBDquYV8U1raa98EAjaGg/xWEvYK2PYpdEq0nPqKS
T+l/SfMer1AZo3lK2B6zIN3FBfbovtLJs2fP1HOW8mQWFMRkRkFEX9eMFXxWD0lppOTTZjL/RTG0
vRGoPQId17AvimBbzftggIL1ihUrUHOWpCqCimii6svPLayxY8cOrpF+Ri4V+fwTJ05IehF1VrQM
eYS+K5KMKWH7rMPS16cHlKbpIbsbpQcEWlHQP3z4MDtWpFyltU9XGzdu5BO2krI+9dn+2065KIa2
NwK1R6AbGvZFQWyreY/BwMAADIKiNJ1PnDgRSVUu0IyGp9C2J9cGcQ1kQUoO6lGvl6T9rl27qEfi
NekStJISts86LH19aGh4eBhOJATL9sBGFQV9HINMsz3gidzAJvu07ZSLYmh7I1BvBLqkYV8UxLaa
91Kph3SIcegcsiAVEBdk60CiHm17EopI35pQK4zOzu7UqVMEPoRpT548UT23kGBK2H7atGlITtP/
3bt3k85jSfA1efJkRg/12KgHnKEJjyBTKOzjjz+G6d58801ZwllkCQnK+oq/sL99+zYXbadcFEPb
G4F6IzAaDft/9mUlFnZ8AWsp6us2XFOTHE47MspP/5bQlo2k6Ek1bOWoIeShLfVcUKlcSdSwZ4R0
uMWGCyplGTqkkkfUK3uIGlITPNFYOBOacE2leqMcPXqUthou+KwOdStL7XkbTlk9y9swOn4KEDoh
VVLwWY61eJqzk+qYFZ1+dTwPS1NBl0aDavaVG5MJhu+gKKIQF1VIw54AkhiHmChQWEUuiMU4dEtG
f3KMrSvr3ek/46gICHbDCFQNgZL/VKJq0xuNP5yI6WdNEkSSqWg0XbmtETACpSNQocir9Lm5QyNg
BGqMgCOvGi+up2YE6oyAyavOq+u5GYEaI2DyqvHiempGoM4ImLzqvLqemxGoMQImrxovrqdmBOqM
wP8BJPaTYy6ChwYAAAAASUVORK5CYIIAbh7wIyoAADamMAYnllS2k1n2xT19Pwj/iVBORw0KGgoA
AAANSUhEUgAAAZMAAADlCAIAAAAZco1eAAAAAXNSR0IArs4c6QAAAAlwSFlzAAAOwwAADsQBiC4+
owAAKbdJREFUeF7tnV+oFdf599+8d9omYBoxJiEquTgKlShGaHpRE2hCocULUyRCI1aKfw6YgjQX
Wi/VXCgHai7UIFFqwSDRi5jeSMHWC1NQUUkhkSLG0JqKqYKmzWV/n7df3vWud82e2TN77zlnz8x3
LjazZ9as9azv88yz1sw567Mf+c9//vO/vFkBK2AFGqXA/26UtTbWClgBK/B/FHDmchxYASvQPAWc
uZrnM1tsBayAM5djwApYgeYp4MzVPJ/ZYitgBZy5HANWwAo0T4GizPXTn/70kUce+dOf/tS8btli
K2AFWq1A2TnXr3/9661btwYpfv/73yupffbZZ+yE7d133/33v/+tYvFx7VOeT6pSAUp+//vfJz+G
S1ottTtnBazAyBQom7lo8NChQySsni3v3LmT/2j99NNPjx07tn79+jgTcTxsq1atOnHixN69e8l3
1HPu3LmPP/54x44ds2fPHlmHXJEVsAIdUKBC5kKNn/zkJ1988UWeLIsXL3777bdPnTpFSsors3r1
6hdffPH48eNktz179pDyVqxY0QGd3UUrYAVGqUC1zPXaa69t37694OFu5cqVWPfRRx/l2cj0iuzG
tIu0xYSL2kbZG9dlBaxANxSolrm2bdvGlOp3v/tdQWLi1N27d0MBveHiZVY4wjPjli1bSF4kuO98
5zvd0Nm9tAJWYJQKVMtc8+bNI91s3ry5YFaVWKeXXB988MEorXZdVsAKdFuBapkLrX784x/zzMjb
+p666S3YxMREgaq85udyKuGt2T//+c9u6+/eWwErMIgClTMXjezevTuvqU8++YRT/K9DXgFSlV7M
Hz58mFf1U1NTg1jta6yAFei2AoNkLv6GSN7J6sa/azGN4h0W87I8VY8ePaoX87zh4h+7eNvl/3Tt
dgS691ZgEAUGyVy087Of/YwZU2iQBMRr+Jdeeol/1zp48GBsSPz/qJcvX37rrbcooxfzevDk/7n8
zDiI63yNFeiwAo+Yidph77vrVqCpCgw452pqd223FbACrVDAmasVbnQnrEDHFHDm6pjD3V0r0AoF
nLla4UZ3wgp0TAFnro453N21Aq1QwJmrFW50J6xAxxRw5uqYw91dK9AKBZy5WuFGd8IKdEwBZ66O
OdzdtQKtUMCZqxVudCesQMcUcObqmMPdXSvQCgWcuVrhRnfCCnRMAWeujjnc3bUCrVDAmasVbnQn
rEDHFHDm6pjD3V0r0AoFnLla4UZ3wgp0TAFnro453N21Aq1QwJmrFW50J6xAxxQom7n4XeutW7cC
led3yd599112+PExfv/1s88+ixXjK7+L0TEN3d1pUoDoin9yeIStEtLE8wgrdFV1K1A2c128eBFT
gNZ/61vf4pdi//Wvf/H7F/z+K78DVLeJrt8K1K3Apk2bCn6wqu7WO1u/5kBs+gEwfkmH6VHJISQ3
c1GXKmUORY38rg8/70pLpC3aWL9+PQ1wlmGQjR9YZJ9WOXX9+nVdyHGZolPsU5W+JjO1znrOHQ8K
hFAhPJjgK7o0taeMQnzJkiXsK96YfBFO7KsYBTjFQQWYylMs+VkpLuG4QpHCCm9VUvKGsctGpQBe
vnLlyldfffXRRx+dPXuWanft2vXcc8+9/PLLpZpgGlWwUS+18PnHP/6R31ikJPv81JguYefTTz/l
58toW0f4ykFmZBTe99+N3yjjOJ8c4QdiOVLcos92UwFFi/p+69YtgopIY1N0EVQKQoUcMUkZSnL2
0qVLxJt2OM6nynOWeAuRqa/UoCZ0igtVFcEZl+ymC2aq14iPX+Q+Nlwp5xZvuXMuvVN44oknivPf
nTt3+OXXeKY9MTExe/ZsPu/fv//nP/953bp1DGh8Yg1VrVy5slRCdaGOKUCo8DPD6vTNmzcJKmKP
jR2OvPrqq/xG57x581SAxPTss88ydeLsihUriDcG6q+//ppTfP32t79N+LG/YMGCMF9jSsXvEzO2
M8litOc4xbiQqvTV24wowG+wPnjwYNWqVf/4xz8YTshWb7755smTJ/sak5u5jh8//vOf/1yJUENT
z41gIkfm/U719773Pc252Pbs2dPXGhforAKEyvnz59X9RYsWac6lyOEIGYf8ksQhuYxihD4p7Ny5
c2SinurxDotKGFwpTxDOmTOHwp3Veaw6juOOHDkyOTmJVU8++eS9e/fKm5ebuXhHwBj49ttvkwg/
+eSTghrfe+89fqeaiVX27z7kvvC+zD9kXd4rHSxJqPDWQy+t+CsQMyMmXHpjxXxq7ty5HHzhhRcS
ZYhPDlJyw4YNzLaKddu/fz8VEtV5L+MJ0fASlmAOr9j053JFMjsDFKMXw1cyWpMGrm2A7mfbkqd4
scXbczyLsAsXLnz88cfZOXDgwNq1a/veAv6N674SuYAVsAJjp0DZ/4oYO8NtkBWwAh1WwJmrw853
161AYxVw5mqs62y4FeiwAs5cHXa+u24FGquAM1djXWfDrUCHFXDm6rDz3XUr0FgFnLka6zobbgU6
rIAzV4ed765bgcYq4Mw1MtfxL9p5q6BG1oYrsgJW4L8KVM5cLIkQUaT8xrqHMbmlBTMZnn0oNEqs
AKvqWDPMwtHysqik1lJUvaoL5a1MF7w8cB8rZ66BW6r1wvL5lHW5QggMsAnt1PNCqANwFsvXGbI5
y4C1qHjMNwGzQqrVAsNaOWtNUWbMHddW8wbPXAn7TXi2eDoG91nEwb179yJfAoELl7///vuBCq0d
7moR4Hj+Ev5NPIAYUiiWtJZ5c4pltCAPteRbNcezvLDqO3gx0Hu1E3PmQg0JbU7rb1ncq5pZLCou
XVyeU7KfjrNpia+AiwH/SD2UQRNgjVqIq4wQBFF+jNMEZ1WMOmtNFnlRjm0XLlyIz4riMAARN48g
iHTBTXJfUCagK6W2JEUK02nampVK9asfwCs9D4ANEljCfhPyLSm6ZcsW0do4RYEYAsdxjAv8MOHi
VJId6BSwccTzEjJRSMIYUqiDXKJWZBVfw04wRmgUqg2URE4Fkpx2Es5cjLULrBXNjPRV5VVh4N7J
YLhAuhyDqVzQO/WOLQgVKHfBKgkia3WQ8qEJuslXKs/qXNWDg5VPTJKkA1TVkyAoWCBKqpvsSEOJ
oMiRrxFQJQdo2pe0SYEB51wJ+w1KF5QSpjzxTAd+BdAl4kyYtxgCxyMbty5wuLzkumzZMtgXnOWR
QdylLKRQD33Lly+PKxHAhDGZGZ+Os8PdzuyAqgpyeeDMJV27e/duz6vAzlIhNXPhqVOnmIvJHvh2
UFk49dhjjz399NM8RT711FMc15SKeVbP2mhFtDzKZwv8/e9/R0wuh+hCWwW9mJ5TgpdCcGO+XLXF
hCAorTR3Q0k4J+wQNgIKsgkfSMfpPiIIH6i48tZlBQbJXDAME/YbkUfKmJqaAtQV1GSoJEz5KmBY
DIEj/qC7heQCfQm2KjF6+/btPGf0hRRila6FJMfDY8Aqkgu422krfrggrZAOKAwTKmkR22KsXfJA
lIUskrUFsNaAFridSbWYxMyCaWPoo25CbcFIfVUrCPL555+zQwbUZETbzMYrieZXv/qVbJg/f35V
YxKCIGFAN3kbQD0IolAhbHCBahY+UHMuNv/ORVXB21q+cuZaunTp6dOnmZjE7DfyAkMiD0fx2xCo
b9yuGiqRL4bAEX9cziRFr8Zef/11JiPF5OhiSCEVPvPMM3ozpTdE4e5iIoNhtKVJnDbekhw7doyS
165dS1zLZCruWnyW5xdM5e1VcgmsYdHRCuYgzFP4AQgYjUzBeHEDnJNHHsxQVcFIGU9t2Iwg27Zt
4yu9E3RNL4B6ot2G4d4VQOaycS9f60XeAH9LTQiCEAHpJlMqHgOZc2lqSdiAqwxNs48OeqfZ1vvQ
/aqqgMmCVRWrvTy3KCmy+Nm2diNmogGSL9RmU79nQvvmtVl5ztW8LtpiK2AFWqeA51ytc6k7ZAU6
oIDnXB1wsrtoBVqngDNX61zqDlmBDijgzNUBJ7uLVqB1Cjhztc6l7pAV6IACzlwdcLK7aAVap4Az
V+tc6g5ZgQ4oUDZzsXRGqAb+hVrYA9EaZgRd0AG/uIsjU4BAFeej0qbFDN7GVoGymevixYv0gYVj
LEyBJ8PCOpakQKQagHMytlrYMCtgBaZZgbBcj3aZFTE9KjnM5GauAEtiER8L5VhXyJoyZlukLdpY
v369mhSOSqisBFYlC0xTmuZQaGhzxcS0BNGlPuogsSdErWBwSRBqJenRo0e17JFIzqN96bbR4lAt
zldUK4xnlo/WUJ/2NTvhvm3fvr3vJf+vQDGyJ9CjWBArABZHAiIq4LRYPCy8QcLtCnipNoGB3Jc6
FOhLTIsRXTJAVC9R3mKGV0J/46uwPISryF89aV8xOExADmoWVy6Aw2aQj1aH5uNQZ6CwyZgQBn1t
y51zMTQx5hTzG0L+K4ZbmaZUYSRx0f+rQBJUCaJLpQQ1SxheHE/ob1A6OAjSg8882lcMDlPl1Pzd
736X8uPGR3OMoEBu5oIbB5CEQYZCWShVnnbFcCsrbgXyFCggpoE8K0Z0JQwvQEwx/S1pMa+qGByW
XDJWfDSHkBTIzVy8NQCTBFSL4QuqVEm9CuBWJWtwsW4qUEBMQ5C+iK64AHOlmP6W6JlXVQwOS34n
JeGjUWEB0awnPU0/OMCFNWHUihsdQ5OGD3KzIobX0DVYASsw3QqU/a+I6bbL7VkBK2AF8hVw5nJ0
WAEr0DwFnLma5zNbbAWsgDOXY8AKWIHmKeDM1Tyf2WIrYAWcuRwDVsAKNE8BZ67m+cwWWwEr4Mzl
GLACVqB5CjhzNc9nLbYYeAD/bt7iDrpro1JgjDKXCXCjcmpz64HKwCLq5tpvy6dNgTHKXNPW57Y2
FIPZAl5NgKpkC4Rb1t9xFevaxKICUCU0VbKJgstGtZyqRICrpPbBgwdZPl3pEhfupgKVM5cJcGMb
KDGY7ezZs8xfIEwdOHAgazBQpMcffxwE0sTEBMvpT506BQFGUCooC9k0d+XKFS6hQqrlbDUC3P9f
HVkyBvgF8OTly5eVHPW0mMf/65lYx9YjNqw+BSpnrqwpLLIHg7N3716G4o0bN77zzjvcA/fu3dP4
rA3I0dTU1J49e+ICPB6CoxAZ7vXXX6cYpBHdP8CSslVR+MKFCydPnoRIIfDY7NmzKUzNEOConApp
l+PYsGvXrvpUG8+agWsvX75ctr3xxhuAQEF9sGWthaaAXBy/fv06mpOYfvCDH/A1XB5fgsiaCoGp
EuIqbqiqFFiVuA+3/uEPf9i2bRukQAKJ5EgWy/O+PO7NCowgc5kAN4ZhxPyIEYXxgCSeN0/hQZIy
ejrri2Ajmzx48GDVqlVDdjYL8CN1fvPNN4xt8P/4lQMmgFDe8vh/Q7buy1ujQOXMZQJcI3z/1ltv
MbUB6Xn79m0Bc5ONTPS3v/0N8hTHKclXdpjvPPnkk9nCPOIdOXJkcnJy+L73BPjNmjUL4J9m32zk
x2KU4PBmuIamK1A5c5kAh8trAsUNQ4BLApE5F1MYYNwvv/wyz4ZMr3i7FMrQEE9nZDf9rsTatWuP
HTvGPq+9VqxYoVdO8UyNR29+P4UJEccT6l7VG6AnwI9nQJ5qFyxYoNde1NkXJVi1XZdvmQImC7bM
ob27Q7oh+/C6qmRvSWe//e1v/VKppFwuNv0KOHNNv+Yz0CKTxB/96EdMvsq0zR86eHc5/CutMm25
jBUYTAFnrsF081VWwArMpAKV33PNpLFu2wpYASvwXwWcuRwIVsAKNE8BZ67m+cwWWwEr4MzlGLAC
VqB5CjhzNc9nttgKWAFnLseAFbACzVNgujPXGKLj+Nn0eHF4eR8mQLHQNWrTT7GX2SoVLlOhyyQK
TA/3LTBU+uoPBoN/9O1bzAWKFZjuzNUFf/A/nCIxFGxhGU2ZwjMuWsLnIi9jP+vAoIPMuG1jYsCm
TZu0CNTbYAowwAhzFFaAjThzBWQd4cuaEsKXBljjpjgWeolPTgXEUrxiLlgTDGWHgxQObCaVEe5O
o1N8q2QBYWqUGlSMjZV3CeApWz/WYjOF4fPIAH2Np0uhs4LqhflR2IHQEvobuhYqie0Ruk92qsss
KlT9ajHuIwVUns8h1wkOFkbxVTg35nNhM2wc1kW/+eabEIeGr181NJH7FkJU0aXJnfxITGqHFaNJ
FAXFAqpM98uolGxoPeR9rbffsmXLL3/5y769qDznYo5A7eAHdMOzoJc0AVlpw4YNxLHO8gmrBMQS
zuNrdrkcWYNZCZWwsYNrWVVHSQauYDE39uHDh0FBBeoWtfWkTYn3dOPGDe4oaC3ss2w4ATxl66cq
mSd8cB5ZDB0pwwLmHTt2ZNU8ceIEZ6H00d9wFlgY+5gd20NHKEmPzp8/r8GZviNUKCyyWOgji5/5
OnfuXLAwfb1Ya4GEz/Xll1+yapoW58+ff//+/fqaHn/uWwjRxYsX41lJIT9eu3YNlhn3xbp16zjY
M4pAlcX3S31KNqhmUgF3E3r2tbly5tJTOj5T1WvWrCFzAdJkWRz3GH5inOETYgmIpbz5882bNzlL
JWzszJs3jzCl2vh9E14n3TBkAbRjakNbZKi7d+9mu7Ry5UoOUoxKtEiYESwBPGXrB34AcYXC5Ag+
s0AoNYSOfFKSAtmmH330UQ4So/Q3ORvbw6n9+/ejzObNm3u6JNtHwAmU7In66+vUOgrEfK6HDx/W
0URS5/hz30KIxpYrVp966imimoGnIIqS+2UaJB3/JsDJAcUsY2flzHX8+HGywKVLl6idCQ6zG6BO
jL2s5uX21hyEjZkUiKWeb74B1C1atIizTDpUmBRLjgNtGs9rOMhkDRjx008/zZSH5q5evUoo5AHC
VExsFmh5CeApWz8FNJ1hkOQzDwils5SkAPcS0yi+Mu+QuLqHL168qERD14LosT2k+9OnTyMXY28o
E8P8kj6W8dx0lon5XCRr5o+0jhRLly4dlRlN5L6FEO37vi+OIhQDmsZncr+MSsnm1sPoyDSizISL
PlbOXLwMYlThUWvnzp0gzKmCuZLedpHRwiM9sQ5iiUyklzVBTWKde5g5F49FTLj0bgvHs8N8G1hz
KEmdXHjmzBkeSDlIAbIYFeYBwshNzI/EkMKMGPDUs366oLdUTL6oPw8IxVnKUJICEK9InbJEdrLD
Vx5UeeRU10Kyju2hAIMwtjFthIrFhWRtgKVMxFRP0sck+Ibhdo0EJRbzueimRGDEeuWVV0Z1nzSL
+6ZehxDtC+GIo4jCzz//PH5J7hfdO1Q7De6ezrZKRiAd5/YRLrzMZlZEkUo4mPuz7x8KywjtMp1V
wFFUh+srz7nqMMJ1WgErYAUqKeA5VyW5XNgKWIGxUMBzrrFwg42wAlagkgLOXJXkcmErYAXGQgFn
rrFwg42wAlagkgLOXJXkcmErYAXGQgFnrrFwg42wAlagkgLOXJXkcmErYAXGQgFnrrFwg43ouAJj
yK0bc49UyFwitIx5f2yeFUgUmB6y4JCys+RWzBJvJRWokLm0NLq43oH5oiXNdTEr0EoFgAuACWhl
10p2amRkwZggSNvCpDHnEk1N7DTADOxrIqYdoF0vvfQSaywTahpmif8nqJ43K5Ao0ESyYEDFEtXc
L1o/D/CAmyU+xUHWZotbqfhPEJhCTnIJpxLiZnfiZGRkwZggSBpi1bFms+DQSFLC6X344YeJsgAk
QOUBCMxS00BrwXUx8bY7sThkT8efLEiccyMQ8EQ7kDhQB4zlf/3rXwEexKfQAbgbrBHYUNxHMXIS
+ghISzhf3Bqs7edUTNzsICh1BGTBhCAYohBS1bJlyzSMxDiqJEyz1DTcKeyfNytQRoHxJwtqfsRD
Bt0htsFbQ2oDXsaoH59SZ0EDLVy4kBQWIye/+eYbjpC/ICCB1aXLMXGzJ0ezjHTNLTMCsmBCEAxa
gEOD8MdX3ilCg8Mfd+7cYXAQLI3t66+/5tPUtOZGz4xY3kSyINQ2pkvQNBX8jOXceKLRJadiSWPk
5KxZsyBWAtQVYjNL3JwRX8xUo6MhC2YJgurP2rVrGVWEQFu9ejV4PMacAHdmrktG49qEmjZTWrjd
pijQRLLgvn37mC7B1wQbyTMKyEAGclE2k1OxF2LkJHM0CJcAdfXimBpi4iZXlcTy1V0MS8jIeklX
U1vUXAtZkAf4H/7wh1Dh++Ifm3Kr2E4rYAWaq0Cp/4pgPOE5HOKw01ZzPW3LrUCbFDBZsE3edF+s
QFcUKDXn6ooY7qcVsAINUcCZqyGOsplWwApECjhzORysgBVongLOXM3zmS22AlbAmcsxYAWsQPMU
cOZqns9ssRWwAoNnrkaw0FjAyT8l281dVqARfK4uO2iwvg+euQZrr6ar8tIoa19ZkFRTo92pNjBb
GAm++OILAVuEOeqOCDX1FCU7yIQIYmppur4K/kN0EWN91a6cuQhWkbZYU0rtCYdL9C4tOtUWCnAJ
1wb8EPcA/5qPrUIXwTbSzcAlXK4mdMNwlkqShrhQmDBNqTBm8+bNHKGYaEdhXwVUOVWxqlM3no5n
De4rWdcK4LUrV6589dVXrEiFxMIyPaSDynLt2rUyEVZSribyuQjgEEu6LzhCgLETcj1xiErFuDqW
/XI7lBSqTcXIBhcuXFCPUOD69essOwe5cfLkyb7drJy5YHJB5qKBw4cPU3vC4cIHHGdJdmiYAs89
95yWwhP9wg+xwp512kT/uXPnzpw5s2bNGlABuhnwPbiPX/ziF7pPuIpVRzBzssCvmN9EYbULWFJt
YcBf/vIX2EnBErIbMm3bto0F/RS4d+8eYmUN7itZ1wrAbxGxEzwLqCIWDLOBZ2GZcV9G7jBajT+f
C7RWiCXWTu/YseM3v/kNK6h3795Nx2FIEGZAU7gPi3F13BE8HAyjVUOvJZC2b98u47/88ks8zs78
+fPv37/ft0eVMxdDLuFLvcA6+Ew4XKSkXbt2sTA7NEwBzc7Ybt68SRriHlDEw8PRV9IWtXGHcDOo
5IoVK2AVTUxMsM9K+mxDHAn8pviZJQxupL+k88QQZ+EfvfDCC8y5Dh06hAFZg/tK1s0CTCXAsYUb
DC9PTU3VKsWY87myscSqXgZp7g5xmR999FE+IQ5yHxpXVyZUHj58WKaYylTOXHPmzGF44Uo1k3C4
SEmMzwcOHAjPERQ4f/68GgM/xCQLl3MbKPWUN7Qv8EuYQ0KEKSGDGNgjkcLijZDiOGhKzctI+VmD
y5vUnZK47MiRI5OTk+oyIxOj0WiX3zeOz5WNJaL6xo0bPFkr+HWDcLNwyxRHL08b3YmlvJ6S6PWs
xjPj0qVL+wpSOXPB5yI7MGdZt24dtSccLh77ebDnATCENQXwpd49AZzYsGEDD2jMeniO42tf+0KB
YuAXOeiZZ56hCfoMC58meAINj9BxK0B1eWDUizCOxwaPlkBUE8ZIvw+A5XqjF34EoA52UtCNGRZT
VPxFizSE68lcAZ1e3okFJZvI54pjCXfoOZFnRj0BoRIScbMQugXRyygL5I73vNPg0Lpjkl6XvImy
kcDjF3QzFOMd0SuvvNI3qMyK6CuRC1iBygqQI3gB4l9dqCxc6Qsqz7lK1+yCVsAKWIG6FPCcqy5l
Xa8VsAL1KeA5V33aumYrYAXqUsCZqy5lXa8VsAL1KeDMVZ+2rtkKWIG6FHDmqktZ12sFrEB9Cjhz
1aeta7YCVqAuBZy56lLW9c64Avx7ZzdXMs+48tNggDPXNIjsJmpXAHyFlhOEjdWs/P/6ACuZ9b/s
tVvsBoZToJbM1XHk0HAe8dUVFCiINBbwx8ySvpWS+zRBE26kb3kXGIkCMZ9LFWYHoZ4N5WYurY8L
HKuEhyWollaxqTGBtFhrqiNCDsUAIw4GSJaJdCPxepsqGYDPFUcaUrC4MoRrjIHjVE/iW0BoUZhA
Zbkr5CWt7NOcK1Si/BgvF41jPpnrtckpdfcl5nOFtIUjSrUrakLexnJQauFz586dMLC0qP3WrVt8
wocBugB6geNbtmyhhrCjSzgSwAwUECqLMsUt+mw3FQCvptjQThJvSSAFiUKkqbzClZ3XXnuNfQWq
gpZY1XGuVWFVQliGg+yLIqdqFeq6XF/D2RDqVKvLvQ2mQBA2+AU9yS19a8udczGSMFIxdQr5L+Fh
sbB74cKF4K4AzonABZzo7t27oXwWYMQpcB+lEqoLdV6BMnyuWCTCjwc94p4LobMRuiK7AUHkM0t8
05SKeVZPpYlkqgJ5wlNntgAxDzyDy6GeZElwnXfdIAIw22W2RSZBT6bPfavIzVzHjx8HzcGQEkat
vLpYE88QxNmrV6+SzlSMkSoLMOprjQt0VoGB+VxZuNW8efNIOhzXuC3OX3bjJmFsh1x6+/ZtnY2B
biQsbqGAmVMrDMaff/45O8S8njO0ddZrI+z4pk2bJCa+E1S2eMvNXLy0wrUgh5haw0EtqAWwDmcZ
fwAKAidiPyCHEhhWP2N8vrsKDMbnCpGWCAeYVDSxGM+blNm3b9+SJUuIbUi8PGHAGWcAxgwVY7bF
cyuzNr3eoja+Mo8D7sZX8DUALPUiWO/1S3KpZqRY3ViuAchiwwe6WRHDa+gaWq4A6YkUmTd3a3nn
x7V7tfxXxLh21nZZASvQEgU852qJI90NK9ApBTzn6pS73Vkr0BIFnLla4kh3wwp0SgFnrk652521
Ai1RwJmrJY50N6xApxRw5uqUu91ZK9ASBZy5WuJId8MKdEoBZ65OududtQItUaD2zGVWV0siZdTd
YMEzq1JGXavr64oCtWeuaRAyMOGmoa1uNhFQVqzRYxGy0Gxbt24dOWfNruxmgA3Q68qZq5gAFywI
YEIdidGDrM8k6LValdsgBrax8JWSwhYCEdftweUJoTDmGsZMuAH670v6KkB6unLlCgv3WJB89uxZ
lijjI9gJ165dCyiFvpWEAtQm74uMFAMsE1eGmBG6T18JnvJtuWSLFaicubJaAMMhjmHrhDgmOsEe
gRARNgwc+L179+BXEHzAJ44ePQpKSUQLluAnFZ47d+7MmTNr1qwBe6Lbg8DduHHjO++8Q3nqIdaB
gkGhgMDD+v7FixdDs4AJByWjxX6awa7Bezl48CDrjYFSwWAAk8AG9ArEAuJXNezDDz+EsoArQS9w
LZx44fqIHxBJwZU8Sypm8Du0JiKHpguQNVXNcPmmKzCCzJUQB1GEFAZkh7DW8voLFy7E6EESmb72
3GDmcBVpCwQS9wy3x507d0hVINwYcsG5CaIUuIZNd0BT7L98+fKDBw/CD1KQTaampgYwnikbOYgL
8a9m0wnAUnUm6L7t27cz3SN/jfz5dIAu+JJxUKBy5iogwIX+BCqb4oyHuxg9CBb1/PnzKjxr1iw+
A7CtpyKA4gLMl1GXAT9bLGbCjYOsLbMBBx05cmRyclL9AnrF2APBaoBuzpkz5+LFi1z48OFDPrMA
S7kyQfcxmDG/5lqm5AM06kvap0DlzFVMgJNAgcqmh8GlS5fyGdCDPF3y3kTvuXjoiIFtefoWEwoD
E24AwlndpLcxNEmvljRgsKO3SAU6cJYZFrNdsfp4jlu3bh2Zi/0B/ji4du1aJt1cSyUa1WKAZXBl
gu7TS09K9hy32ndbukd9FTDlpq9ELmAFrMDYKVB5zjV2PbBBVsAKdE8BZ67u+dw9tgLNV8CZq/k+
dA+sQPcUcObqns/dYyvQfAWcuZrvQ/fACnRPAWeu7vncPbYCzVfAmav5PnQPrED3FHDm6p7P3WMr
0HwFhspc/Dc2S8kSEbygv/lRMZM9GJjbJdBIMF0rIvnaM0rzeqh1BTPZf7ddToHKmSsEBPWz/pbl
GuUacikrMDMKlInSwAVjgSRrY2fG0E62ykCloSLgj1gQVoZllJu5YnAS9eJaYZWWLFly6tQpTaz4
1CgndhIbRIGgf8JX6qRf3OmyCiTcrgBxI+pCHCvktLFkMsyPwg6oHE4R+lqMqa1nlAZWIndOzAVT
0HKV7ig2bgSN1voa11y2by6XowAiA5LRSQAzIK0YNiBcsbK1r2a5mSsGJyl0BNWCugXBRqQkqFjy
8fXr12FpcXDFihVqMuEr9bXDBTquQMLtAuKmCOSTkTIWh0i7devW5s2b2UlE27JlizBwLBEPp3pG
KTQ3SnKKhmLEGzgd3UU8TEANI9ohzdHQ7du3+Txx4oSoJ95GogDr5yU4G16AcIXvbty4wU7f+nMz
VxactHLlyp7VgVIC/wDZJj6b8JX62uECHVcg4XYx6gKTEFKCPBWLQ6QBI2H4vHnzZiIazEKOgFFK
kh0HkyjVlIqs1FN2ahYnTuhEwDtw4mh3/vz59+/f77inauo+owUTICWyMiyj3MyVBScFixl/YutB
KTEQxcg3RqeEr1RTb11taxRIuF1kHyY4Aucm71KJNKKc3LRo0SK6H8PdwKhyhKxHXmMnDtQkSgHm
MJ+iiVAmRrxRMzcPNevtB+zM1ug8th1h6JqYmGC0YJaNa/ramZu5EnBSqIhRCMAu4xWjlg4KpSR4
Ey8F4G2ROBO+Ul87XKDjCiTcLmbx4U1r8r6WSFuwYAGDpTBwTzzxxLZt26QeL0oIQjLd7t27Ofv8
888HglgSpfv27eONLXcLkykeLwIXTPVw7YYNG6gZEi9PlAlzvCfXrCr1rCQcbUaKoUDd3LpstDNW
MefCfQcOHChgJocLzefqeMZoUve5jckm/ttfk3xWm62V/yuiNktcsRWwAlagrAKec5VVyuWsgBUY
HwU85xofX9gSK2AFyirgzFVWKZezAlZgfBRw5hofX9gSK2AFyirgzFVWKZezAlZgfBRw5hofX9gS
K2AFyirgzFVWKZezAlZgfBRw5hofX9gSK2AFyiowM5lLkJyyNrpcGxUYmCDYRjHcp8oKzEzmkpkx
pLCy4b5gGhUINCtW59EsC57BZoWFq9NoSLWmHGDV9GpU6cqZKyDfmDexar8YwCZOW5YAJ4nAUQRI
YahH9wNXcW+w6lsIimwNnGKLF343SvYmGYsLrly5AqyKRc5nz57F9MBUGqAbWYKgoH24m1PkGrmV
r6RLBYN22BROnNLO+++/z9kYYJkgAOMAG8BUXzLOClTOXJDYhBhkI5oLAGyE1KuvvlqwPvaNN94Q
pBAqjupRhXqQZL04vMQE+xWk/Pjjj997771Lly4ZJ113eOGCgwcPgh8BcYVDae6DDz5Yvnz5YO1m
CYJkLmIA3AinNm7cSNjwlRaz9QOx4RRACMwAhAK6KwuwjBGAIcAwfjBrfdXYKlA5cwE/CgyKYgAb
IzNDNIGYZVcmclAPmQgMABs7d+/epQDUi2LV5s6du3DhQsqPrbhtMgxS1YMHD2AnDdmpLEFw2bJl
1MlUi1N4ExxNXhMKPLg08+bNw/vsZwGWRgAO6aCmXF45c5FQzp8/r+4VA9gY6JgQQYwjIikcE+D4
qnQmrhv1vPjii0y4NJUTiDLeZs2ala2hKRK3wE58d+TIkcnJyeH7kiUIXr16lWp5FF26dClhoFdp
bI899hiJiR2eVfPa7QuwTCiYw9vvGsZEgcqZC+QbkaRfE4C4VgBg279/P2UYJxlFEwKc6IMBUkhq
Y2rGhIvyAQUXC8QDS1JDIl9NILSO4+KCyGDdDx06JHjkkH8UTgiCfOXZUz9asXr1at4A7Nixg684
lFnYsWPH2OfxMO9uKQZYZimYY3LX2YzhFTDlZngNXYMVsALTrUDlOdd0G+j2rIAVsAIZBZy5HBRW
wAo0TwFnrub5zBZbASvgzOUYsAJWoHkKOHM1z2e22ApYAWcux4AVsALNU8CZq3k+s8VWwAo4czkG
rIAVaJ4ClTNXwCqFpfzN67QtbqkCw/+Lf0uFaWG3KmeuoMGmTZsKFse2UKoOd6lZfC5juZoSqsPE
1YCZi+AQG0tAJVaZsfAwYWxJvixlSTwmPodcAdcU9zTdztHyufLUMPet6XFS1f4h42rAzMVaVpZA
y1bIJFNTU5s3b84ytnp2ZmJiAiAElBKAOVV76/LTr8Bo+Vx59pv7Nv2endkWh4yrATNX3GfogM8+
+2xPxlZPaRYsWMDxgdF0Myt3Z1sfFZ8rT0Bz37oZWgPH1SCZC8JcVuU8xlYZylI3fdagXo+Qz5XX
a3PfGhQPozJ1mLiqnLnAv50+fTrg30IfmHb1ZGwVU5aqArBoriYUF+/jsJ/6q5okRj7v+8rbNp1t
DS8X/Rohnysv6DvFfQsBMEDwDO/Q0TZaPuyD5SEGhokr87lGNX64HitgBaZPgcpzrukzzS1ZAStg
BXIUcOZyaFgBK9A8BZy5muczW2wFrMD/AIWEP4ctJgwwAAAAAElFTkSuQmCCAG4e8AtRAAByi57L
GEC919qgVMVwqCqV/4lQTkcNChoKAAAADUlIRFIAAAGGAAAA9wgCAAAAlutkYgAAAAFzUkdCAK7O
HOkAAAAJcEhZcwAADsMAAA7EAYguPqMAAFCfSURBVHhe7Z0N0F7lWefzAdHQElsoBAoVsNvVKkyI
lFVqB1CXDrPtMi6tSIQyyLBQ65TOUjJjSh1wBKtLywxhprR1BjJWBSPJFlKcWJapYEs/AiZZspaI
sWmtfEhLEJAo+dpf+HevXl73+Xo+3ud9nue9zrzzznnOuT+u+3/f5zr3Oef63//5Bw4cmJdbIpAI
JALjgcCC8TAjrUgEEoFE4CAC6ZJyHCQCicAYIZAuaYw6I01JBBKBdEljNwY+85nPzJ8//7777hs7
y9KgRGDmEUiXNPMYd67h5Zdfvvbaa9esWfP5z3/+3e9+N/uds2bCRGBKEJjf8MWNe7Vv5U033XTB
BRf86I/+6JQ0PZuRCCQC44dAD7OklStXnnDCCQ8++KBagcMK2+OPP/7tb3/713/913XcUpKYx5D3
vve9Os7Nn+nA9773PZ+dgxwhJbnssSUkoHCqKOvlCA87et4hgcyjHKsRk8hrZt91113WEdRLLlXt
Nx3XRnZrCw0JBmguQ5mWmNaVHS1j7HgJCKfI+PGPf1zlvP3tb7dnN3b4aUYKBNrbay+M3/BLixKB
iEC7S/rLv/xLZlLf+ta33v/+95P77LPP9hcwp2z7iZ/4iauvvnrr1q3ffXXjKlVKrigeQ378x39c
5Xzxi180B/GRj3yEg9/4xjd+93d/98orr6zsHyUg14UXXnjUUUepOo6Q+NOf/rR+XnHFFT7vo48+
ip3vfOc7OYUlzz77LHnN7BUrVpgBzSOCWijhiCOOoDT/cocHK2v1jTfeiMOizDvvvJODtPTee+9t
LrYOkA9/+MPr168HIsq59NJLKcq851e+8pU77rijrtguvZBjPxGYDAT8aA77aoBckrb3vOc9HNG1
p7M+Cxc/R0jTfFCXnBLLJbGxw08OUh07uuZ9FVRqx0uXxBHcEwnkRLDhjDPO+Jd/+RcV/sgjj5j/
Upkk0FmrN7Rdx1WaLxDDvBk6q6o9UKE0g84a7lESIGXJugdgp05Zvd4dd+yF0p48kgiMJwLtsyTv
WZl38POxxx7zB23/yCOPxBGsW7fOTyi++tWvkoDHFktW+TbqueeeqyzTDh5++OHNCewsMyBsOP/8
8w877DAdfOtb38r/L3zhC76ET37ykx0LlP3MU+QLyu24447j4K233lo+AJaJ6wBR4aeccoplOeus
s9i3SvFizJta53eVvdC9pZkyEZhdBHpzSUuWLAnm6sWHeZyPfexjJODKsdc3//iP/8iRY489tqGd
vBz51Kc+xcSEy6ku2YsvvsipY445phWvb37zm6Txpso34acs7wc/+EFejfm3Xc3FyiG+9NJLSkYD
1XCV8PM///PMaCj/DW94Q+vH+zpA5KoowSxRpU8//bSO/Nqv/RpeiUfj0tTWXmgFLRMkAmOCQG8u
6Tvf+Q5285LbrNfc7+6779YRbux664SLIVnrLZ1XSFxOzGLI0vDNm3JWr17NFEzzncE37MQDrlq1
avv27X2UZu+SNJHB5d122216tMRb8Yq6jzK7ZLnhhhtwfLfccktIPGAvdKk60yQCo0GgB5fEUwkv
XzFLzyl1G89lXJ9EDJBg7dq1Smzzi5ALv6CXSrwUrysQn4V3YybCu157Fmsw4KSTTuLsCy+8YGn0
CUyvZmxjusGzmJ86NZSpp6elS5c2pOENOu6YBMy/GnxxHSC8/iev0NBWTgz5gMB7K9x96+AIvdCa
PhMkAmOCQFeXxLPVRz/6Ua5hpip4h1briWAiza5du/Ry5OGHH7Ys4XLlYY1JByX/0R/9UWWxmgLw
YatjSBTJMFLeU9umTZv4rxmNbaq3tSEkwKNRGmXiEZrTU7V8cWUcgPLWAcJnfs7693TMPcuJ4cUX
X8zBLmaTxnqhY/pMlgjMOgLtLonv33q20s359ttvb5iqWDSNLi1+6irlAU1xNPgjpifhhcu73vUu
pjAEAVhU0YC48AyIj7MaefHMW5jzzjsvFEu9+obYsOFc+DZPaRRSl4zm8O6MWSSJeSWEy2jwnnWA
4Ogxhi/9ctkYzwyOhgS0+akXdg1b2QsD4pnZE4HRIdDwITAYwSMDjxWWvjSRpxs2u8h98I6fj+B9
eMAJQQB65CGv/xauKiotDHFJ9iXePtv7GvV4qHJCmSrHt0vJFASgDYMri9VZxTFocqTE+qgfNsFi
B0tAOGXBXwaF0pfxAVSqmKyeeqGhr/NUIjAmCDQRSkbnF7OmRCARSAReRaD9wS2BSgQSgURgZAik
SxoZ1FlRIpAItCOQLqkdo0yRCCQCI0MgXdLIoM6KEoFEoB2BdEntGGWKRCARGBkC6ZJGBnVWlAgk
Au0IpEtqxyhTJAKJwMgQSJc0MqizokQgEWhHIF1SO0aZIhFIBEaGQLqkkUGdFSUCiUA7AumS2jHK
FIlAIjAyBNIljQzqrCgRSATaERiaS2JBjO7rxkoyqN26+hTNJbC+R6UU0iA1Zt5EIBEYAQJDc0kj
sNVXwXodrJ9dVykrxrF2R8NK3mRkjcqUkx1xr2V1iUArArWLkzAN4bL/xCc+wZphzGhYi54Fz1qL
a0jA8mavec1rWHiodW3GQWrpnpc10lifiMUqu2fJlIlAIjDTCDTNklhGkgUVbc1WPQ2x4a2kVcuT
mhet5adXo0XfUdqteDSSaR1bVqeUYKwe3ExUVnl5+rMqrOXkNd1apjaWjIUcsY0SlEu1sElul5+m
jssR0nj7PaxmQ6u4yEx3RpafCCQCTS6JBVvRicUrPfnkkyDFCq2sO8c0BxEOfrKwIWu/siA3yWx5
Q37yxKSlGlGmveaaazjFQves2aplFTnFbEvLJOIC0LBlRUd+spwuGoqsJyt1SaowV6gV+zlLRegI
XXbZZTgRisU26coiDCsD7r///ptvvhlxWn4iOWcLwl5++eU8ynn7TXDNbEB+kkq7CLHloEkEEoGZ
Q6DJJb3xjW/kCmeuhKfAAiYyzDUkW7Rt27b3ve99OAvO+jcyuKFyAsLC20HWUWlQNGPBad74vPnN
b+anVEz4KSGQ3bt3K1kQj8MYyahRu0ScpPmB40OVhLokxMRK3qZ6ctppp5X2mw0UiHra2972No7g
5mYO6yw5EUgEWhFoeb3NzMJWiWZOhISsFsnGffBKSBMfL1iCs8AX4LaYKyHxiHcgPetSa57FxmTH
bMKVMEtiNrRjxw5mQK997WsrzcUP4n14D7Vs2TLVZat6MwsLWVj6muq0irCXRSFZsJ8jSOxiA1Xb
2ttj8p6rtdsyQSIwrQi0f3HjOUtr3fOGG4Uy9EW47CUxxjcvXI+X0JCUKxuOCT01fBYSbEgnMRNZ
vHgxz3pMRiQcwkbJuBh8DY6Mhyx2KlGWei0bMzJcmB7rmAdJZShsqEWiEaIXUkGdKdiPM2IahYQR
no5Zkt6RTWs3Z7sSgUlBYMhyALqq8TX4Cx7oBvxIJxB5n820iAkRL8vxbvmNbFLGVtqZCPSBQPss
qddCNYVh6vGzP/uzveatS6+JD/95gTWsMrOcRCARGEMEhjxLGsMWpkmJQCIwQQi0uKQb1x0UrT24
zUcXcd617zmopp1bIpAIJAIzhMDwH9xmyNAsNhEYPQK8Es1QtRHD3uKSbly/7ft/6w7uHHbRnf5v
xLYOUh3v3e1L3yDljCyvDCbunLf7oVKO6/sgkWLs8NafI+XnQk71YS3VdWREk6y0jZAORc+Hz519
WKIstHGUVETP1oZ+QBRuM1Oyj3ZV4talHHUNBIaRfRru29QuzalL08Ms6eU/XjFITSPOK9oKG1fI
sC6PoTeh1VESiR6iT7lpE2BBeBdfM4m0Iuicb5FXXHHFUD5u9tTAu+++uwzj2rRpE4UQFEZEW0+l
hcTmGs4666zZ+sZKhC3A9teKBs9eiVv3WiAw1EXwdS+kIaUfkwOa2p89TS6JCVF/hY5JLmKmuDYY
0+zIJDHy/I5IeWECxZ257kakiYk2LcYiihwzfIoil+YIWjtF+5rU6BHAKHicYl+RpX5WYrMMsXa0
qTqR+EjPkUsuuYRiiSAlzksmiXioGtlExxE3UG3xdoonyFk/AZGdis4P6e2nJ+KQWE1WLTIPYhDh
YxRlzESjIso2soiWyCYKJMfNVCuTIwSLqWky0uznBhMqLc3jiO5JlGC3eu0YX1L3KuvNMAZCdfpJ
Fu0wVbEqhLAvmf3Pfvaz9A6nPENTcBkIHhAbQpVtCV0juDRF1Y7wtL62+3EYxjIek0IC+0m7bEya
qUZcFUShLhulHjGbtlfO3y1L5U6nWRLzI02RbKe50HE7+/rXv77SJLCGlIfb6ulmSKQoWQiVIiyT
biMEnJ+i+1ELlBRNYRiRcOtIBpmGBASFEsRwxx134CLlKEnAWdwl9yIzD9aeOHpyo0wQeHBQMDo/
4fFwnABUsmAzO8Sdm8+lcKg5Sqz4VfhARJZSSGknwauctQkIDynYKYKhLjbfLkYbnEGKtacYGqjY
fTaoPJxiNkcDyY6F2IYxXC0cpzmiIso2doh33bBhA0wAqEJgRcAqHUGL1OqHHnpIMz41LdiDJaIu
+kpL87CfqF3hXHY9U0vqpacee+zg1xv24Rjg6202rSuZ7Fad0MBUcICnuWLFChKDHkaysfPMM89A
UaCoO++8k24lWgV8hFhomuEmQKAuNEMdugZwykbRm7fffjvtwpJgmN1FDCWM9JaTHjcEAhhz4YUX
2pi0LoZVKsTWrFmDMb4uw9YGjCHWtxPo5JL47qZPb7bTd32jzMgg457AgLjgggsq6+W5g5Burhy/
+Bw/udUruqry1SbXGKURdUXfMO6ZFJCS2YrowQxZC2dn5s8cm4uH40Sx85+LltFMev6LmhM2LhJK
4KCIe2w291H5DRuF+7kVKXl6Ovnkkyvt5MLwz1ZPP/009RrBMLSLkH0cFqPNuNDeDDVt+fLl/iDG
nHrqqRzhpgr3kJ3TTz9dCURsxB/RRrCCSslBzZg0Byw37FHTuIzFQ/SVlubJqdU9s8MToF7hzMY+
UACItY7qxJSkUlWn2jEVAqYepSEViB3Jxg7HOUtRxx57LAG9vgl1TRMgrVCHrqkbAFh14oknYkkw
zGibhhJjzFtOemgVdQ/auFoSM5JpGh0nIqrVZcaUHdQwUJtPdXNJr77kpiC96laJ4/9qSQ9uuCTB
zYUBqYUdLvKdO3eqFYxdJgvMdwwm0nNnFo2u8tUm9zQSc8lBjuOi0qTJJjLNcOPIuIsqsWYoulxt
Y0Kn1zGi7KginCC3YqrTgKjbKJwpRuXZLnbidLgmRUIM6cEBa7GNCU5zA+0sxmzZsoWfIBmI05Ul
rF+/nqoB0wAJdEhxLSkzvFzjYKV5zNTwI2vXriU91xWd7omWtNSo4OwzU8Dj615CvTTfmJJ+Dust
hy/l2ZFlo1QdE8CyaT5xF6h91yhv2SgrMxhm7/sMJVJ6y0lPt/r3rX5M4mpJzOQIAElW9xqLVvgO
osfFLdu8eXPHAWPJOrkkpZ7oV0tw2RgZXO34KW5rWpFSrxI4Egi6HkTutHpxYJumRQx3psp4NPyF
3kd0WeeXSZm9jaKPyX788ceT1wYEEzqFqjONUo1Yzh0bm3nSabCTlBTOCJAxYX7Xaic3QEY50wet
iBDS6z5Pk7u/RKchXMzkorTzzjuveVziBZhiUDuTIHiUJMYF8xBBvcooujWlrV692t8/dLY0T+9B
OMW7f8ph2guAZgNtpC5mryIYsM+ciyuKWxeDgdkE1fE8JSS5GiuNJzHTRrEjy4+5OAKe5TlFOaFp
obRWqEPXKHvZKCu2zjCPkrdc6UFADSnHJE/KIEZL+f6oRTXKLXQQU2Oe8ijQVuNoHgD+bA/R28El
jf8sqTsKDSnxIE899RQjQGn4yS1rtr4BDaVFc7wQHsxvuOEGzR1w3FxpesOV25gg0MMsSe+27W9M
GjCjZmh633qTn1EbsvBEYE4h0MMsaU7hko1NBBKBWUGgh1nSrNiXlSYCicCcQiBd0pzq7mzsjCPA
W+QuHzpm3I5XK2ilB4zGjJ5qSZfUE1y1ifuIUh28Yj6UNIz+YdHNKuOzLA6+eyvq4rx6KqF7YqXk
mhwZI4zqwJwPppXxmb1aPpT0fEa0yMy6AptH0VDM6KmQdEk9wfXvEnseU38sM31mZrOv3f1bU+Qc
Ft2s0iTFlA/R2ukoisimujimGW1gnVu57bbbhk4bbmjI4HcdCp9ml1QyephTGLPcdowM5bG2vCYb
J6aVZwMZj8mzzEShMmKXfjZw2cVIIHqFki1kSekDmaiSjiebPX9NRzzdzCcQQcyIeHV0M8+fsgLl
PcVlU42cUmMxlfgd0axCY61RdabKvGbCl8UHedaeJ2p51p5X+qNwqC1mduAYWo8b8Y28NuEV596f
CkS2QCo0e0ryY3kZi7Ymw+iUYFgApKQE+mHJPpFrxF758KhATFN/sdGoMMzMNj+KaEuvtD7NRsVM
HMT/Tq1LKhk9UJPothAAXUmG8pwpCD7EvDEjIGibxJ4NZDwmzzILxC7CF4kDZMQ0rEbAfYy4J8Ig
RX/DQ5GeMerJRA10vJK/xoCgTKOblfwjEfGIS6ykmzVMi4xqRzyhJQMTjCf61ICyQcmDDJiDPI0i
PQ81gRJohVQSvrB8+/btmEq9CtIz1l5JMTPWnin9MUcgC/GQMrvkGFrtnoZ25plnKhCZVpDXn+Kg
J7J5UiH28JNmwhOiyZWdEoBVHD9VEGIeyI+kbKYE+mFJbDqMELrbqJrATgJgBzqiWLhb0NHsizgZ
hpmsKg3uldbnmYnpkioQ8IwekaoUHRci4j0ZytYhsryMMwY6oavcXgjaJnsDG0iDPhC7qI7JvOdP
VfYWjhK6hm7CPs7YyESVdDwVVfLsQhUl/8iIeJV0s0oLG6h2XFRyoAaU+X0ApO0Yr8cHPFegBFpd
lYQvLMenewkcY+2VFDOx9mSJjzLX2gZitNVxDD0NTeOEyxingNmBoeaJbJ5UiF+AkkLfiXzX0FJr
MsuMsE/D4cSVhjVQAsU7K9G2ktFAJAENJzAdq8JtuBxmlaNoEFpfuqQKBDyjh1sEI1XMAHwEN152
iMlWNiNDscNdi9FseSEoQvCBBi1WGtyOwAYy2pSK6pXYpVzYxk2SIciTIFcg1XHQM7yUrKTjcZDR
1spfC/yj1uFSSQprptqBmAfKPALehEsCxyRGKw8gzZTA0BZZXsn1raOYyZK6Z4eSY4hVJQ1NKl74
62aGmicVwgXDJ2pCx9baUuoVjZFXftyNKg2r6ynxzmxYCm3vd+BykkDkfjamRbSFBW2YMZ1zzjnl
MOsyiqiildZXOW5bx1tIMLUPbp7RAzdHerZMbrl1cMkx64EtBRaeDGXQ+LwQ2Xgk0TN/YAMZj8m+
6TQTu5iFlS+VRCWncMYN41gXA3MxrZthWyUdjzs/6RnNzTy7ZoJYOWICf0q0r1aqnQfKyhRrjImD
RPpaTQ2EL/0kL/gHL9NAMcMSeHDqstC6wDHUWYoKNDQQ42bDo2J5yhfoSYUMKrpDpvK+JjQEr2qv
w6wErQmBr6ecSsMaLuaANgwnfLcpG3InYBSJtqbXmtxKuTewIVIfhlnHUSSgGmh9JAjMxF6dkdJn
9HZ/uGWuRKA3BLgh4eOMtspP5oDdacy9VVaTmgcFXNWsfBPsbv/UzpK6Q5ApE4GZRkAfN+po9DNd
O7MkfTfkQUFrYIzzlrOkce6dtC0RmHMI5CxpznV5NjgRGGcE0iWNc+/8wDZm/uXL2skwPa1MBHpB
YPpdkpiHlYJofD6YIQLUgJH1pX4WHzv4MqKg6v62walM/fHFFOSdWyLQEYHpd0kCohRE4yCfTls/
eXgiW0dMB08m/axA4yZsqtRNG7yuLCERGCsEptYltQqiKSJJsyRj9/B8FCSovCBXHanKerSZz1WS
6TxjzmhNOogr9CpvxlHieCWfSxFPJQ+OFol6BklFCUomWkOB3kKye75YKMrIbtTYUU5urK6ENGZc
EDB1jSnbgUBEwCGNIlRPUiW2EWVLzKROEWDGZtJs7OignYUoJEEuYmGl6yCxEOmLWYAsCRRvbXwu
K5YoW0qQPJY3Q6JJVgLWmioG6SnHslCXLFRRnLKMFsVLApLJVL9xXM1Rq0N6pawrUFQvs5CfslDN
CUWRUhWRxhrCT5WgqgMmUzbksjlDQWBqZ0ndBdE6SlDVkars3tLM5yqVxUr9LKM1hfsV8f6BGub5
XJ7rVMrSkVE6HJKTq+NGVRZI+sDp83yxsihV1JOc3LjcmdOOsUFgal1Sd0G0VgkqEdlaCT6tfC4j
06n3S/2sclSYolYlNaxklpU8OOYm+AhKlvxcJRPN6g0Flpw+b2FdUQPKyY3NpZGGzA4CU+uSugui
NUtQGZGNaVczwaeZz1WS6QJjrux/U9TCNdSx2DzXqZIHB4FAyr1ayaCSiearbuD0BQvriupJTo5v
izP00XN2rqesdWAE5nT0thYwa/3oNjDIWUAikAh0RWBqZ0mtADBx4FlGrz9ySwQSgTFBYE7Pksak
D9KMRCARMARaXNKN6/7/qj2E4B6Yd+17TknsEoFEIBGYOQTm7oPbzGGaJScCiUDfCLTMkg676M6G
ol/+4xV9VzzrGVleluUcFcs3/htvvgjRHFAAh0K6t1cCBF2W+6pDki+ALFAJtixEPRSEB1z2TNIP
V155ZXcQBjGbUH4WloW0NEghs5h3QLT7tnyaZ0nQGoQLY1ELb/ttDJXIBmfG9j0OBslYh+TGjRuv
uuqqAf3R4GJ5oWmtUouDQEFeY1yzcvHE+aPB0ZY0E1vf0oRNLql5ijRgz810dm7dROJoNT94DE8/
/TQ7nstmSmTd5dJKm4MaV6B9tapxBdJcqcYVSHM+vRkT1MS87lg4RRavg+Z1uzzNLTQzSIzxk0L8
SimVSGI58xGWl2YnaIoZG65SLEw6ulo5m/1exfJK80q2Y9Dyq1Nn45ZGaYaG8QdLQIzT57XMaELQ
/hMUvoNC4WRhRJmScCkpbPKCXjNu2qQJG2gpi3/1T/QX0tQdHwrDZViFSOcDZyRKGqyrwGWTspjm
8JC8SE8yY7R1NAPamtS4ROwKtC+jrVGs+HGkIQtsOBG+PGmOs1LjsqoDaS6Q7EivlIFTpoNi9nWn
m3mamxHfxJijELWR/xICs6qVshJJ2aDmCBa12vqF49Yj4gzKBmu+SHm+R0Q/NHuAS0xGDgor0QaD
eSXbkWLFf9SOeocSSCnEfHsDGiUgJcgyQIVbr6l1GmZWlzXWQyRqoQdWyWx4hDJJ75tTsil9XusO
dsR/FG5lM7ugbfbbjuFvIFtDNE5ar7VOD258d/N/Mz3BGUr5TIvEDoVOwb2F/w1ctma5NNN3qzTM
q3GVtK8GNS7km0gvhRJ2kHsM5QfSXCDZWfrAKfO6Yz3RzURzK9sYJMYYUrxjQoSjEg1D0k/iaB3L
TkO4IVBe2j4WDlaKhTUIxqnMZrG80ryS7VhaHtTZpB3Cf/k4Nq+jFwApQfbl02teRpDm+7qUUtpz
BlGQGrTS5og0YTeXtH7bje5PGI35u22GJiufc92ynoY0cDrKmZU0MdN3q7wIvRpXM4MsZGd0apak
O4zWQvJqXIE0F0h2tnaS55QF3bEB6WYi9wWJMepFRRbJqQb9Xt9S8eZ4l8eFh3RP3fVmWUrBuJ7E
8krzSrZjqeXnDa6TVLOBERKUIHsNPjEZvYxgOYoqISLLzp07A5K8nKI5HJxiacJOLqnyUhzzg4xs
RgNeScqueKVjjjkGm7n7cTmh81VpfyVNzFK2qnG1Msh8pYipBtJcUOMKpDk0wipJdp5TRku9JFlP
dLMACLUvW7aMGWKQGOPVG29DNmzYUDmlqkQVnh3LFTAZRFCvVaUjCMb1KpZXmleyHYOWX7C5UlLN
D4yQIIActMxAycsISs+u3AJEPDQBV1ATmQvShAevUO7PHZ1LeNs95rOkjo3qNdk4qHH1anOmTwQm
CIEeZkn4IP83QY0clqmzq8Y1rFZkOYnAOCPQwyxpnJuRtiUCicB0INDDLGk6GpytSAQSgXFGIF3S
OPfOtNkWNFdmt3kpjTe7+NfVPrUuqXX0KzC677B3AVpHASmF2Jq7f3AqCSX0qvJGeoUXj2wjTGym
+Rzd2wLTJXzSKvO2jqLu1TWkHLz3GwovQ8D7s3lGjfQmTa1LasX91ltvJZT2mmuuaU3ZRwIJsfWR
cbqzENA0IHO4D3zq3AqUYGhofRTYX5aRXdLBvDHkcjYDOP0uqZIXxrf8devWESzDPcTThTzVi5mO
uEuK3ibghcRB5c3A9cQlE2IzjhszMhUVaFNBZK3SVA4qr8Rmxf8SlyqIrBFUbbyqLiJrRPRt375d
BWqG5Vlv1jTj8VEdDdG8ktBHEvtTHAxsQdOeI3GguVW21Go0Zh+GsR8M84BU9lHgoHk5PFUhHpy6
g1gzM0a94xl2ZlJgI2qJZDbFCongHTD3aHCqJDB26X1ru2xWN7HjITJanCznJ2mMSGgMxEqsGliZ
anuzDmCpG9ifv/53uUqWynQcEdOnjhdGG3mCIKqtpCCBjig/7DCN0rOGWEIq06u8BVaaacZJbc04
bpW0KSMZyZiS8qaOkAG4j9CWUgZOhD7Z30VkTfQxShYbrllkTSJx4qmJomV0PNOPo2pjMJnZNEG5
OMVOQ0tt4JlunTApFfFkSV0fBbRLzpe6kuxKKbOtUpkhhl3lKJImXWAsiijHgFG3SubP0AgsM1Xh
Jfbqet8PMA0qs43yNSrU4+VPtdEzEMvxXMfKtL5o1gEsdQMH9x5TPkuq44WZVy4pSJ7qRagx5AMp
oJ1wwgkNdwDPLPPJxHELrChL4EXWGihvCkAPbSll4AgHZ5aO/Urp9d2osVJkjaZRMv937doFBzCo
xclOTRDOPvts9knMeiObNm3iyZSnHn9KiY3jRmmENZOeg7t378YeYqaJXWZy2kruIwuKLLKZjKVh
AkQ1ln1Uh7bBztxQqi0rV65Elsq/3qpk2JUSfqKtLVmyBJaSIuafeeaZEvOS8efHRpfeN14bs7ly
+FE10eHqcfWOfipxua58iVUDK1PVNesAlrqBDddIx1PT7JIYbXW8MEOnCwXJQ8ko5ArhyObNm3Uc
VlpglpXQ19GmvMhaJeXNFxXa0iADt3Tp0iGKrHH1cnNmNiGuGc8jvIbT4iThlLdWjEJdG4sXL8Ye
o5u3dgpZpDqHcyEjRVXK2NUN8RJtk8NTFlywZhBsEBi5rnjmxed+6EMfKhl25SiqrLcBc0vvCYwc
7NL7OD7x2iC14eBwfDhNI/0BLw9WeHkgpUD7af661Qu0sjKbdQBLQmhrja0JptYlQZVav349d49W
8bUuFCTDkQtyzZo13GC3bt3KQW7XXJaBWVaCXkmbIpkXWWPu0GqqT9AsA9dFZI3x7U1leFWqxfF0
wwQHPj1zAZwv9XJtgAN5w6myNKZFYMWsipYyzdQLDlkOh8tefHAwLC2g+RrY0pA6w+oGd0Db5PCM
J8xCTpCx9eaFy5hPb1zVlHbLLbcEhl3HUSRLmhmOgcDYsfc9r4338fhNcLOGAy+o4l5FnbOf3emH
razMBh3AZkJoq+upS5DR231DlxmHhgAva5966imtiss2K0vE4pu4pAdfTXhooDQWFBYXnqxVm5sh
mtpZ0mhGRtYyOAL4AtaoPu+88wYvqr8SNBPBH/Gaf/QxCv3ZPMW5cpY0xZ2bTUsEJg+BnCVNXp+l
xYnAFCOQLulg546GNzDFwyiblggMC4E555JMzsEjyEcZPupXhn50AdpLzXRJX5mG1xm95lU8d6+5
Mn0iMM4IzDmXZOpagXME/ap7NMc492jalghMNAJT65KChJlRfsQC85wjSynhsCC+RnpicDwFzGt7
ieRF2I4GQSVHrK7A/kTWAq9N8TWyPPCVJnpcpvFzFoGpdUlcqxAsFKGr6Q9xdwTFiXwETV/sIYJ3
CZNj6kQyLmyFzCnjjh07iCFmh2BlonvxLARG8tO+E8Mm5es1kSwqE2fh0/shVVlgaeHNN99MUcTU
lUUR+M9ZYvxohcKgFcVDpLKoXoQdX3bZZZjKT8wQWzW3RGDiEJhal1Sqa5WUH/UWV3jQ7RIxLVCr
SrYRUnE4KTwUZIIyvR8KlQX2IbJW8to0QcMM/pd8pYkbjmlwIjC1LqlBwsx6XZwjCERSN2XzIu6B
WuXZRlYCsyReiku3q5WKFRL0IbLWwGvDgFa+Ug73RGD8EZhal9QgYaZeMc5RHQEtUKs820glQAeH
7UXUL5x7frZSsUKCPkTWeuK1aUmd8R+CaWEi4BHI6O0cD4lAIjBGCEztLGmMME5TEoFEoDMC6ZI6
Q5UJE4FEYOYRSJc08xhnDYlAItAZgep3SY9e/9vNJZx2/XWdq8iEiUAikAh0RqBy+e5HrrueP536
9LyDbstv5ZHB1wCf9RJYKwfMtIi9Fl2f0I1WaG3/YL80ArSYP+vGkkxryIdkZCzzNkARBBEGB41g
Ucrsu5xy8f/+ijK4bDn9/sqxXH2MK+k1EKHSU48MYmcfRg5SXWXeTg9urZOmzg5wpAlZO1WLmbbq
R8LGIDCaa5Xv9BMhwUajPK8lwEr8JMvmhoMbN25kJX/i11l2Vp6IkAL+j7RL6iuzFhkJcXYNM7gG
0UHzK0z0Pa4OP/zwsjeHCI4ne/Zt5BDtiTdJ+a0wSwrToomYJUnJh1uceWLuvQCndelNdlVppFEh
PR92uDtph00COLpva0caPppSWTJ2JJtDIZU3eZPBIC++T4kpRIlVkQSCZCc/taMwTjPe22ayRbLN
hgWF8FPzPtlpZ22HsyqTvNYK3ZANDZCps1OaRTJMZngLrUxvodXCQW+ttIlkqo4Lk4b+Upd5xR6b
+pGdppFAfcR/PwZ8S63f1SNUp4arRWaPoaQd9YjXL5I6lqqzjBpXSu/HVUOlfspgfae8KpYENmXT
hFedW4KvojxKoXesLcgoyUipgbFDc9jsIOWEuoY+LQoFdpolYR8TpcmaKzEXIBbR+GjGGuOewArn
tAiZCrAg1hFiB/1B33OLYJakcSntDX/lqJO0Pfvsswxi1oon3pKOZ2NHsjkw0XwIuM9F95OLvKhN
lHw0UfBIL6IccgPQRLABskugvGEkyajUxFqJIGeheBJryBIXzinoe3JVkOn4SRvZZ0feirNQZEjM
ou498eZkZ1g1IVjIT+g41G4WUouwwkhMJW5eoiNcBqtWrfItCoTByv5iSXyaQH8ZvPfeey9aBhSo
i1lNlgHiLZYtJQ2sRtKQkewkYMDQQWhAEiVvcAklKM30mjTvfJ/avmiMqpSN49u2bdNTpB9XDZWa
WkHgTgLOySefHCplpLGSPyOqkhGpxIZS2TvIRummgoySkT1t8DM4NVZRvsAYX1dl24d7sJNLOu26
63ifPVmvtBEm80hxhXAtcYShg1NgR7psy5cvrwTUa3uVCSqF1WC6eQ24Mhdx3lzJdXw0o+DJTuRA
KBCPyX6dwppVwWimarjEfunoUmStsqW98uYqqYLBQrkYdEfsMgt6eTyJeKW20rDm/sKvQYT2oiYI
qAhYWDv8r5RyCy0lzamnnkpiVnqQqhJW0UGmg+atUkc0bKIxVsrA+VxdKg3cybpKvWRepQCfoRR6
x0vslYXrzoqrAgr4CSJdNQvSzYJLGm6VoymNccYdyV64SFaMqrds2dI6vEjmtb0YqdxVOIiKhjc+
6JG1tovbjpa+J2VPfLRK9pyIddoYPcwFuP79KnQNImuhFdz/zXeEVnSxk1FbWsgsDAPWrl2rAoNe
Hlm8UpvS+BY19xfOl/WtVq9ebWZDVNQ7shdffJH/lcJ5gSFIGgYDiRkYyPM1dx++nuvzkksuofvO
OeecUlJN2Stl4HzJHSv13EmyI4THfwbzzp07SzvryJWGUkjgJfZUmheYkyAdkyOqY2DM6GusSsy7
zZIm8JM/N2q6X2JhTP4ZT7SffcYxTwrN44+zXtuLt8UMQeX1GUs9MjtLj0ojzKeHCsdEiQdGbGvV
z/IZS/YcT0AsTmKv7bGEBwTmfdLz0tYgsla2QiJrkpP3W6udUrIDaq8Bpwka5VxzzTUqDQu9Xh4D
3Su1kSC0qLm/uN/wzLVhwwYTLLvgggtwB1TKcy6lVfIWA0OQLDxSyc5WfRS6kusTv892//33l5Jq
amaQgSsl5LpUGriTFMsth/5lMH/wgx8sh24dudJQCgn0UxJ7ECErBeYYq1RHlzFdCjWC/MyuZVr5
ssq/3i4TTMTr7aG8hNN9278f7V4s8397B0yucfi82t34mU454Jf+mTavoXxesvjX6rNoybRW3TRL
+sz8BZV/VxzYX7rqKTsyoLYXtxFuaLly7tSMCmZJzA6YVjB9qJyqTE1LZ70huRLArHdBGpAIJAI/
QKDTu6QELBFIBBKB0SCQLmk0OGctiUAi0AmB4bgkXp3wpN2pwn+fiG9h5VeePsrJLIlAIjAdCNS6
JBPn0ZfC6WhttiIRSATGHIGWWRIfGmH0KJDHnBRTG/9T0xziNcRxlf+SohmbQhgko8Z/AvP1MctS
wndln0kWYW8W/GrSaWMOX5qXCCQCw0Wg/cFNsfZiQhGUQZAOMWP4HX6K8kecLgm06gUBXYT544ZI
Q0rSk0wh1KL/EK6+cuVKKZGJAGW8U6ITibfmCKfgrMMYGG5Ts7REIBEYfwRaXBLzF2LbCeGFH0Rj
FNMJBUYR6Aqx1QYnizAcYtVhkEGiIQ0pJd0hTpn4RDAz4Fta0C1HxDUjphnfRwCugnqJwTW25PiD
mBYmAonAsBBocUlMZ5588kl0X+EHUSWzHsWMEjjPT1vEIFiDY2LSZEHPcG0sAafguNet9QMvQQRx
o1MPq51ZTiKQCEwEAi0uiekMUyQevpgl8VDGrEeUMY7z1GY/Q1OZPS1btkz8skCHgV/D2cpTFAID
iCmV3jTx1mkiEEwjE4FEYIgIZPT2EMHMohKBRGBQBNpfbw9aQ+ZPBBKBRKAzAumSOkOVCROBRGDm
EUiXNPMYZw2JQCLQGYGWd0k3rnvsxvXbfGnXnn/yte85+Lktt0QgEUgEho5A0yzpsIvuDP6I6jnC
8aHbkQUmArOCAFyC/vhS4hvMis3TXWm1Szo4OVr3mLX85T9eoT87kl6pdVh4eawyMWcnK8qBsIwG
5bhWNIaSoBnS1ipwPeJC+Y0lcbUaeq8bC7lJUcZvQgnuVNm5uDB/sEtbSN8fm73XtoxV+hqXtH6b
zY/wRDgg+aDglcbZMdGd5fijCeNwaY3VCCivqF7N8wKKveYdZXoTrfRjgHX+60Summ2jNFbgrkzD
ytal5MSsqDZOStd4GNtfb4+z3+kyoGHwsiloU3GbBGpyw8Rn6bg8F/+NGKx11DliTGPSGyWYLKz2
35A9WKUFUsvgT1QGrHaoy56lrHp9pdhWOUmxwknAYqzBKrGdaQ4FigjNT+1IcUj7Ijl7cKwJ2CDD
dMSntzRE0sKd1izAoGNfGWkalqsE7VCmhAyAUbPFuo5QFTwfKQEKa/wM6VWRX+LGEmi2YiYJ7YYx
YHBRowaDYGejdX7CIrkH677Kcej7XR2KMc1tsXI0HhghAs0bY2loi7oDMFWXZEW0r/FgXUMuG1RW
gh/eNoWsnEt2udCGlabdJammjdf+Ao9yk+ievDCelzAsxR2lDkhjpRDJZebVEKWHo4X9SVOX3bNn
BB23R3IR+/7QQw/5bhOHGdIfg8DLQHpdxkqJxND3I1OsBAHJXt56662eFG0CigYduHl5QjJ6m5E8
W79+PRfME088gcBJK5JIgXLt1SGPJcb9Vi0UqPQIK3mTJFrpxwB5aQspaZfeKEk4E60nr0xZKlmi
20Euug8vWd4qaD6TL9/vptrY3BbZH6QlG8YAvC4oX/DYpVULqkG60rqmi9jnsHzKgOV0dUln/uTS
8lX3gHWPLHspjMcwwu+IEAPRVyxiqQOySSGyVEM0gxH/a8ge2qXFWHBw4TiqNQxcrklq9zKQXpex
UiKxLGc0ipVcq5USht4eQSd4TZ4waIFhLSs9ILvGRYuOayuSVCo9S7jZcjG+43gZxLzAXlGramHo
e7NysEHtDmNAFQXYSyVLJjtUiqtqGMOV/d7cFpUWpCUbxgBUdslkMZAEcildqTK7iH2O7Hpsrqir
SxoTc4diBouo0IWtoolBDRGHxb0U5yIhttbsmIqvYa7OvUuK9VrmxTZTmmQwBRlI02WslEgMIIxM
sZInoDpSdGia4A3yhF4ZkaKYnnBVd+kIitI8S2qUAXn6gimtafOpwNaPaJLDquvEAHupZMk0CuOZ
n1KIV8S0n3X93twW61kvLdllDFjGUrrSuqZZ7LNOP3UoV1xPhXR1SZP4yFYJhEkYtoomBjVEbozc
4iiTuToXW2t2aS4yI2DZFm5lPBUywfYm8clGSpM8I3gZSK/LGCQSZ1exMuhHWltMQJEVI+wgTyhe
njAoI4ItU1ccE+lbkaQokNR8NqSnUzhO4f7jFwXioThe97mqdQwE2EslS+5PrJ+DYaz2hfa3tRpL
rr76an7SwMp+b2iLFRKkJStlMusu8iBdaV3TKvZZp5/akzcZSuLqUElFAPgnNX1381X6r29DMWVS
CuHFMHceLVw3+o3L7A//8A9NIY6fN9xwQ/kCa/SGZY2JwFAQqJ4lEZ/dHKI9B/2RbshsvAE599xz
h4J+r4WkYmWviGX6iUOghVBS+bw2B/3RxPVrGpwITCgCLe+SSu+T/mhCezrNTgQmAoFcwm0iuimN
TATmCgJdv7jNFTw6tHNk4a2VFU0iRaADqJkkEfg+AjlLGruhwBt0vlITX1NpmcJwZ+t739iBlQZN
HQJTO0vyzCBRloheI66HHeNtiW8VmFmeb+X5U+ITiaVltDj2SU/5kiBXLEwlKypUaj8Dw84zsMqK
PJW8JF5N3eDMBs1JBEyhaMp2CD5Ep1dqvQSwQQUi8hi6AxMQuE6KQoYBRDStpJ+kdmnhvCQgGekF
CxFx/NQ+O/wkrxXCDj+lkal9CjTNKMvlK9VB0igleTHYpKKUN1RErDD2iLUkLl6oYsp6MJszNxGY
2llSYAYRTUv8NBHVeiCCQMt/wpHhQ7HjmVmV/ClCconxZ0YDWVR3Lp6eCClmh2KlnSmNzOXLl/O/
ZEWFSrUUjidJGcMu3BmpqJJZVlnFnLyrZqOnCoGpdUmBGcQjG3SHzZs3ayVAsaVwW0yLrD9LvpXx
p7Sqzutf/3qExZUejUzNhrZs2VIujlOyokKln/3sZyEKVJKkSOlpU1QUmGViLVVWMVVjMxszJxGY
WpcUmEFwiyBeQH1ivgMbVvMOpjnwoXy/e76V50+J1U16o5hLfJyDq1evNs6nFVWyojjlKyUBpZUk
KZIZA0ulUSNzOgWO8waK9Sjg8bLjq2DCFSQ85+RgzkZPAwJz8Ysb1zNPYf2tJdh3n89KpX1bmxkT
gdlCYGpnSbMFaNabCCQCgyAwF2dJg+CVeROBRGBGEah2SRsefbSh1v962mkzalMWnggkAnMWgaYH
N1wPf59/9FHt2M85C1Y2PBFIBGYagTn3Lklh01LIGMqGmMRMfO3qovM1FPtnsRAFZ7EkXgCwTvCq
1dTWvmhWRhPmsqeOySjtkCH2eNB3a23jhCborkk3tS6pbliz5DPRQNdcc80gXeu5r9DN/OLzgxQ7
lXlbx+Lhhx8e9AJKHETlacVnKH0he0z0zVeKDcg6EDU2YI/7+82s6Lu1IjmLCdpd0qdnaUXXYYHi
ddy4xUmUgrHlRaw8za1OHkuRQaKweeUy3TODfhaFiPIW5C1NS8vujdrxKnKh4ZUycJ7gZtpqBFLZ
NEE7bJIA076awCwgSKGFGsXj0yZ9NMvLTitWpPdybwSFgnnwKV6nTLX77uAnC5yTpRSYK0XfDGcR
EkOrrWmhxkpBOo+D+k7+VFCwL5mZSy65xLdRDEfDmfTaV400ATw9pZFyaN3ZZ5+tPlLJMt4A94PW
W+WJlhw3gTwySrBP7IIgnBdaETrIyp+hQdUr8i0uiffcV746KCd38zpu3EVFc+NG5zXa+CntNgUr
lfJYRG8bAW3btm0mj0UINYwzsgT9LI4Qq0mxDD5Tji+1tDyqUpHrKANnymKUKW01BiuBl2U3QXbB
DFqEGxWPD43WUjqtzEgu0nMRYr+wYmPnmWeeacbKTJLc2/ve9z5RBW1tg6BTxowDMZjQHQpYp1GU
0Ky+ZzizHrn6gk2ttrlMqDFYGNpOLqZIEn1je/LJJykKpqQ6nbYwrylhtxrxv5dffjmJiX2jCYTU
QhKQKpx034j1F2VSczqTBZQe35o1a7DWD1ozDzRgRIneWG5SoLNF2UMC34q65s/EoOoJednc4pKm
4+NaqeMWNNqI5xbNTaCU8li2rgADrnJAlPpZTP4ZHxRrtLhSS8sXVcdxq5QDM4JbSbUL5jGIMYP2
chmogZUadmWjyEV67CcvVwjjlY2dpUuXNmNVR8qzKoJOGcfL7jASoge80vISZwpUq+tqbLXQo4HQ
CEUde+yxu3btsuMl7L5GBOywSqpzYj6WlEZfhby8yd5JVbActEa0DDJNKkoKdHWbb0Ura3KIgyr0
dRfk2x/cGto5uaeCRlvruwxJ3XKXgxOnEROUy0r9rEpwTEuLAcdA5Brj9lUHY4MMnBHcAtVuyZIl
9DoFwubzxaq9mq91kU4jGZ6U9HgE8tJqW3WgtdNLUl7ZRq9TRoFldxgJUZMIto7qe3Xm+RpLCy2X
Ord1a2Y4ltlLSqOvCC9fyt6VhRjRUjJNXhcvJF68eHFDgrrmz9Cg6oi8NaHFJempjf+T/vgW+ixo
tEkytGHjwYcpN9OE888/n+mxyWPZQ1nQz6osSi8OOMXLdZ6eeJvQIJfaLANnBLdAteM4M39q2bp1
q7eB9jLt546ttxVBOq1SHg5MSM8DiPJiqr3paMYqkPIY6DzB6S2PMgadMo6U3YH9ZOFpDmYiCVqV
15pNCjUGCy2vMO/yHr2Z4VgaEyiNtAtgJWOnLcjeVTbHEy2DLl5Ir2dYugytwLKouuYPd1BV9nVd
1d7IplDJyqc2fNOkv/BuHr5z86yXh+OaZDTXvbOYm/hkq0eGQJNLIkiytCP90cj6ZmQVMX/RZ2/V
mC5pZMhnRSUCc/RdUg4Fj4C+MdkRfV5MiBKBWUEgabezAntWmggkAtUI5CwpR0YikAiMEQJz1CUp
MNf6wQL8eyIctTKqxqif05REYEIQmKMuqa53WglHnrE1FEbVhIyTNDMRGBECU+uSxKxhY+JTkr9A
961vfat4TIa0EY4sVpsEWoFb5XDcGFtiLXVnt42oP7OaRGDCEZhal0S/SMeNuOq1a9eW3QSliAC8
7du341x01ghHENbEOGMjis+z24yxxSeq7uy2CR8kaX4iMDoEptklscoEQMId8+wkg5boZL52E7Bb
cgigj0ijjW0o7LbR9WfWlAhMOALT7JJefPFFemfTpk3or5XkLzhT0Lgg4Ijg5h0TE6uHHnpIPVuy
2wJjqyO7bcLHSZqfCIwIgWl2SStWrOB1Dz6F9StK8hf0HyZK0LV5BAvkJtJDW9UrpMBuKxlbzew2
vXIaUWdmNYnA5CMwtaGSvN6G8Tzg6n+T37/ZgkRgwhCY5lnShHVFmpsIJAIoSCebKYdBIpAIjA8C
1S7pk3f/L0w86silr128eN++VxawHZh34MACyJi8GNm7b8G8+QsOkHX+/kXz5x26b//8+fuee27X
3/3dzlVXv3982paWJAKJwMQhkA9uE9dlM2IwEaHEgs5I0VnobCAgGYLZqHnQOqtd0onHHcff/932
2BcfeOBbf/8Pm7686a+++PCWTVv/+mubH/6rTdu2bnts6/955OuP/vWmrY98ffOmTY/80z/tOumk
tzz11FODmjOq/F71qLXOUvanTuSrtaiZTqB2IVbhGXxdKmWpzLAC4cwJyfUEfhfjK9O0ijVZrp7s
KYsdDdWxp+5gmdBLL72UsLvuIAiN/trCN+Uhur9ql7T/1Y3lpS+6+OIzzzyTr+mXXnrJu979rosu
umjFigvPPffcX/mV9/7qRRf+0i/9t1/+5QtYxnz+vH0/suSHjjnmmL4H0ExkRB1IH/KHKCQpOytF
vmaiCf1dbCwTztrePdnDwrt+yaSe8s7xxGNIdeSSxKqO/TJutM1qlzR/3wL+TjrmuEXzFiw8MO/f
Xnp57+5/e82hi15+/vlFC+a99ocP/efvPrfnxZcXzdu/+6V/3rdvz/4D817ZM++QQ8boMZCJDBxa
LWLPWtemTSaqmr9Dym1pZeign+UlqLx+mZHjvByYF/MKo2FAZTSLIGf643l21hBiPqUdZkHnGBAE
4GQqG7dQr+kWFOh4ggMEkrHWOIUE3TSOe70w1aIZmXYqBcgC39DACXmlZSblOG1mp+Z9WhyahliB
0pULLS1F4nxDhKHnLVYOhuZizRg/eJoHQwAhwD5Dun7WtNCP9hM0+qZtmjidammVxuvoIqudyEGH
NH/fd7/77B/8wR/ce++9G14Vpbr3nnsfeOCBO26/He4Ychefu+ee9evXb9y4kSG+aNEhixYtOPTQ
QzvWOoJkBG0T8WjaYUGITQYEhTJp8rBUPvQ3FmwPElSkN/0yiXyVelhBPiw0s29lNDh3EgLjP5Ih
pTIafcTMiASi3WE87cUj6wiR6JgKmw8DOMIEymu6oV4HUByH1kc5rEvP2OKn6YuxmD8/kQwRGbBZ
L6xSgIxczXxDAYVkGxX52zt1IQ9lkmqGP2lIyXGQIaMXKSt7TYUjXad23XbbbV0GA/oxzcXKGMO8
y2DwIJTCf2G09K3rRzmlrl9Q7vNo9Efb5C6IngW9w12fGglIlp6gxPsGucCrXdLCeYfyd+QRR15/
7Ye/9cQTLzz77AlvfOPCefvO+YWfOfOM019z6KFv/0+nnPVzP/225af85184C64GX+J2736FC3IQ
U4abN/DaKqlqQaFM9pt+Vik35vXLSFmKUgX5sNCivpXR6G9FovMfuccSKFR0qJrjRIfaWS8Ah6n4
HUmbeU03fuKquPIpfOXKlTyqf+pTn5IimGTIuPAQB+Ysx8W5adYL8wB6O5v5hkqJhUwWjAXNEVNM
UgLDX7MnLgkd9yJlZa+RQDcbi5vtMhgQMmouto/B4EEohf9Ct/at6yehYPrUrsdS/86jUQ6nLqKE
3M5BADKD7vq8i2SEUC+jpU7rsOMFXuOSFu5fuHA/V/Xzz+/6+Mc/9lM/9ZOnnXbK0UcfVK34xV/8
uWXLfvKlF19a8iOv/bGTjjv5p97yjne8fcGCeT/8wwtb1dA62jSUZEzyuRHZo02lEFtQKCuVZoPc
WDCsQQ6ssgl9K6PhBXSDZZMeb+DZQeJjVshx0frYmJkzh2VahGwsjka6YxK59Jpu/MT1cEqFM/tA
UAysOC4lNX4yZ9TZylD4LoJ0Zpj4hvyUCl7IS/nMO1atWmXo4aS45eJ6PvShD3lINXsCk0oVvLLX
JF1nzq7LYCh7cPDB4EmXgRrZBcaOun433XST+otpsoZKqdzn0SiHUxfaJrc3XA+OSYOKy00CxdoG
uYRr3v7sXzBv/4JDFy7Y/viO3/vY//z2t3Y++MWHnn9u1+N/s+OuP/ncY1sfe+apf3ps69987atf
u+dzG3iaY6a4d8++V17510FMGW5exjfISn2MGXugqvGTK5b5QoNCWSk3FixsEKXizTpP6SF938po
XJn23I6TreTZcZlpGqVKWVOFmzw1Mv9n+iNT+Ukatdo03ZDYxnfrnQjDiwc3TZq46VFOUHwr+6hV
kE5ZPN9Q4NMin3fHjh1UymMm91urhX3dcm+55RZfNVcdy10xN6SNwaS6XqMhODuqYCI24sFgFnoQ
AjWyFcbuun5CUi8NGQbLli0rlfs8Gr3SNm2A0VmMImkgcq0xwFSvn+f2cVFXh0p+4cGvUdaWLVsu
+pULjz56yT3r7nvb25Y/+OBf/czP/PR/eMt/vP9/P/C6I37kDUcf9a979r75x056/PHtjz/+BC/5
77vvz6/+jf/ehxHTlwXHwe2d1xZq2hyXIRqQb4ijZNzzzsLeDE7igBkQhElscn8213xxm39g/vwD
Cxcu5G7/m7/5m7jbtWv/7Hvf++6f/unamz5+E28fvvSlL929bh1vQ3/v93//nnvuOeSQhQsW7H/l
lVf6M2L6cnFv9w8g09fA0bRIr8PwR9yQJ9ofjQau6ailepb0Fw9+meZ9/euP/saVl//ex35/8eLD
znzHGbxY5bXR3+/c+Y3Ht7/95854Ze+eV/bsOfINRz385a+86U1v4gGB6/C3Vl49HbhkKxKBRGBW
EKieJS16dXvhn1+A2/Y7v/PbPJG++c0nLVgwf+/ePXyHxvvs27tv6dFHHXX0UezzaYC3lYRWvu51
r5uVNmSliUAiMDUIVM+SHvjywXdJf7t9B98R4dke2LPn0EMW7N+3jwe0w1+35PkXnt+7f+/iwxbv
3bd3/nwCJBe96U3HL1++bN26z636H1dNDTTZkEQgERg9AtUuaeODX8KUs95xxp69C39o0bwDe+cp
MHv//gO79/zrgoULDl106J69e/ibv+CQRQsXEQTwxBN/t/bP1t3w0R98wR19YyprJIaFqJzu8fVj
YnaakQjMTQSqXdLvfOL7n4q6gfKDMITf+vAHumUZXapKl8RXcL6qJqtrdN2QNSUCHRGw6KYp21GU
oEDge42REj7ykY8QZWfHaTVH+EnwGMftp8hxuSUCicCIERgjomxHH9oxWaB9iSOGoyHcnkhZ3BBO
iqe5QE3S7ImU+cm5I86ZLBEYLgJT65IC7UvEboK5A3yBp3b11VfDG8AxKUw+t0QgERgxAlPrkgLt
ixUYoGVA1wJfnun4LxJp4KkxOYJERl6WOhhxT2R1iUAiAAJT65LgEHnaF7RAqFsQuHhkYwKF34Fr
ysHAU1O4MCk5DgOA6VKOkkQgERglAqlQMkq0s65EIBFoQWBqZ0nZ84lAIjCJCKRLmsReS5sTgalF
IF3S1HZtNiwRmEQEhu+SeEPsV3SfRFDS5kQgEZgtBIbvkvprCSGLXaQNOybrz4bMlQgkArOOQJNL
Mskavos3SxWyxhtp1BgUiqaA4+pbNOudlAYkAnMHgVqXxAK6hOfAuhDDhQV6TdeBcB48lDksrl7i
fYBMy+7ynwc3S8zchzXDSSx1sODdSgEykxuTsJq2kCwUbj8pnH1KUF4JfnnHKgO0KrYdV/AR/2Wh
hN58iyQTVq6lPXdGSbY0ERgZArUuCV4Fi657rrw0s3BPV111FQtLE2pI2CE/WXVb2s3sk14sVkvM
OuG6vFm5nQQwYP3S7jDRpH1GaXIThE3DRCPMGodo+iIhWSic1SxVSB03DUotZfKf2lkbk4XuqYjy
qYXj1KgFzNEslrjC/fffby1CdoXyYeTaQtoj65usKBGYgwi0v0vSxIdJBMHQkmpCaIGrlEsUUTo/
l/HwkVjKqyhJSE9KumAQOLzcm5ho0hdjg3GGwhRMNNSg+GkpQ7JQON6TiYwVUvYiqhUwRfCJ1C5B
Bek7UQt1UaORS2SnJH204XDxU6gzJuttDl4e2eTRI1DrkniKQWwHf8TER1MY5jtBqomnOWRt+MQm
u/1FS2Kp3/BfzqhyQ3RF8lg6i8vQjMaeFnU8JAuF8zPotDCpoUxkC+rqlQ9qVijzLTrzzDPxZTyB
jr6HssZEYE4hUOuSIHkh3YeqnzhfeChYY6+ue/v990Gig7HWB2dPPvlkpC+5aM01wHHFI5CA/yiF
1WEqOVMyakrFdAbZKYmv+flXSBYK5yd5zTCmXThTymxQ3WTJcB7ipONaSWSzFumVE3M9HkhZg3xO
DY5sbCIwegSS4zZ6zLPGRCARqEWg/V1SgpcIJAKJwMgQSJc0MqizokQgEWhHoPrBbcc/fI+sO77z
nC/gnWe8pb28TJEIJAKJwAAI5CxpAPAyayKQCAwbgWqXxPyIP6ZF9nf/V55YefOfD7v2kZanACs+
FPItnw+IbBwpP7dxpJk9E4xWgPggLaHGEMTQUNrg1Q1ianNeLXBOmHsJ4AyBr3j9mWtRKFkfgtVf
A644Sjnd2en9VWfW9oSPOrGnLMNN3DJLAjU2KCPUetPV/wWvNFmOiXFjQ/bWW28lEAkK3saNGwlA
J2CKkCtWvB0QUAh9BEyEQobbr374VlY3YBN6yt7atCOOOAINmFDmDIHfbHlHX98xmeoiyJYoubqR
M1wXaaX1PVBlbU/9O5rETUBVijT9xcN/y58/dc0n7vN/OoX1I9Z46qk6uCMENBFdJSKLsDZBN+2I
EyMSDBs+i32FQemUwkTZ2FGTiRclnlP8FUnCcYpNufhPqKcVyL5lkT36SXZ+Uo63SrJOQtXqxX6l
Ia9VRzJfVLA5oKQytYFDaBRlYgalUYg2ksElUvni3EgRj/+haVaRwatyzDxyUf5QwPd2Wr2UT13B
Qp1tUOvDHuCVkTYeOFhZDkVZGqpjX82RIKBQUjOty0jDWYHGcRMKpMeDvKAs0fhkR20U1L40VWcD
lTQUFYacYVJaq5FDAu3UjRbfiaEuQ0ajXcaomSoQk9gYNjK+vHCUQNl908orutqnmEtiRLLB8wju
yVwSdVx33XU9eYqRJeZixni6QTXKWaj7RScWpupauRj1hMYrTZPX0KDXjjD1TdBgsn7SYNJgNZSU
hQ6Tf6QKdpRShmkYsW/1qnaVQDK5EhnPz1CUbJbyiuUyI1WmnGDZKFWtXDJMycilRlldnKJ23zRV
IZBJT1HWarNWlg8OvrfTmiY7g4V2FuPV0TRE14lMlV+ws7ZTWY5QpdWCUUPIrkbdnECGvBy3BMLN
Vy0bSKnrGVi0eZdEaX50heqsFdoJQ06trrS2dEnlaAmdGOqiLWqOtT2AoF6gORigVpQXDhhSC8c9
UNZZttPy4MYjGxsV6AlON4SwXX/99ZXHZ/cghJK7774bhlpJNwmG4XCJ//YUOWK74cTRkd/85jfF
uRMVTpw7CqxsmmbIy5cvL88qC9S8U089lR1eY0GjgzCo4yXhhnoZuA3B4qEoCmGKThOwuY6Lx1kK
LBu1dOlSDlpdWCgaIAiICUhdsBrFbZS3CtvTTz9NxDzpKcpOKbi/IXBfKbuDH+z0NrRaGNT6gAK2
ALyCoMBeWQ5vHsEH7lSl2ijESUo79thjd+3aFWA5/fTT1UAxExhUjJ8gLxiyMMbKlwCWJhTF8XLI
NVtrRZWjJXRiqMtYpZUjXxzSJUuWQAgDDTCh/PLC4XH+xBNP5HizZ2hxSby58FtZlhzeGG6bNm2C
UMJVAbkEGl2DheCIz628kqHCVXLuurT3ySefDMlwQFu2bOEg1dF/lExP8/O5554T547XXjt37mTn
pJNOYn0CT6nzTGAShKK62EMDKRBMKNw3qjUvdWlyx6ZXb2XTRFTULZqN903r16/XZCRYHqrrDn6d
ndRSWmiJK9X6wJnFJMhl3yWUrLIcrjFAA7qOvGsDQTaogezQ9VyTQV6QYcDFz9nNmzfzn34JHzp8
aaGoSkAqraXeZ555hlaXHecL8Z0Y6gIZmOdKjLsRe/Spp56q65QuF04Ayopqckl6mV3+Weax9UdY
eNddd2nSTsvD5R1wlJQbUwP8VxgQ3Nl49ynOXffvI5TPTZUXuoGpB0mQiRsHSXDeeeexZgv3T34y
XaKbmfRSkRZFYc5CvdwDVS8WHn/88eybkwpFhRbR9nJ1JxpIgVweKrx7o5hC6nuZXkmWTeMmyaCn
fK3fIPu5VXIEALkl1A1cjg8IPqAhUBwstOrq1PpuvvlmcP7ABz6AYwJSS1ZZDm2hFqDT5LF54/nl
wgsvNCI6iQGH/0C3evXqVatWlfKCa9as4ezWrVtJdvvtt5OGn/rmFUoLRVVaUmktJkFWLaWefQmh
E0NdIIPT1Bigr9nUojo0Wi8ca5qGli+nOlTyC195gkR8+K+rkq9vbb2T52cNARwHC1rZAk/8ZDiO
8/1j1pDKiscPgaTdjl+fDGwRE6tzzz3XXg+lSxoY0SxgdAikSxod1llTIpAItCKQHLdWiDJBIpAI
jA6B5LiNDuusKRFIBFoRmEMctwYswjv/VtT4INITDy4U2MrJ8Ol5E9Srea32DzFBT2yMunp75RUO
l7fRioaRxQbvi6S2taI9zRw3voXrs6X/KNuKSJcEfMvnW3hIOZSL08q00ghCm/WPZcNtWheEB0nT
8bLvqVEii9X1xXBdpJU2t6ht1uVlQDdHOnLcKvOOyUGRGxT+z2Y8Lx30nB2FbImspHB+IyWJuCSy
kkX6K/ItcIU8o8pnUWI2BUl5GpFICT5C35hxxN0rF+l1kGS+qMCuKjEPRKfA3vIW0nA1ULYpitLI
ViIxmTFWUSDo+fTeGN8ia7sHmZJ75RV6OoLvKatX1ora4hMMTm2zvqhjbI0VtS2wVQaktilw3y6l
OmpbGAndqW29EUoI+iQQyf50gcEjsW2Qe9oM5SV6m/guIwHo/qbRvG3bNmLkiObSEVFJCJ+jUUTN
cY8lnJrjxDoS3cMpicRZpD87RrakCk6hiUAhokpJ6VdZTjnlFArUFU6sGtQcAmTFBStbTb0ExYpq
Bw/GSiMUkMSK6LOiSEaniF1lriqUaexHou9oL7dcSua/VBKsUfy8/PLLKQTbSECMHDHll112Gc3n
J1AQ+OubplqI82SWQQJB4dNbuGloEcjI/2JMOEUJIEnrQNJayk+arIUciCll5Yagi1X2lGwTJZCZ
bEhw8cUXc0pxkhIcVH+V4FAIsdp0mVHbkIcgpfqCDVYEYY04UyzUwMBa0VM0rnbs2KFRBEpghRAh
4bj+nuQ7C/QEJqFkvjSNE2uFiuIIDCQSE6+o6P86a8sxZsPVYm7DmAx1+cukjBQlAnnDhg3nn38+
MegMRaI9eSMRRkIDUKV5OtInx43e+u3/v40nxy1wjkwRVxdkydkhiodhB4KBD0VirzQXcKxjlikL
VDXRf/SUV8kFswJLtpevKxRFwH4Du0oZuQb4DxWARpXsLd8oPCANEdVOtCmySL6FyHKRLcIWCHqV
6UOLpPXCyKGo7tS2Bl5h2VPByJmjtlFRHWNrLlPbuHuVI6Ejtc36rn+Om2Yc+j+GG9RWfLwtlsQ1
ySUqQj/XmOfsBONh9wS5uu6tC1evqGrYoAWn2DyNKHCFSraXLy0UJUJs88ZdmgQ0nCY3sMAqCyFL
ELkLTfMEPUoo03MwtIiZDpMOpnXM77pT28p3djKY23JDT4lYFxLMNWpbINDVjZaO1LbFixdTgtEw
K0uDGl05EnziOmpbV5fUNuzH9zwTYK5DMbmY8fIMxUMBP5ln8gjgOTthWUKxrvRevPtijwBhVCkD
hZkXot4S72USHmhEaMN5rlBge4XSQlHlLBpSG6/zfX9ImhhHwCNGHQusrv/IwtONka3KpnmCHoWE
9Co2tIjFK2gyVHjmdzzdDMIrFLWtrqeMEkin+66ca9Q27sqeQFfZ192pbbt37/Y0zI4jJyQzapu+
XVZ+tk6O2/h61Z4sw3vCzIZgqVz85O43+JqZPdmQiROBwRFIQsngGM5+CbyLxfswGbQXwOmSZr9X
0oK+EEiX1BdsmSkRSARmBoEklMwMrllqIpAI9IXA/wOUIQDJk0V37wAAAABJRU5ErkJggqBGHfBT
3QAAmClSqiyz+YeetvA7k37o/v//2P/gABBKRklGAAECAQBIAEgAAP/hBs9FeGlmAABNTQAqAAAA
CAAHARIAAwAAAAEAAQAAARoABQAAAAEAAABiARsABQAAAAEAAABqASgAAwAAAAEAAgAAATEAAgAA
ABQAAAByATIAAgAAABQAAACGh2kABAAAAAEAAACcAAAAyAAAAEgAAAABAAAASAAAAAFBZG9iZSBQ
aG90b3Nob3AgNy4wADIwMDM6MTE6MTcgMTE6MTA6NDkAAAAAA6ABAAMAAAAB//8AAKACAAQAAAAB
AAADIKADAAQAAAABAAACWAAAAAAAAAAGAQMAAwAAAAEABgAAARoABQAAAAEAAAEWARsABQAAAAEA
AAEeASgAAwAAAAEAAgAAAgEABAAAAAEAAAEmAgIABAAAAAEAAAWhAAAPAOgDCyAAAAEA6QMoAAAA
gBYAAOAQAADgEAAAgBYAAAUAAAAKAAAACQAAAAoAAAABAAAAAAAAAQ8A8gMWAQAALwDIDwwAAAAw
ANIPBAAAAAEAAAAPANUHTAAAAAAAtw9EAAAAQQByAGkAYQBsAAAACAAAAAAAAAB8uRMAfLkTAMx3
ngD8txMA5LcTAKHQBzAIAAAAAAAAAPy3EwA6QQkw9LcTAAAABiIAAKQPCgAAAIAAQgAAAP//FAAA
AKUPDAAAAAAAAAguAAAABwAAAAAAqQ8KAAAABwAAAAIACQQAAEAAow9uAAAABQD//T8AAAAiIAAA
ZAAAAAD/AABkAAAAAAAAAAAAQAIAAAAABwAAAP//7wAAAAAA////////EgAAAAABAAAABQAAIAEg
AQAAAAAABQAAQAJAAgAAAAAABQAAYANgAwAAAAAABQAAgASABAAAAAAPAAsE7AMAAA8AAPDkAwAA
AAAG8GgBAAAErAAALAAAAFsAAAAZAAAAAQAAAAcAAAACAAAABAAAAAMAAAA6AAAAAAAAAAYAAAAF
AAAACAAAAAAAAAAGAAAABwAAAAYAAAAIAAAACQAAAAAAAAAGAAAACgAAAAQAAAALAAAABgAAAAwA
AAAIAAAADQAAAAQAAAAOAAAABAAAAA8AAAAEAAAAEAAAAAQAAAARAAAABAAAABIAAAAEAAAAEwAA
AAcAAAAAAAAABgAAABUAAAAHAAAAAAAAAAYAAAAXAAAACQAAAAAAAAAGAAAAAAAAAAYAAAAAAAAA
BgAAAAAAAAAGAAAAAAAAAAYAAAAAAAAABgAAAAAAAAAGAAAAHwAAAAQAAAAgAAAABwAAAAAAAAAG
AAAAIgAAAAcAAAAAAAAABgAAACQAAAAEAAAAJQAAAAYAAAAAAAAABgAAACcAAAAEAAAAKAAAAAgA
AAAAAAAABgAAAAAAAAAIAAAAAAAAAAQAAADPAAHwEAIAAGIAB/AkAAAABgYelvGRPXdzPT3+rkbd
W1Ya/wBBNQAAAQAAAAAAAAAAAAAAUgAH8CQAAAAFBZbmoOAtd5mXPygPkhrv6Zv/AKs0AQABAAAA
QTUAAAAAAABSAAfwJAAAAAUFvDoCjWlz7AohAcDNA0I7NP8Afa4AAAEAAADsaQEAAAAAAFIAB/Ak
AAAABQUgNygNC8A6tnyPZzDhCBYP/wBjhAEAAQAAAGkYAgAAAAAAUgAH8CQAAAAFBQpbciOiNlEZ
XK4hgIEMMvX/AKDrAAABAAAAzJwDAAAAAABSAAfwJAAAAAUF7RdMnOsaYv8wAWqo3hmEnv8AEhoB
AAEAAABsiAQAAAAAAFIAB/AkAAAABQXsMAhTRvPphSUn/PKkUIz6/wAoTwAAAQAAAH6iBQAAAAAA
UgAH8CQAAAAFBb5JbcHZE9enm1sGyU1kaHf/AC5rAQABAAAApvEFAAAAAABSAAfwJAAAAAUFeODc
eMq2/pxGaXV0UEP1y/8AWQoBAAEAAADUXAcAAAAAAGIAB/AkAAAABgYYZJxvHO0pM36ie0IuSp9C
/wBKIgAAAQAAAC1nCAAAAAAAYgAH8CQAAAAGBjamMAYnllS2k1n2xT19Pwj/ACsqAAABAAAAd4kI
AAAAAABiAAfwJAAAAAYGcoueyxhAvdfaoFTFcKgqlf8AE1EAAAEAAACiswgAAAAAAIMAC/AwAAAA
gQEEAAAIgwEAAAAIhkEAAAAAvwEQABAAwAEBAAAIxUEAAAAA/wEIAAgAAQICAAAIEAAa8QQAAAD/
AAAAQAAe8RAAAAD//////wAAAAIAAAj3AAAQHwDwDxwAAAAAAPMDFAAAAAIAAAAAAAAAAAAAAAAA
AIAAAAAADwDQB3EBAAAfABQEHAAAAAAAFQQUAAAAmyjdCgDKmjutB5THAMqaOwEBAAAPAPoDZwAA
AAAA/gMDAAAAAAEAAAD9AzQAAABBAAAAZAAAAEEAAABkAAAACAAAAAAAAAAUuBMAOkEJMAAAAAAA
AAAAoP////j+//8BABMAcAD7AwgAAAAAAAAAcAgAAHAA+wMIAAAAAQAAAEALAAAfABMEPAAAAAAA
/QM0AAAAZAAAAGQAAABkAAAAZAAAAEC4EwDqJAkwfLkTAKR3ngAAAAAAAAAAAAAAAAAAAAAAAAET
AB8A/wMUAAAAAgAABAwAAAAAAAAAAAAAAAIAAAAPAIgTdgAAAA8AihMwAAAAAAC6DxAAAABfAF8A
XwBQAFAAVAAxADAAAACLExAAAAAAAA0ECAAAAHC1AABwtQAADwCKEzYAAAAAALoPDgAAAF8AXwBf
AFAAUABUADkAAACLExgAAAAAAHsXEAAAANy3EwDkBAAAAwADAAIPQTA/ANkPDAAAAAAA2g8EAAAA
DQAlAA8A8A9YGAAAAADzAxQAAAADAAAAAAAAAAIAAAAAAQAAAAAAAAAAnw8EAAAABgAAAAAAoA9Q
AAAAQwBFAEQAUgBPAE0ALQBTAE4AaQAZIHMAIABEAEkAVABBAC0AYgBhAHMAZQBkACAAcAByAG8A
agBlAGMAdAAgAGMAcgBlAGEAdABpAG8AbgAAAKoPJgAAAAcAAAAGAAAACRAAAAUAAAAHAAAAAwAJ
EAAAHQAAAAYAAAAJEAAAEACfDwQAAAAFAAAAAACoDx0AAABGcm9tIGFuYWx5c2lzIHRvIGRlbGl2
ZXJhYmxlcwAAqg8MAAAAHgAAAAYAAAAJEAAAAADzAxQAAAAEAAAAAAAAAAIAAAABAQAAAAAAAAAA
nw8EAAAAAAAAAAAAqA8wAAAAT3ZlcnZpZXcgb2YgdGhlIHByb2plY3QgZGVsaXZlcmFibGVzIGFu
ZCBjb250ZW50AAChDxYAAAAxAAAAAAAACAAAAAAxAAAAAAACACgAAACqDwwAAAAxAAAABgAAAAkQ
AAAQAJ8PBAAAAAEAAAAAAKoPDgAAAAEAAAAHAAAAAAAJEAAAAADzAxQAAAAFAAAAAAAAAAIAAAAD
AQAAAAAAAAAAnw8EAAAAAAAAAAAAqA8KAAAASGlnaGxpZ2h0cwAAoQ8UAAAACwAAAAAAAAgAAAAA
CwAAAAAAAAAAAKoPDAAAAAsAAAAGAAAACRAAABAAnw8EAAAAAQAAAAAAoA+4AwAAVABoAGUAcgBl
ACAAaQBzACAAYQAgAGcAcgBlAGEAdAAgAG8AcABwAG8AcgB0AHUAbgBpAHQAeQAgAGYAbwByACAA
cgBlAHUAcwBlACAAYQB0ACAAdABoAGUAIABmAHUAbgBjAHQAaQBvAG4AYQBsAGkAdAB5ACAAYQBu
AGQAIAB0AGEAcwBrACAAbABlAHYAZQBsAHMALgANACoAIABGAHUAbgBjAHQAaQBvAG4AYQBsAGkA
dABpAGUAcwAgAGEAcgBlACAAcAByAGUAcwBlAG4AdABlAGQAIABhAHMAIABjAG8AbgBjAGUAcAB0
AHMAIABiAGUAYwBhAHUAcwBlACAAdABoAGUAeQAgAGEAbgBzAHcAZQByACAAdABoAGUAIABxAHUA
ZQBzAHQAaQBvAG4AcwAgABwgVwBoAGEAdAAgAGkAcwA/AB0gIABvAHIAIAAcIFcAaABhAHQAIABp
AHMAIABpAHQAIAB1AHMAZQBmAHUAbAAgAGYAbwByAD8AHSAuACAAVwBoAGEAdAAgAGkAcwAgAGEA
IABzAGUAYQByAGMAaAA/ACAAVwBoAGEAdAAgAGkAcwAgAGEAIAB0AGgAZQBtAGUAIABhAG4AZAAg
AHcAaAB5ACAAdwBvAHUAbABkACAASQAgAHUAcwBlACAAbwBuAGUAPwANAFQAcgBhAGkAbgBpAG4A
ZwAgAGcAdQBpAGQAZQBzACAAdgBhAHIAeQAgAGYAcgBvAG0AIABvAG4AZQAgAHQAcgBhAGkAbgBp
AG4AZwAgAGMAbABhAHMAcwAgAHQAbwAgAHQAaABlACAAbgBlAHgAdAA6ACAAdABoAGUAcgBlACAA
aQBzACAAYQAgAGcAcgBlAGEAdAAgAG4AZQBlAGQAIABmAG8AcgAgAGEAIABmAGwAZQB4AGkAYgBs
AGUAIAB0AG8AcABpAGMAIABvAHIAZwBhAG4AaQBzAGEAdABpAG8AbgAuAA0ATQB1AGwAdABpAHAA
bABlACAAdQBzAGUAcgAgAHQAeQBwAGUAcwAgAHcAaQB0AGgAIABkAGkAZgBmAGUAcgBlAG4AdAAg
AGEAYwBjAGUAcwBzACAAdABvACAAZgB1AG4AYwB0AGkAbwBuAGEAbABpAHQAaQBlAHMALAAgAG4A
ZQBlAGQAIABmAG8AcgAgAGMAbwBuAGQAaQB0AGkAbwBuAGEAbAAgAHQAZQB4AHQAIABiAGEAcwBl
AGQAIABvAG4AIABhAHUAZABpAGUAbgBjAGUAcwAuAAAAoQ9CAAAATQAAAAAAABAAAFAAsQAAAAEA
ABAAAFAA3wAAAAAAABAAAFAATQAAAAAAAgAcALEAAAAAAAIAGADfAAAAAAACABwAAACqDwwAAADd
AQAABgAAAAkQAAAAAPMDFAAAAAYAAAAEAAAAAgAAAAIBAAAAAAAAAACfDwQAAAAAAAAAAACoDxwA
AABPbmxpbmUgSGVscCBEZWxpdmVyeSBQcm9jZXNzAAChDxQAAAAdAAAAAAAACAAAAAAdAAAAAAAA
AAAAqg8MAAAAHQAAAAYAAAAJEAAAEACfDwQAAAABAAAAAACoDwEAAAAgAAChDxQAAAACAAAAAAAB
AAAAAAACAAAAAAAAAAAAqg8MAAAAAgAAAAYAAAAJEAAAAADzAxQAAAAHAAAAAAAAAAIAAAAFAQAA
AAAAAAAAnw8EAAAAAAAAAAAAqA8KAAAASGlnaGxpZ2h0cwAAoQ8UAAAACwAAAAAAAAgAAAAACwAA
AAAAAAAAAKoPDAAAAAsAAAAGAAAACRAAABAAnw8EAAAAAQAAAAAAqA+AAQAAVGhlIHByb2R1Y3Rp
b24gYW5kIGRlbGl2ZXJ5IG1vZGUgYXJlIHVzZWZ1bCB0byBwcmV2ZW50IHVzZXJzIGZyb20gd2Fp
dGluZyB0b28gbG9uZyBmb3IgdG9waWMgZGlzcGxheS4gUHJlLXByb2Nlc3NlZCBlbGVtZW50cyBp
bmNsdWRlOiANVGhlIHRhYmxlIG9mIGNvbnRlbnQNVGhlIGluZGV4DVRoZSByZWxhdGVkIGxpbmtz
IA1UaGVyZSBpcyBhbHNvIGEgbmVlZCB0byBzYXZlIG9ubHkgdGhlIHJlbGV2YW50IGZpbGVzIGlu
IHRoZSBkb2N1bWVudCBiYXNlLCBzbyB0aGF0IG90aGVyIGZpbGVzIGFyZSBub3QgcmV0dXJuZWQg
YnkgdGhlIHNlYXJjaCBlbmdpbmUuIEl0cyBmYXN0ZXIgdGhhbiBjaGVja2luZyB0aGUgbWFwIGV2
ZXJ5dGltZSBmb3IgcHJvamVjdCByZWxldmFuY2UuAAChD0IAAACHAAAAAAAAEAAAWgAyAAAAAQAA
EAAAWgDIAAAAAAAAEAAAWgCHAAAAAAACABwAMgAAAAAAAgAYAMgAAAAAAAIAHAAAAKoPJgAAAGAB
AAAGAAAACRAAAAkAAAAHAAAAAwAJEAAAGAAAAAYAAAAJEAAAAADzAxQAAAARAAAABAAAAAIAAAAG
AQAAAAAAAAAAnw8EAAAAAAAAAAAAqA8fAAAAUHJlLXByb2Nlc3NlZCBUYWJsZSBvZiBDb250ZW50
IAAAoQ8UAAAAIAAAAAAAAAgAAAAAIAAAAAAAAAAAAKoPDAAAACAAAAAGAAAACRAAABAAnw8EAAAA
AQAAAAAAqg8OAAAAAQAAAAcAAAAAAAkQAAAAAPMDFAAAABIAAAAEAAAAAgAAAAcBAAAAAAAAAACf
DwQAAAAAAAAAAACoDxMAAABQcmUtcHJvY2Vzc2VkIEluZGV4AAChDxQAAAAUAAAAAAAACAAAAAAU
AAAAAAAAAAAAqg8MAAAAFAAAAAYAAAAJEAAAEACfDwQAAAABAAAAAACqDwwAAAABAAAABgAAAAkQ
AAAAAPMDFAAAABMAAAAAAAAAAQAAAAgBAAAAAAAAAACfDwQAAAAAAAAAAACoD1gAAABQcmUtcHJv
Y2Vzc2VkIFJlbGF0ZWQgTGlua3MLKkluY2x1ZGVkIGluIHRvcGljcywgdG8gYmUgbW92ZWQgaW4g
bWFwcyB0byBhZGFwdCB0byBjb250ZXh0AAChDx4AAABZAAAAAAAACAAAAAAcAAAAAAAAAD0AAAAA
AAIAEAAAAKoPDAAAAFkAAAAGAAAACRAAAAAA8wMUAAAAFAAAAAAAAAABAAAACgEAAAAAAAAAAJ8P
BAAAAAAAAAAAAKgPRQAAAFNlYXJjaCB3aXRoIE9wdGlvbnMgYW5kIFJlc3VsdHMgYmFzZWQgb24g
VG9waWMgVHlwZXMgKCp0YXNrIG9yIG90aGVyKQAAoQ8gAAAARgAAAAAAAAgAAAAANQAAAAAAAgAo
ABEAAAAAAAIAEAAAAKoPDAAAAEYAAAAGAAAACRAAAAAA8wMUAAAAFwAAAAAAAAACAAAADAEAAAAA
AAAAAJ8PBAAAAAAAAAAAAKgPCgAAAEhpZ2hsaWdodHMAAKEPFAAAAAsAAAAAAAAIAAAAAAsAAAAA
AAAAAACqDwwAAAALAAAABgAAAAkQAAAQAJ8PBAAAAAEAAAAAAKgPYgEAAFRpdGxlcyBhbmQgdGhl
IGNvbnRlbnQgYXJlIGluZGV4ZWQgc2VwYXJhdGVseSBpbiBURVhUTUwgU2VydmVyIHRvIG9mZmVy
IG1vcmUgcHJlY2lzZSBzZWFyY2ggY2FwYWJpbGl0aWVzIHRvIHVzZXJzLg1TeW5vbnltb3VzIGFy
ZSBpbmNsdWRlZCBpbiB0aGUgcHJvbG9nL2tleXdvcmQgZWxlbWVudC4gU28gd2hlbiBhIHVzZXJz
IGRvIG5vdCBrbm93IHRoZSBleGFjdCBleHByZXNzaW9uIHVzZWQgaW4gdGhlIHRleHQsIHRoZXkg
Y2FuIGZpbmQgcmVsYXRlZCBpbmZvcm1hdGlvbi4gDVJlc3VsdHMgYXJlIHNlcGFyYXRlZCBpbnRv
IGRlc2NyaXB0aW9ucyAoY29uY2VwdHMsIHRvcGljcywgcmVmZXJlbmNlcykgYW5kIHRhc2tzLgAA
oQ8UAAAAYwEAAAAAABAAAFoAYwEAAAAAAAAAAKoPJgAAAJIAAAAGAAAACRAAAAYAAAAHAAAAAwAJ
EAAAywAAAAYAAAAJEAAAAADzAxQAAAAIAAAABAAAAAIAAAAEAQAAAAAAAAAAnw8EAAAAAAAAAAAA
qA8lAAAAQ3JlYXRpbmcgdGhlIFdlYiBTZXJ2aWNlcyBPbmxpbmUgSGVscAAAoQ8WAAAAJgAAAAAA
AAgAAAAAJgAAAAAAAgAoAAAAqg8MAAAAJgAAAAYAAAAJEAAAEACfDwQAAAABAAAAAACqDwwAAAAB
AAAABgAAAAkQAAAAAPMDFAAAABUAAAAAAAAAAgAAAAkBAAAAAAAAAACfDwQAAAAAAAAAAACoDwoA
AABIaWdobGlnaHRzAAChDxQAAAALAAAAAAAACAAAAAALAAAAAAAAAAAAqg8MAAAACwAAAAYAAAAJ
EAAAEACfDwQAAAABAAAAAACgDyYCAABEAG8AYwB1AG0AZQBuAHQAYQB0AGkAbwBuACAAZgBvAHIA
IABXAGUAYgAgAHMAZQByAHYAaQBjAGUAcwAgAG8AcABlAHIAYQB0AGkAbwBuAHMAIABpAHMAIABh
ACAAbQBpAHgAZQBkACAAbwBmACAAVwBTAEQATAAgAGkAbgBmAG8AcgBtAGEAdABpAG8AbgAgAGEA
bgBkACAAYwBvAGQAZQAgAGMAbwBtAG0AZQBuAHQAcwAuACAAVABoAGUAIABpAG4AZgBvAHIAbQBh
AHQAaQBvAG4AIABpAHMAIABtAGUAcgBnAGUAZAAgAHQAbwBnAGUAdABoAGUAcgAuACAARQBhAGMA
aAAgAHMAZQByAHYAaQBjAGUAIABhAG4AZAAgAGUAYQBjAGgAIABtAGUAdABoAG8AZABzACAAYgBl
AGMAbwBtAGUAcwAgAGEAIABEAEkAVABBACAAcgBlAGYAZQByAGUAbgBjAGUAIAB0AG8AcABpAGMA
LgANACAAQQAgABwgcwB1AGIAbQBhAHAAHSAgAGYAbwByACAAYQBsAGwAIABXAGUAYgAgAFMAZQBy
AHYAaQBjAGUAcwAgAGkAcwAgAGMAcgBlAGEAdABlAGQAIABhAG4AZAAgAHIAZQBmAGUAcgBlAG4A
YwBlAGQAIABiAHkAIAB0AGgAZQAgAGcAbABvAGIAYQBsACAAcAByAG8AagBlAGMAdAAgAG0AYQBw
AC4AAAChDxQAAAAUAQAAAAAAAAAAFAEAAAAAAgAcAAAAqg8mAAAAwgAAAAYAAAAJEAAABgAAAAcA
AAADAAkQAABMAAAABgAAAAkQAAAAAPMDFAAAABYAAAAAAAAAAQAAAAsBAAAAAAAAAACfDwQAAAAA
AAAAAACoDxQAAABXZWIgU2VydmljZXMgTWV0aG9kcwAAoQ8WAAAAFQAAAAAAAAgAAAAAFQAAAAAA
AgAoAAAAqg8MAAAAFQAAAAYAAAAJEAAAAADzAxQAAAAYAAAAAAAAAAEAAAANAQAAAAAAAAAAnw8E
AAAAAAAAAAAAqA8eAAAAQ3JlYXRpbmcgYSBQREYgVHJhaW5pbmcgTWFudWFsAAChDxQAAAAfAAAA
AAAACAAAAAAfAAAAAAAAAAAAqg8MAAAAHwAAAAYAAAAJEAAAAADzAxQAAAAZAAAAAAAAAAIAAAAO
AQAAAAAAAAAAnw8EAAAAAAAAAAAAqA8KAAAASGlnaGxpZ2h0cwAAoQ8UAAAACwAAAAAAAAgAAAAA
CwAAAAAAAAAAAKoPDAAAAAsAAAAGAAAACRAAABAAnw8EAAAAAQAAAAAAoA/6AwAAVAByAGEAaQBu
AGkAbgBnACAAcwBlAHMAcwBpAG8AbgBzACAAYQByAGUAIABhAGwAbQBvAHMAdAAgAGEAbAB3AGEA
eQBzACAAZABpAGYAZgBlAHIAZQBuAHQAIABiAGUAYwBhAHUAcwBlACAAdABoAGUAIABuAGUAZQBk
AHMAIAB2AGEAcgB5ADoADQBOAGUAdwAgAHUAcwBlAHIAcwAgAHcAaABvACAAdwBhAG4AdAAgAHQA
aABlACAAcAByAG8AZAB1AGMAdAAgAGYAbwByACAAbQBlAGQAaQBhACAAbQBvAG4AaQB0AG8AcgBp
AG4AZwANAE4AZQB3ACAAdQBzAGUAcgBzACAAdwBoAG8AIAB3AGEAbgB0ACAAdABvACAAcwBoAGEA
cgBlACAAbgBlAHcAcwAgAG8AbgAgAHQAaABlAGkAcgAgAGkAbgB0AHIAYQBuAGUAdAANAE4AZQB3
ACAAHCBrAG4AbwB3AGwAZQBkAGcAZQAgAG0AYQBuAGEAZwBlAG0AZQBuAHQAHSAgAHUAcwBlAHIA
IAB3AGgAbwAgAG4AZQBlAGQAcwAgAHQAbwAgAGwAZQBhAHIAbgAgAGgAbwB3ACAAdABvACAAYwBy
AGUAYQB0AGUAIABhAGQAdgBhAG4AYwBlAGQAIABxAHUAZQByAGkAZQBzAA0AUgBlAGcAdQBsAGEA
cgAgAHUAcwBlAHIAcwAgAHcAaABvACAAdwBhAG4AdAAgAHQAbwAgAGwAZQBhAHIAbgAgAG4AZQB3
ACAAZgB1AG4AYwB0AGkAbwBuAGEAbABpAHQAaQBlAHMADQBSAGUAZwB1AGwAYQByACAAdQBzAGUA
cgAgAHcAaABvACAAYQByAGUAIABnAG8AaQBuAGcAIAB0AG8AIAB1AHMAZQAgAHQAaABlACAAdABv
AG8AbAAgAGYAbwByACAAbgBlAHcAIABwAHUAcgBwAG8AcwBlAHMADQBDAG8AbQBwAHUAdABlAHIA
IABsAGkAdABlAHIAYQB0AGUAIAB1AHMAZQByAHMAIAB2AHMAIABuAG8AdAAtAHMAbwAtAGMAbwBt
AHAAdQB0AGUAcgAgAGwAaQB0AGUAcgBhAHQAZQAgAHUAcwBlAHIAcwAmIA0ARABvAGMAdQBtAGUA
bgB0AHMAIABpAG4AYwBsAHUAZABlACAAdABoAGUAIABzAGEAbQBlACAAawBpAG4AZAAgAG8AZgAg
AHQAYQBiAGwAZQAgAG8AZgAgAGMAbwBuAHQAZQBuAHQAIABhAG4AZAAgAGkAbgBkAGUAeAAgAGEA
cwAgAHQAaABlACAAbwBuAGwAaQBuAGUAIABoAGUAbABwAC4ADQAgAAAAoQ9QAAAARgAAAAAAABAA
AFoAZAEAAAEAABAAAFoAUgAAAAAAABAAAFoAAgAAAAAAARAAAAAAWgBGAAAAAAACABgAZAEAAAAA
AgAUAFQAAAAAAAIAGAAAAKoPJgAAAIcBAAAGAAAACRAAAAIAAAAHAAAAAwAJEAAAdQAAAAYAAAAJ
EAAAAADzAxQAAAAaAAAABAAAAAEAAAAPAQAAAAAAAAAAnw8EAAAAAAAAAAAAqA8sAAAARWxlbWVu
dHMgb2YgUERGIERvY3VtZW50cyBiYXNlZCBvbiBESVRBIG1hcHMAAKEPFgAAAC0AAAAAAAAIAAAA
AC0AAAAAAAIAKAAAAKoPDAAAAC0AAAAGAAAACRAAAC8A8A+oAAAAAADzAxQAAAALAAAAAAAAAAAA
AAAAAQAAAAAAAAAA8wMUAAAADAAAAAAAAAAAAAAAAQEAAAAAAAAAAPMDFAAAAA0AAAAAAAAAAAAA
AAIBAAAAAAAAAADzAxQAAAAOAAAAAAAAAAAAAAADAQAAAAAAAAAA8wMUAAAADwAAAAAAAAAAAAAA
BAEAAAAAAAAAAPMDFAAAABAAAAAAAAAAAAAAAAUBAAAAAAAAAADqAwAAAAAPAPgDpAkAAAIA7wMY
AAAAAQAAAAECBwkIAAAAAAAAAAAAAAAAABMAYADwByAAAAD///8AAAAAAICAgAAAAAAAu+DjADMz
mQAAmZkAmcwAAGAA8AcgAAAA////AAAAAACWlpYAAAAAAPvfUwD/mWYAzDMAAJlmAABgAPAHIAAA
AP///wAAAAAAgICAAAAAAACZzP8AzMz/ADMzzACvZ/8AYADwByAAAADe9vEAAAAAAJaWlgAAAAAA
////AI3G/wAAZswAAKgAAGAA8AcgAAAA///ZAAAAAAB3d3cAAAAAAP//9wAzzMwA/1BQAP+ZAABg
APAHIAAAAACAgAD///8AAFpYAP//mQAAZGIAbW/HAAD//wAA/wAAYADwByAAAACAAAAA////AFwf
AADf0pMAzDMAAL55YAD//5kA06IZAGAA8AcgAAAAAACZAP///wAAM2YAzP//ADNmzAAAsAAAZsz/
AP/nAQBgAPAHIAAAAAAAAAD///8AM2aZAOPr8QAAM5kARopLAGbM/wDw5QAAYADwByAAAABoa10A
////AHd3dwDR0csAkJCCAICeqAD/zGYA6dy5AGAA8AcgAAAAZmaZAP///wA+PlwA////AGBZewBm
Zv8Amcz/AP//mQBgAPAHIAAAAFI+JgD///8ALSAVAN/AjQCMe3AAj18vAMy0AACMnqAAAACjDz4A
AAABAP/9PwAAACIgAABkAAAAAP8BAGQAAAAAAAAAAABAAgAAAAAHAAAA///vAAAAAAD///////8s
AAAAAAMAABAAow98AAAABQD//T8AAQAiIAAAZAAAAAD/AABkABQAAADYAAAAQAIAAAAABwAAAP//
7wAAAAAA////////IAAAAAABAACABQAAEyDUASABAAACABwAgAUAACIg0AJAAgAAAgAYAIAFAAAT
IPADYAMAAAIAFACABQAAuwAQBYAEAAAAACAAow9uAAAABQD//T8AAAAiIAAAZAAAAAD/AABkAB4A
AAAAAAAAQAIAAAAABwAAAP//7wAAAAAA////////DAAAAAABAAAABQAAIAEgAQAAAAAABQAAQAJA
AgAAAAAABQAAYANgAwAAAAAABQAAgASABAAAAABQAKMPUgAAAAUAAAABCQAAAAABAAAAAAAAAAEA
AQkAAAAAAQAgAQAAAAACAAEJAAAAAAEAQAIAAAAAAwABCQAAAAABAGADAAAAAAQAAQkAAAAAAQCA
BAAAAABgAKMPDAAAAAEAAAAAAAAAAAAAAHAAow8+AAAABQAAAAAAAAAAAAIAHAABAAAAAAAAAAIA
GAACAAAAAAAAAAIAFAADAAAAAAAAAAIAEgAEAAAAAAAAAAIAEgCAAKMPPgAAAAUAAAAAAAAAAAAC
ABgAAQAAAAAAAAACABQAAgAAAAAAAAACABIAAwAAAAAAAAACABAABAAAAAAAAAACABAADwAMBNYE
AAAPAALwzgQAABAACPAIAAAABgAAAAYEAAAPAAPwZgQAAA8ABPAoAAAAAQAJ8BAAAAAAAAAAAAAA
AAAAAAAAAAAAAgAK8AgAAAAABAAABQAAAA8ABPDSAAAAEgAK8AgAAAACBAAAAAoAAJMAC/A2AAAA
fwABAAUAgABgsp4AhwABAAAAgQEEAAAIgwEAAAAIvwEBABEAwAEBAAAI/wEBAAkAAQICAAAIAAAQ
8AgAAACtACABYBV9Aw8AEfAQAAAAAADDCwgAAAAAAAAAAQCeAA8ADfBUAAAAAACfDwQAAAAAAAAA
AACoDyAAAABDbGljayB0byBlZGl0IE1hc3RlciB0aXRsZSBzdHlsZQAAog8GAAAAIQAAAAAAAACq
DwoAAAAhAAAAAQAAAAAADwAE8BYBAAASAArwCAAAAAMEAAAACgAAgwAL8DAAAAB/AAEABQCAAAzc
ngCBAQQAAAiDAQAAAAi/AQEAEQDAAQEAAAj/AQEACQABAgIAAAgAABDwCAAAAPADIAFgFRMPDwAR
8BAAAAAAAMMLCAAAAAEAAAACAJ4ADwAN8J4AAAAAAJ8PBAAAAAEAAAAAAKgPUgAAAENsaWNrIHRv
IGVkaXQgTWFzdGVyIHRleHQgc3R5bGVzDVNlY29uZCBsZXZlbA1UaGlyZCBsZXZlbA1Gb3VydGgg
bGV2ZWwNRmlmdGggbGV2ZWwAAKIPHgAAACEAAAAAAA0AAAABAAwAAAACAA0AAAADAAwAAAAEAAAA
qg8KAAAAUwAAAAEAAAAAAA8ABPC2AAAAEgAK8AgAAAAEBAAAAAoAAIMAC/AwAAAAfwABAAUAgACs
254AgQEEAAAIgwEAAAAIvwEBABEAwAEBAAAI/wEBAAkAAQICAAAIAAAQ8AgAAABeDyABYAaKEA8A
EfAQAAAAAADDCwgAAAACAAAABwGeAA8ADfA+AAAAAACfDwQAAAAEAAAAAACgDwIAAAAqAAAAoQ8U
AAAAAgAAAAAAAAAAAAIAAAAAAAIADgAAAPgPBAAAAAAAAAAPAATwuAAAABIACvAIAAAABQQAAAAK
AACDAAvwMAAAAH8AAQAFAIAAHO2eAIEBBAAACIMBAAAACL8BAQARAMABAQAACP8BAQAJAAECAgAA
CAAAEPAIAAAAXg+wB9AOihAPABHwEAAAAAAAwwsIAAAAAwAAAAkCngAPAA3wQAAAAAAAnw8EAAAA
BAAAAAAAoA8CAAAAKgAAAKEPFgAAAAIAAAAAAAAIAAABAAIAAAAAAAIADgAAAPoPBAAAAAAAAAAP
AATwuAAAABIACvAIAAAABgQAAAAKAACDAAvwMAAAAH8AAQAFAIAA4POeAIEBBAAACIMBAAAACL8B
AQARAMABAQAACP8BAQAJAAECAgAACAAAEPAIAAAAXg8gEGAVihAPABHwEAAAAAAAwwsIAAAABAAA
AAgCngAPAA3wQAAAAAAAnw8EAAAABAAAAAAAoA8CAAAAKgAAAKEPFgAAAAIAAAAAAAAIAAACAAIA
AAAAAAIADgAAANgPBAAAAAAAAAAPAATwSAAAABIACvAIAAAAAQQAAAAMAACDAAvwMAAAAIEBAAAA
CIMBBQAACJMBjp+LAJQB3r1oAL8BEgASAP8BAAAIAAQDCQAAAD8DAQABABAA8AcgAAAA////AAAA
AACAgIAAAAAAALvg4wAzM5kAAJmZAJnMAAAPAIgTOAAAAA8AihMwAAAAAAC6DxAAAABfAF8AXwBQ
AFAAVAAxADAAAACLExAAAAAAAOsuCAAAAPNaxAGgX04CIAC6DxwAAABEAGUAZgBhAHUAbAB0ACAA
RABlAHMAaQBnAG4ADwDwA/oFAAABAPEDCAAAAAAAAIAAAAowDwAMBHoFAAAPAALwcgUAAMAACPAI
AAAABwAAAAcwAAAPAAPwCgUAAA8ABPAoAAAAAQAJ8BAAAAAAAAAAAAAAAAAAAAAAAAAAAgAK8AgA
AAAAMAAABQAAAA8ABPDIAAAAEgAK8AgAAAACMAAAAAoAAIMAC/AwAAAAfwABAAUAgAC8Jh8DgQEE
AAAIgwEAAAAIvwEBABEAwAEBAAAI/wEBAAkAAQICAAAIAAAQ8AgAAAAAAAAAUAcgAQ8AEfAQAAAA
AADDCwgAAAAAAAAACgITBA8ADfBQAAAAAACfDwQAAAAEAAAAAACgDwIAAAAqAAAAoQ8UAAAAAgAA
AAAAAAAAAAIAAAAAAAIADAAAAPkPBAAAAAAAAAAAAKoPCgAAAAIAAAABAAAAAAAPAATwygAAABIA
CvAIAAAAAzAAAAAKAACDAAvwMAAAAH8AAQAFAIAAQC0fA4EBBAAACIMBAAAACL8BAQARAMABAQAA
CP8BAQAJAAECAgAACAAAEPAIAAAAAACPCd8QIAEPABHwEAAAAAAAwwsIAAAAAQAAAAcAEwQPAA3w
UgAAAAAAnw8EAAAABAAAAAAAoA8CAAAAKgAAAKEPFgAAAAIAAAAAAAAIAAACAAIAAAAAAAIADAAA
APgPBAAAAAAAAAAAAKoPCgAAAAIAAAABAAAAAAAPAATwZAAAABIACvAIAAAABDAAAAAKAABjAAvw
JAAAAH8ABAEEAYcAAQAAAH8BAAABAL8BEQARAP8BCAAJAD8CAQABAAAAEPAIAAAAsAHQAhAOIAoP
ABHwEAAAAAAAwwsIAAAAAgAAAAUAEwQPAATwFgEAABIACvAIAAAABTAAAAAKAACDAAvwMAAAAH8A
AQAFAIAAkDIfA4EBBAAACIMBAAAACL8BAQARAMABAQAACP8BAQAJAAECAgAACAAAEPAIAAAAsAqw
ATAP0BQPABHwEAAAAAAAwwsIAAAAAwAAAAYCEwQPAA3wngAAAAAAnw8EAAAAAgAAAAAAqA9SAAAA
Q2xpY2sgdG8gZWRpdCBNYXN0ZXIgdGV4dCBzdHlsZXMNU2Vjb25kIGxldmVsDVRoaXJkIGxldmVs
DUZvdXJ0aCBsZXZlbA1GaWZ0aCBsZXZlbAAAog8eAAAAIQAAAAAADQAAAAEADAAAAAIADQAAAAMA
DAAAAAQAAACqDwoAAABTAAAAAQAAAAAADwAE8M4AAAASAArwCAAAAAYwAAAACgAAkwAL8DYAAAB/
AAEABQCAALA6HwOHAAIAAACBAQQAAAiDAQAAAAi/AQEAEQDAAQEAAAj/AQEACQABAgIAAAgAABDw
CAAAAF8VAABQB38WDwAR8BAAAAAAAMMLCAAAAAQAAAAJAhMEDwAN8FAAAAAAAJ8PBAAAAAQAAAAA
AKAPAgAAACoAAAChDxQAAAACAAAAAAAAAAAAAgAAAAAAAgAMAAAA+g8EAAAAAAAAAAAAqg8KAAAA
AgAAAAEAAAAAAA8ABPDQAAAAEgAK8AgAAAAHMAAAAAoAAJMAC/A2AAAAfwABAAUAgAA0QR8DhwAC
AAAAgQEEAAAIgwEAAAAIvwEBABEAwAEBAAAI/wEBAAkAAQICAAAIAAAQ8AgAAABfFY8J3xB/Fg8A
EfAQAAAAAADDCwgAAAAFAAAACAITBA8ADfBSAAAAAACfDwQAAAAEAAAAAACgDwIAAAAqAAAAoQ8W
AAAAAgAAAAAAAAgAAAIAAgAAAAAAAgAMAAAA2A8EAAAAAAAAAAAAqg8KAAAAAgAAAAEAAAAAAA8A
BPBIAAAAEgAK8AgAAAABMAAAAAwAAIMAC/AwAAAAgQEAAAAIgwEFAAAIkwHevWgAlAGOn4sAvwES
ABIA/wEAAAgABAMJAAAAPwMBAAEAEADwByAAAAD///8AAAAAAICAgAAAAAAAu+DjADMzmQAAmZkA
mcwAAA8AiBM4AAAADwCKEzAAAAAAALoPEAAAAF8AXwBfAFAAUABUADEAMAAAAIsTEAAAAAAA6y4I
AAAA+FrEAcDLD0EPAMkPGAQAAA8ADASoAwAADwAC8KADAACwAAjwCAAAAAUAAAAFLAAADwAD8DgD
AAAPAATwKAAAAAEACfAQAAAAAAAAAAAAAAAAAAAAAAAAAAIACvAIAAAAACwAAAUAAAAPAATwtgAA
ABIACvAIAAAAAiwAAAAKAACDAAvwMAAAAH8AAQAFAIAA8AsfA4EBBAAACIMBAAAACL8BAQARAMAB
AQAACP8BAQAJAAECAgAACAAAEPAIAAAAAAAAAFAHIAEPABHwEAAAAAAAwwsIAAAAAAAAAAoCEwQP
AA3wPgAAAAAAnw8EAAAABAAAAAAAoA8CAAAAKgAAAKEPFAAAAAIAAAAAAAAAAAACAAAAAAACAAwA
AAD5DwQAAAAAAAAADwAE8LgAAAASAArwCAAAAAMsAAAACgAAgwAL8DAAAAB/AAEABQCAANwRHwOB
AQQAAAiDAQAAAAi/AQEAEQDAAQEAAAj/AQEACQABAgIAAAgAABDwCAAAAAAAjwnfECABDwAR8BAA
AAAAAMMLCAAAAAEAAAAHAhMEDwAN8EAAAAAAAJ8PBAAAAAQAAAAAAKAPAgAAACoAAAChDxYAAAAC
AAAAAAAACAAAAgACAAAAAAACAAwAAAD4DwQAAAAAAAAADwAE8LwAAAASAArwCAAAAAQsAAAACgAA
kwAL8DYAAAB/AAEABQCAAMwXHwOHAAIAAACBAQQAAAiDAQAAAAi/AQEAEQDAAQEAAAj/AQEACQAB
AgIAAAgAABDwCAAAAF8VAABQB38WDwAR8BAAAAAAAMMLCAAAAAIAAAAJAhMEDwAN8D4AAAAAAJ8P
BAAAAAQAAAAAAKAPAgAAACoAAAChDxQAAAACAAAAAAAAAAAAAgAAAAAAAgAMAAAA+g8EAAAAAAAA
AA8ABPC+AAAAEgAK8AgAAAAFLAAAAAoAAJMAC/A2AAAAfwABAAUAgABEHx8DhwACAAAAgQEEAAAI
gwEAAAAIvwEBABEAwAEBAAAI/wEBAAkAAQICAAAIAAAQ8AgAAABfFY8J3xB/Fg8AEfAQAAAAAADD
CwgAAAADAAAACAITBA8ADfBAAAAAAACfDwQAAAAEAAAAAACgDwIAAAAqAAAAoQ8WAAAAAgAAAAAA
AAgAAAIAAgAAAAAAAgAMAAAA2A8EAAAAAAAAAA8ABPBIAAAAEgAK8AgAAAABLAAAAAwAAIMAC/Aw
AAAAgQEAAAAIgwEFAAAIkwHevWgAlAGOn4sAvwESABIA/wEAAAgABAMJAAAAPwMBAAEAEADwByAA
AAD///8AAAAAAICAgAAAAAAAu+DjADMzmQAAmZkAmcwAAA8AiBM4AAAADwCKEzAAAAAAALoPEAAA
AF8AXwBfAFAAUABUADEAMAAAAIsTEAAAAAAA6y4IAAAA+FrEASBFDkEPAO4DPwYAAAIA7wMYAAAA
AAAAAA8QAAAAAAAAAAAAgAABAAAHABMADwAMBMABAAAPAALwuAEAACAACPAIAAAAAwAAAAMIAAAP
AAPwUAEAAA8ABPAoAAAAAQAJ8BAAAAAAAAAAAAAAAAAAAAAAAAAAAgAK8AgAAAAACAAABQAAAA8A
BPByAAAAEgAK8AgAAAACCAAAIAIAAFMAC/AeAAAAfwAAAAQAgAC4/J4AvwEAAAEA/wEAAAEAAQMC
BAAAAAAQ8AgAAAA+BbAB0BTcCA8AEfAQAAAAAADDCwgAAAAAAAAADwCeAA8ADfAMAAAAAACeDwQA
AAAAAAAADwAE8J4AAAASAArwCAAAAAMIAAAgAgAAUwAL8B4AAAB/AAAABACAAJT0ngC/AQAAAQD/
AQAAAQABAwMEAAAAABDwCAAAAJAJYAMgE+ANDwAR8DwAAAAPABQQJAAAAAEA8Q8cAAAAAAAABwAE
AAAAAAAAAAAAAAIAAQACAAAAAAAKMAAAwwsIAAAAAQAAABAAngAPAA3wDAAAAAAAng8EAAAAAQAA
AA8ABPBIAAAAEgAK8AgAAAABCAAAAAwAAIMAC/AwAAAAgQEAAAAIgwEFAAAIkwGOn4sAlAHevWgA
vwESABIA/wEAAAgABAMJAAAAPwMBAAEAEADwByAAAAD///8AAAAAAICAgAAAAAAAu+DjADMzmQAA
mZkAmcwAAA8AiBMnBAAADwCKEx8EAAAAALoPEAAAAF8AXwBfAFAAUABUADEAMAAAAIsT/wMAAAAA
6i4EAAAAAgAAAAAA6y4IAAAA81rEAQAOWQIAAAArBAAAAMVbV18fAETxjwMAAAAAJ/EgAAAAAAAA
AAMAAAAAAAAAAAAAAAAAAAAAuRMA/////xIAAAAPAD3xDQAAAEABQvEFAAAAAQkAAAAfAETxSgMA
AAAAJ/EgAAAAAAAAAAAAAAABAAAAAAAAAAAAAAAAAAAA/////xgAAAAPAD3xDQAAAEABQvEFAAAA
AQQAAAAAAEHxFAAAAAEAAAABAAAAAAAAAAAAAAADAAAAPwAl8SwAAAAAACjxEAAAAAEAAAAJAAAA
AAAAAAAAAAAPADzxDAAAAAAAASsEAAAAAQAAAE8AJfEsAAAAAAAo8RAAAAABAAAACgAAAAAAAAAA
AAAADwA88QwAAAAAAAErBAAAAAEAAAAfAETxgQIAAAAAJ/EgAAAAAAAAAAAAAAAAAAAAAwAAAAAA
AAAAtxMAAAAAAAEAAAAPAD3xAAAAAB8AJfEYAAAAAAAo8RAAAAAAAAAAAAAAAAAAAAD/////HwBE
8SkCAAAAACfxIAAAAAAAAAAAAAAAAAAAAAMAAAAAAAAAAAAAAAAAAAABAAAADwA98QAAAAAfACXx
GAAAAAAAKPEQAAAAAAAAAAAAAAAAAAAAAAAAAB8ARPHRAQAAAAAn8SAAAAAAAAAAAAAAAAAAAAAD
AAAAAAAAAAAAAAAAAAAAAQAAAA8APfFBAAAAkABC8QUAAAABAQAAAKAAQvEFAAAAAQAAAACwAELx
BQAAAAEBAAAAQAFC8QUAAAABAQAAADABQvEFAAAAAQAAAAAfACXxGAAAAAAAKPEQAAAAAAAAAAAA
AAAAAAAAAAAAAAAAKfEIAAAAAwAAAAAAAAAAACnxCAAAAAQAAAAAAAAAAAAp8QgAAAAFAAAAAAAA
AAAAKfEIAAAAAAAAAAAAgD8fAETx+AAAAAAAJ/EgAAAAAAAAAAAAAAADAAAAAwAAAAAAAAAAtRMA
AQAAABkAAAAPAD3xAAAAAA8AMfGgAAAAAAA68QgAAAABAAAAAQAAABAAQvERAAAAA3YAaQBzAGkA
YgBsAGUAAAAPACrxbwAAAAAAM/EQAAAABAAAAAAAAAAAAAAAAAAAAB8APvErAAAAAABC8SMAAAAD
cwB0AHkAbABlAC4AdgBpAHMAaQBiAGkAbABpAHQAeQAAAA8APPEcAAAAAAD7KhQAAAACAAAAAQAA
AAMIAAAAAAAAHgAAAB8AJfEYAAAAAAAo8RAAAAAAAAAAAAAAAAAAAAAAAAAADwACKzgAAAAPAAgr
MAAAAAAAAysQAAAAAQAAAAAAAAADCAAAAQDfBAEACSsQAAAAAQAAAAEAAAAAAAAAAAAAAA8A7gO/
BgAAAgDvAxgAAAABAAAADQ4AAAAAAAAAAACAAQEAAAcAEwAPAAwEFgIAAA8AAvAOAgAAMAAI8AgA
AAADAAAAOQwAAA8AA/CmAQAADwAE8CgAAAABAAnwEAAAAAAAAAAAAAAAAAAAAAAAAAACAArwCAAA
AAAMAAAFAAAADwAE8HIAAAASAArwCAAAAAIMAAAgAgAAUwAL8B4AAAB/AAAABACAABjrggK/AQAA
AQD/AQAAAQABAwIEAAAAABDwCAAAAK0AIAFgFX0DDwAR8BAAAAAAAMMLCAAAAAAAAAANAIICDwAN
8AwAAAAAAJ4PBAAAAAAAAAAPAATw9AAAALIECvAIAAAAAwwAACAKAACTAAvwNgAAAH8AAAAEAIAA
eO6CAr8AAAACAARBAQAAAIIBAAABAIQBAAABAL8BAAABAP8BAAABAAEDAwQAABMAIvEGAAAAvwEA
AGAAAAAQ8AgAAAACBHQDHBMrDw8AEfA8AAAADwAUECQAAAABAPEPHAAAAAAAAAcABAAAAAAAAAAA
AAACAAEAAgAAAAAACjAAAMMLCAAAAAEAAAAOAIICDwAN8DwAAAAAAJ8PBAAAAAEAAAAAAKEPFAAA
AAEAAAAAAAEAAAAAAAEAAAAAAAAAAACqDwwAAAABAAAABgAAAAkQAAAPAATwSAAAABIACvAIAAAA
AQwAAAAMAACDAAvwMAAAAIEBAAAACIMBBQAACJMBjp+LAJQB3r1oAL8BEgASAP8BAAAIAAQDCQAA
AD8DAQABABAA8AcgAAAA////AAAAAACAgIAAAAAAALvg4wAzM5kAAJmZAJnMAAAPAIgTUQQAAA8A
ihNJBAAAAAC6DxAAAABfAF8AXwBQAFAAVAAxADAAAACLEykEAAAAAOouBAAAAAIAAAAAAOsuCAAA
APNaxAFw8zlOAAAAKwQAAADFW1dfHwBE8bkDAAAAACfxIAAAAAAAAAADAAAAAAAAAAAAAAAAAAAA
ALkTAP////8SAAAADwA98Q0AAABAAULxBQAAAAEJAAAAHwBE8XQDAAAAACfxIAAAAAAAAAAAAAAA
AQAAAAAAAAAAAAAAAAAAAP////8YAAAADwA98Q0AAABAAULxBQAAAAEEAAAAAABB8RQAAAABAAAA
AQAAAAAAAAAAAAAAAwAAAD8AJfEsAAAAAAAo8RAAAAABAAAACQAAAAAAAAAAAAAADwA88QwAAAAA
AAErBAAAAAEAAABPACXxLAAAAAAAKPEQAAAAAQAAAAoAAAAAAAAAAAAAAA8APPEMAAAAAAABKwQA
AAABAAAAHwBE8asCAAAAACfxIAAAAAAAAAAAAAAAAAAAAAMAAAAAAAAAALcTAAAAAAABAAAADwA9
8QAAAAAfACXxGAAAAAAAKPEQAAAAAAAAAAAAAAAAAAAA/////x8ARPFTAgAAAAAn8SAAAAAAAAAA
AAAAAAAAAAADAAAAAAAAAAAAAAAAAAAAAQAAAA8APfEAAAAAHwAl8RgAAAAAACjxEAAAAAAAAAAA
AAAAAAAAAAAAAAAfAETx+wEAAAAAJ/EgAAAAAAAAAAAAAAAAAAAAAwAAAAAAAAAAAAAAAAAAAAEA
AAAPAD3xSwAAAJAAQvEFAAAAAQEAAACgAELxBQAAAAEAAAAAsABC8QUAAAABAQAAAEABQvEFAAAA
AQEAAABQAULxAgAAAAABMAFC8QUAAAABAAAAAB8AJfEYAAAAAAAo8RAAAAAAAAAAAAAAAAAAAAAA
AAAALwAl8RgAAAAAACjxEAAAAAIAAAADAAAABQAAAAAAAAAAACnxCAAAAAMAAAAAAAAAAAAp8QgA
AAAEAAAAAAAAAAAAKfEIAAAABQAAAAAAAAAAACnxCAAAAAAAAAAAAIA/HwBE8fgAAAAAACfxIAAA
AAAAAAAAAAAAAwAAAAMAAAAAAAAAALUTAAEAAAAZAAAADwA98QAAAAAPADHxoAAAAAAAOvEIAAAA
AQAAAAEAAAAQAELxEQAAAAN2AGkAcwBpAGIAbABlAAAADwAq8W8AAAAAADPxEAAAAAQAAAAAAAAA
AAAAAAAAAAAfAD7xKwAAAAAAQvEjAAAAA3MAdAB5AGwAZQAuAHYAaQBzAGkAYgBpAGwAaQB0AHkA
AAAPADzxHAAAAAAA+yoUAAAAAgAAAAEAAAADDAAAAAAAAAEAAAAfACXxGAAAAAAAKPEQAAAAAAAA
AAAAAAAAAAAAAAAAAA8AAis4AAAADwAIKzAAAAAAAAMrEAAAAAEAAAAAAAAAAwwAAAEA3wQBAAkr
EAAAAAEAAAABAAAAAAAAAAAAAAAPAO4DKg0AAAIA7wMYAAAAAQAAAA0OAAAAAAAAAAAAgAIBAAAH
ABMADwAMBMABAAAPAALwuAEAAHAACPAIAAAAAwAAAAUcAAAPAAPwUAEAAA8ABPAoAAAAAQAJ8BAA
AAAAAAAAAAAAAAAAAAAAAAAAAgAK8AgAAAAAHAAABQAAAA8ABPByAAAAEgAK8AgAAAAEHAAAIAIA
AFMAC/AeAAAAfwAAAAQAgADAAx8DvwEAAAEA/wEAAAEAAQMCBAAAAAAQ8AgAAACtACABYBV9Aw8A
EfAQAAAAAADDCwgAAAAAAAAADQAQBA8ADfAMAAAAAACeDwQAAAAAAAAADwAE8J4AAAASAArwCAAA
AAUcAAAgAgAAUwAL8B4AAAB/AAAABACAAKAAHwO/AQAAAQD/AQAAAQABAwMEAAAAABDwCAAAAPAD
IAFgFRMPDwAR8DwAAAAPABQQJAAAAAEA8Q8cAAAAAAAABwAAAAAAAAAAAAAAAAIAAQACAAAAAAAK
MAAAwwsIAAAAAQAAAA4AEwQPAA3wDAAAAAAAng8EAAAAAQAAAA8ABPBIAAAAEgAK8AgAAAABHAAA
AAwAAIMAC/AwAAAAgQEAAAAIgwEFAAAIkwGOn4sAlAHevWgAvwESABIA/wEAAAgABAMJAAAAPwMB
AAEAEADwByAAAAD///8AAAAAAICAgAAAAAAAu+DjADMzmQAAmZkAmcwAAA8AiBMSCwAADwCKEwoL
AAAAALoPEAAAAF8AXwBfAFAAUABUADEAMAAAAIsT6goAAAAA6i4EAAAAAgAAAAAA6y4IAAAA9FrE
AVBbdUcAAAArBAAAAN1uDCkfAETxegoAAAAAJ/EgAAAAAAAAAAMAAAAAAAAAAAAAAAAAAAAAuRMA
/////xIAAAAPAD3xDQAAAEABQvEFAAAAAQkAAAAfAETxNQoAAAAAJ/EgAAAAAAAAAAAAAAABAAAA
AAAAAAAAAAAAAAAA/////xgAAAAPAD3xDQAAAEABQvEFAAAAAQQAAAAAAEHxFAAAAAEAAAABAAAA
AAAAAAAAAAADAAAAPwAl8SwAAAAAACjxEAAAAAEAAAAJAAAAAAAAAAAAAAAPADzxDAAAAAAAASsE
AAAAAQAAAE8AJfEsAAAAAAAo8RAAAAABAAAACgAAAAAAAAAAAAAADwA88QwAAAAAAAErBAAAAAEA
AAAfAETxWgQAAAAAJ/EgAAAAAAAAAAAAAAAAAAAAAwAAAAAAAAAAtxMAAAAAAAEAAAAPAD3xAAAA
AB8AJfEYAAAAAAAo8RAAAAAAAAAAAAAAAAAAAAD/////HwBE8QIEAAAAACfxIAAAAAAAAAAAAAAA
AAAAAAMAAAAAAAAAAAAAAAAAAAABAAAADwA98QAAAAAfACXxGAAAAAAAKPEQAAAAAAAAAAAAAAAA
AAAAAAAAAB8ARPHRAQAAAAAn8SAAAAAAAAAAAAAAAAAAAAADAAAAAAAAAAAAAAAAAAAAAQAAAA8A
PfFBAAAAkABC8QUAAAABAQAAAKAAQvEFAAAAAQAAAACwAELxBQAAAAEBAAAAQAFC8QUAAAABAQAA
ADABQvEFAAAAAQAAAAAfACXxGAAAAAAAKPEQAAAAAAAAAAAAAAAAAAAAAAAAAAAAKfEIAAAAAwAA
AAAAAAAAACnxCAAAAAQAAAAAAAAAAAAp8QgAAAAFAAAAAAAAAAAAKfEIAAAAAAAAAAAAgD8fAETx
+AAAAAAAJ/EgAAAAAAAAAAAAAAADAAAAAwAAAAAAAAAAtRMAAQAAABkAAAAPAD3xAAAAAA8AMfGg
AAAAAAA68QgAAAABAAAAAQAAABAAQvERAAAAA3YAaQBzAGkAYgBsAGUAAAAPACrxbwAAAAAAM/EQ
AAAABAAAAAAAAAAAAAAAAAAAAB8APvErAAAAAABC8SMAAAADcwB0AHkAbABlAC4AdgBpAHMAaQBi
AGkAbABpAHQAeQAAAA8APPEcAAAAAAD7KhQAAAACAAAAAQAAAAUcAAAAAAAATQAAAB8AJfEYAAAA
AAAo8RAAAAAAAAAAAAAAAAAAAAAAAAAAHwBE8dEBAAAAACfxIAAAAAAAAAAAAAAAAAAAAAMAAAAA
AAAAAAAAAAAAAAABAAAADwA98UEAAACQAELxBQAAAAEBAAAAoABC8QUAAAABAAAAALAAQvEFAAAA
AQEAAABAAULxBQAAAAECAAAAMAFC8QUAAAABAAAAAB8AJfEYAAAAAAAo8RAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAp8QgAAAADAAAAAAAAAAAAKfEIAAAABAAAAAAAAAAAACnxCAAAAAUAAAAAAAAAAAAp
8QgAAAAAAAAAAACAPx8ARPH4AAAAAAAn8SAAAAAAAAAAAAAAAAMAAAADAAAAAAAAAAC1EwABAAAA
GQAAAA8APfEAAAAADwAx8aAAAAAAADrxCAAAAAEAAAABAAAAEABC8REAAAADdgBpAHMAaQBiAGwA
ZQAAAA8AKvFvAAAAAAAz8RAAAAAEAAAAAAAAAAAAAAAAAAAAHwA+8SsAAAAAAELxIwAAAANzAHQA
eQBsAGUALgB2AGkAcwBpAGIAaQBsAGkAdAB5AAAADwA88RwAAAAAAPsqFAAAAAIAAAABAAAABRwA
AE0AAAD+AAAAHwAl8RgAAAAAACjxEAAAAAAAAAAAAAAAAAAAAAAAAAAfAETxgQIAAAAAJ/EgAAAA
AAAAAAAAAAAAAAAAAwAAAAAAAAAAtxMAAAAAAAEAAAAPAD3xAAAAAB8AJfEYAAAAAAAo8RAAAAAA
AAAAAAAAAAAAAAD/////HwBE8SkCAAAAACfxIAAAAAAAAAAAAAAAAAAAAAMAAAAAAAAAAAAAAAAA
AAABAAAADwA98QAAAAAfACXxGAAAAAAAKPEQAAAAAAAAAAAAAAAAAAAAAAAAAB8ARPHRAQAAAAAn
8SAAAAAAAAAAAAAAAAAAAAADAAAAAAAAAAAAAAAAAAAAAQAAAA8APfFBAAAAkABC8QUAAAABAQAA
AKAAQvEFAAAAAQAAAACwAELxBQAAAAEBAAAAQAFC8QUAAAABAQAAADABQvEFAAAAAQAAAAAfACXx
GAAAAAAAKPEQAAAAAAAAAAAAAAAAAAAAAAAAAAAAKfEIAAAAAwAAAAAAAAAAACnxCAAAAAQAAAAA
AAAAAAAp8QgAAAAFAAAAAAAAAAAAKfEIAAAAAAAAAAAAgD8fAETx+AAAAAAAJ/EgAAAAAAAAAAAA
AAADAAAAAwAAAAAAAAAAtRMAAQAAABkAAAAPAD3xAAAAAA8AMfGgAAAAAAA68QgAAAABAAAAAQAA
ABAAQvERAAAAA3YAaQBzAGkAYgBsAGUAAAAPACrxbwAAAAAAM/EQAAAABAAAAAAAAAAAAAAAAAAA
AB8APvErAAAAAABC8SMAAAADcwB0AHkAbABlAC4AdgBpAHMAaQBiAGkAbABpAHQAeQAAAA8APPEc
AAAAAAD7KhQAAAACAAAAAQAAAAUcAAD+AAAAcQEAAB8AJfEYAAAAAAAo8RAAAAAAAAAAAAAAAAAA
AAAAAAAAHwBE8YECAAAAACfxIAAAAAAAAAAAAAAAAAAAAAMAAAAAAAAAALcTAAAAAAABAAAADwA9
8QAAAAAfACXxGAAAAAAAKPEQAAAAAAAAAAAAAAAAAAAA/////x8ARPEpAgAAAAAn8SAAAAAAAAAA
AAAAAAAAAAADAAAAAAAAAAAAAAAAAAAAAQAAAA8APfEAAAAAHwAl8RgAAAAAACjxEAAAAAAAAAAA
AAAAAAAAAAAAAAAfAETx0QEAAAAAJ/EgAAAAAAAAAAAAAAAAAAAAAwAAAAAAAAAAAAAAAAAAAAEA
AAAPAD3xQQAAAJAAQvEFAAAAAQEAAACgAELxBQAAAAEAAAAAsABC8QUAAAABAQAAAEABQvEFAAAA
AQEAAAAwAULxBQAAAAEAAAAAHwAl8RgAAAAAACjxEAAAAAAAAAAAAAAAAAAAAAAAAAAAACnxCAAA
AAMAAAAAAAAAAAAp8QgAAAAEAAAAAAAAAAAAKfEIAAAABQAAAAAAAAAAACnxCAAAAAAAAAAAAIA/
HwBE8fgAAAAAACfxIAAAAAAAAAAAAAAAAwAAAAMAAAAAAAAAALUTAAEAAAAZAAAADwA98QAAAAAP
ADHxoAAAAAAAOvEIAAAAAQAAAAEAAAAQAELxEQAAAAN2AGkAcwBpAGIAbABlAAAADwAq8W8AAAAA
ADPxEAAAAAQAAAAAAAAAAAAAAAAAAAAfAD7xKwAAAAAAQvEjAAAAA3MAdAB5AGwAZQAuAHYAaQBz
AGkAYgBpAGwAaQB0AHkAAAAPADzxHAAAAAAA+yoUAAAAAgAAAAEAAAAFHAAAcQEAAN0BAAAfACXx
GAAAAAAAKPEQAAAAAAAAAAAAAAAAAAAAAAAAAA8AAis4AAAADwAIKzAAAAAAAAMrEAAAAAEAAAAA
AAAABRwAAAEA3wQBAAkrEAAAAAEAAAABAAAAAAAAAAAAAAAPAO4DFwcAAAIA7wMYAAAAAQAAAA0O
AAAAAAAAAAAAgAMBAAAHABMADwAMBJgCAAAPAALwkAIAAFAACPAIAAAABAAAAAcUAAAPAAPwKAIA
AA8ABPAoAAAAAQAJ8BAAAAAAAAAAAAAAAAAAAAAAAAAAAgAK8AgAAAAAFAAABQAAAA8ABPByAAAA
EgAK8AgAAAAFFAAAIAIAAFMAC/AeAAAAfwAAAAQAgAAMVBMEvwEAAAEA/wEAAAEAAQMCBAAAAAAQ
8AgAAACtACABYBV9Aw8AEfAQAAAAAADDCwgAAAAAAAAADQATBA8ADfAMAAAAAACeDwQAAAAAAAAA
DwAE8J4AAAASAArwCAAAAAcUAAAgAgAAUwAL8B4AAAB/AAAABACAAFSLHwO/AQAAAQD/AQAAAQAB
AwMEAAAAABDwCAAAAPADIAFgFRMPDwAR8DwAAAAPABQQJAAAAAEA8Q8cAAAAAAAABwAEAAAAAAAA
AAAAAAIAAQACAAAAAAAKMAAAwwsIAAAAAQAAAA4AHwMPAA3wDAAAAAAAng8EAAAAAQAAAA8ABPDQ
AAAAsgQK8AgAAAAEFAAAIAoAAOMAC/CQAAAABAAAAAAAfwAEAAUABEECAAAABcE6AAAABgEBAAAA
gQH///8AgwH///8AvwEAAAEAwAEAAAAA/wEAAAkAAQKAgIAAAQMDBAAAgcMCAAAAiAMAAAAARQBN
AEwAMgAwADAANABQAHIAbwBjAGUAcwBzAFUAcwBlAHIATwBuAGwAaQBuAGUAaABlAGwAcAAAAAAA
AAAQ8AgAAADVA0cD9RJnDg8AEfAQAAAAAADDCwgAAAD/////EwATBA8ABPBIAAAAEgAK8AgAAAAB
FAAAAAwAAIMAC/AwAAAAgQEAAAAIgwEFAAAIkwGOn4sAlAHevWgAvwESABIA/wEAAAgABAMJAAAA
PwMBAAEAEADwByAAAAD///8AAAAAAICAgAAAAAAAu+DjADMzmQAAmZkAmcwAAA8AiBMnBAAADwCK
Ex8EAAAAALoPEAAAAF8AXwBfAFAAUABUADEAMAAAAIsT/wMAAAAA6i4EAAAAAgAAAAAA6y4IAAAA
9FrEAYCHbiQAAAArBAAAAMyygH8fAETxjwMAAAAAJ/EgAAAAAAAAAAMAAAAAAAAAAAAAAAAAAAAA
uRMA/////xIAAAAPAD3xDQAAAEABQvEFAAAAAQkAAAAfAETxSgMAAAAAJ/EgAAAAAAAAAAAAAAAB
AAAAAAAAAAAAAAAAAAAA/////xgAAAAPAD3xDQAAAEABQvEFAAAAAQQAAAAAAEHxFAAAAAEAAAAB
AAAAAAAAAAAAAAADAAAAPwAl8SwAAAAAACjxEAAAAAEAAAAJAAAAAAAAAAAAAAAPADzxDAAAAAAA
ASsEAAAAAQAAAE8AJfEsAAAAAAAo8RAAAAABAAAACgAAAAAAAAAAAAAADwA88QwAAAAAAAErBAAA
AAEAAAAfAETxgQIAAAAAJ/EgAAAAAAAAAAAAAAAAAAAAAwAAAAAAAAAAtxMAAAAAAAEAAAAPAD3x
AAAAAB8AJfEYAAAAAAAo8RAAAAAAAAAAAAAAAAAAAAD/////HwBE8SkCAAAAACfxIAAAAAAAAAAA
AAAAAAAAAAMAAAAAAAAAAAAAAAAAAAABAAAADwA98QAAAAAfACXxGAAAAAAAKPEQAAAAAAAAAAAA
AAAAAAAAAAAAAB8ARPHRAQAAAAAn8SAAAAAAAAAAAAAAAAAAAAADAAAAAAAAAAAAAAAAAAAAAQAA
AA8APfFBAAAAkABC8QUAAAABAQAAAKAAQvEFAAAAAQAAAACwAELxBQAAAAEBAAAAQAFC8QUAAAAB
AQAAADABQvEFAAAAAQAAAAAfACXxGAAAAAAAKPEQAAAAAAAAAAAAAAAAAAAAAAAAAAAAKfEIAAAA
AwAAAAAAAAAAACnxCAAAAAQAAAAAAAAAAAAp8QgAAAAFAAAAAAAAAAAAKfEIAAAAAAAAAAAAgD8f
AETx+AAAAAAAJ/EgAAAAAAAAAAAAAAADAAAAAwAAAAAAAAAAtRMAAQAAABkAAAAPAD3xAAAAAA8A
MfGgAAAAAAA68QgAAAABAAAAAQAAABAAQvERAAAAA3YAaQBzAGkAYgBsAGUAAAAPACrxbwAAAAAA
M/EQAAAABAAAAAAAAAAAAAAAAAAAAB8APvErAAAAAABC8SMAAAADcwB0AHkAbABlAC4AdgBpAHMA
aQBiAGkAbABpAHQAeQAAAA8APPEcAAAAAAD7KhQAAAACAAAAAQAAAAcUAAAAAAAAAgAAAB8AJfEY
AAAAAAAo8RAAAAAAAAAAAAAAAAAAAAAAAAAADwACKzgAAAAPAAgrMAAAAAAAAysQAAAAAQAAAAAA
AAAHFAAAAQDeBAEACSsQAAAAAQAAAAEAAAAAAAAAAAAAAA8A7gNTDgAAAgDvAxgAAAABAAAADQ4A
AAAAAAAAAACABAEAAAcAEwAPAAwEwAEAAA8AAvC4AQAAoAAI8AgAAAADAAAAAygAAA8AA/BQAQAA
DwAE8CgAAAABAAnwEAAAAAAAAAAAAAAAAAAAAAAAAAACAArwCAAAAAAoAAAFAAAADwAE8HIAAAAS
AArwCAAAAAIoAAAgAgAAUwAL8B4AAAB/AAAABACAAHhWEwS/AQAAAQD/AQAAAQABAwIEAAAAABDw
CAAAAK0AIAFgFX0DDwAR8BAAAAAAAMMLCAAAAAAAAAANABMEDwAN8AwAAAAAAJ4PBAAAAAAAAAAP
AATwngAAABIACvAIAAAAAygAACACAABTAAvwHgAAAH8AAAAEAIAApDoTBL8BAAABAP8BAAABAAED
AwQAAAAAEPAIAAAA8AMgAWAVEw8PABHwPAAAAA8AFBAkAAAAAQDxDxwAAAAAAAAHAAAAAAAAAAAA
AAAAAgABAAIAAAAAAAowAADDCwgAAAABAAAADgATBA8ADfAMAAAAAACeDwQAAAABAAAADwAE8EgA
AAASAArwCAAAAAEoAAAADAAAgwAL8DAAAACBAQAAAAiDAQUAAAiTAY6fiwCUAd69aAC/ARIAEgD/
AQAACAAEAwkAAAA/AwEAAQAQAPAHIAAAAP///wAAAAAAgICAAAAAAAC74OMAMzOZAACZmQCZzAAA
DwCIEzsMAAAPAIoTMwwAAAAAug8QAAAAXwBfAF8AUABQAFQAMQAwAAAAixMTDAAAAADqLgQAAAAC
AAAAAADrLggAAAD1WsQBoCsaDgAAACsEAAAAz0aV8R8ARPGjCwAAAAAn8SAAAAAAAAAAAwAAAAAA
AAAAAAAAAAAAAAC5EwD/////EgAAAA8APfENAAAAQAFC8QUAAAABCQAAAB8ARPFeCwAAAAAn8SAA
AAAAAAAAAAAAAAEAAAAAAAAAAAAAAAAAAAD/////GAAAAA8APfENAAAAQAFC8QUAAAABBAAAAAAA
QfEUAAAAAQAAAAEAAAAAAAAAAAAAAAMAAAA/ACXxLAAAAAAAKPEQAAAAAQAAAAkAAAAAAAAAAAAA
AA8APPEMAAAAAAABKwQAAAABAAAATwAl8SwAAAAAACjxEAAAAAEAAAAKAAAAAAAAAAAAAAAPADzx
DAAAAAAAASsEAAAAAQAAAB8ARPEMCAAAAAAn8SAAAAAAAAAAAAAAAAAAAAADAAAAAAAAAAC3EwAA
AAAAAQAAAA8APfEAAAAAHwAl8RgAAAAAACjxEAAAAAAAAAAAAAAAAAAAAP////8fAETxtAcAAAAA
J/EgAAAAAAAAAAAAAAAAAAAAAwAAAAAAAAAAAAAAAAAAAAEAAAAPAD3xAAAAAB8AJfEYAAAAAAAo
8RAAAAAAAAAAAAAAAAAAAAAAAAAAHwBE8dEBAAAAACfxIAAAAAAAAAAAAAAAAAAAAAMAAAAAAAAA
AAAAAAAAAAABAAAADwA98UEAAACQAELxBQAAAAEBAAAAoABC8QUAAAABAAAAALAAQvEFAAAAAQEA
AABAAULxBQAAAAEBAAAAMAFC8QUAAAABAAAAAB8AJfEYAAAAAAAo8RAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAp8QgAAAADAAAAAAAAAAAAKfEIAAAABAAAAAAAAAAAACnxCAAAAAUAAAAAAAAAAAAp8QgA
AAAAAAAAAACAPx8ARPH4AAAAAAAn8SAAAAAAAAAAAAAAAAMAAAADAAAAAAAAAAC1EwABAAAAGQAA
AA8APfEAAAAADwAx8aAAAAAAADrxCAAAAAEAAAABAAAAEABC8REAAAADdgBpAHMAaQBiAGwAZQAA
AA8AKvFvAAAAAAAz8RAAAAAEAAAAAAAAAAAAAAAAAAAAHwA+8SsAAAAAAELxIwAAAANzAHQAeQBs
AGUALgB2AGkAcwBpAGIAaQBsAGkAdAB5AAAADwA88RwAAAAAAPsqFAAAAAIAAAABAAAAAygAAAAA
AACHAAAAHwAl8RgAAAAAACjxEAAAAAAAAAAAAAAAAAAAAAAAAAAfAETx0QEAAAAAJ/EgAAAAAAAA
AAAAAAAAAAAAAwAAAAAAAAAAAAAAAAAAAAEAAAAPAD3xQQAAAJAAQvEFAAAAAQEAAACgAELxBQAA
AAEAAAAAsABC8QUAAAABAQAAAEABQvEFAAAAAQIAAAAwAULxBQAAAAEAAAAAHwAl8RgAAAAAACjx
EAAAAAAAAAAAAAAAAAAAAAAAAAAAACnxCAAAAAMAAAAAAAAAAAAp8QgAAAAEAAAAAAAAAAAAKfEI
AAAABQAAAAAAAAAAACnxCAAAAAAAAAAAAIA/HwBE8fgAAAAAACfxIAAAAAAAAAAAAAAAAwAAAAMA
AAAAAAAAALUTAAEAAAAZAAAADwA98QAAAAAPADHxoAAAAAAAOvEIAAAAAQAAAAEAAAAQAELxEQAA
AAN2AGkAcwBpAGIAbABlAAAADwAq8W8AAAAAADPxEAAAAAQAAAAAAAAAAAAAAAAAAAAfAD7xKwAA
AAAAQvEjAAAAA3MAdAB5AGwAZQAuAHYAaQBzAGkAYgBpAGwAaQB0AHkAAAAPADzxHAAAAAAA+yoU
AAAAAgAAAAEAAAADKAAAhwAAAJwAAAAfACXxGAAAAAAAKPEQAAAAAAAAAAAAAAAAAAAAAAAAAB8A
RPHRAQAAAAAn8SAAAAAAAAAAAAAAAAAAAAADAAAAAAAAAAAAAAAAAAAAAQAAAA8APfFBAAAAkABC
8QUAAAABAQAAAKAAQvEFAAAAAQAAAACwAELxBQAAAAEBAAAAQAFC8QUAAAABAgAAADABQvEFAAAA
AQAAAAAfACXxGAAAAAAAKPEQAAAAAAAAAAAAAAAAAAAAAAAAAAAAKfEIAAAAAwAAAAAAAAAAACnx
CAAAAAQAAAAAAAAAAAAp8QgAAAAFAAAAAAAAAAAAKfEIAAAAAAAAAAAAgD8fAETx+AAAAAAAJ/Eg
AAAAAAAAAAAAAAADAAAAAwAAAAAAAAAAtRMAAQAAABkAAAAPAD3xAAAAAA8AMfGgAAAAAAA68QgA
AAABAAAAAQAAABAAQvERAAAAA3YAaQBzAGkAYgBsAGUAAAAPACrxbwAAAAAAM/EQAAAABAAAAAAA
AAAAAAAAAAAAAB8APvErAAAAAABC8SMAAAADcwB0AHkAbABlAC4AdgBpAHMAaQBiAGkAbABpAHQA
eQAAAA8APPEcAAAAAAD7KhQAAAACAAAAAQAAAAMoAACcAAAApgAAAB8AJfEYAAAAAAAo8RAAAAAA
AAAAAAAAAAAAAAAAAAAAHwBE8dEBAAAAACfxIAAAAAAAAAAAAAAAAAAAAAMAAAAAAAAAAAAAAAAA
AAABAAAADwA98UEAAACQAELxBQAAAAEBAAAAoABC8QUAAAABAAAAALAAQvEFAAAAAQEAAABAAULx
BQAAAAECAAAAMAFC8QUAAAABAAAAAB8AJfEYAAAAAAAo8RAAAAAAAAAAAAAAAAAAAAAAAAAAAAAp
8QgAAAADAAAAAAAAAAAAKfEIAAAABAAAAAAAAAAAACnxCAAAAAUAAAAAAAAAAAAp8QgAAAAAAAAA
AACAPx8ARPH4AAAAAAAn8SAAAAAAAAAAAAAAAAMAAAADAAAAAAAAAAC1EwABAAAAGQAAAA8APfEA
AAAADwAx8aAAAAAAADrxCAAAAAEAAAABAAAAEABC8REAAAADdgBpAHMAaQBiAGwAZQAAAA8AKvFv
AAAAAAAz8RAAAAAEAAAAAAAAAAAAAAAAAAAAHwA+8SsAAAAAAELxIwAAAANzAHQAeQBsAGUALgB2
AGkAcwBpAGIAaQBsAGkAdAB5AAAADwA88RwAAAAAAPsqFAAAAAIAAAABAAAAAygAAKYAAAC5AAAA
HwAl8RgAAAAAACjxEAAAAAAAAAAAAAAAAAAAAAAAAAAfAETxgQIAAAAAJ/EgAAAAAAAAAAAAAAAA
AAAAAwAAAAAAAAAAtxMAAAAAAAEAAAAPAD3xAAAAAB8AJfEYAAAAAAAo8RAAAAAAAAAAAAAAAAAA
AAD/////HwBE8SkCAAAAACfxIAAAAAAAAAAAAAAAAAAAAAMAAAAAAAAAAAAAAAAAAAABAAAADwA9
8QAAAAAfACXxGAAAAAAAKPEQAAAAAAAAAAAAAAAAAAAAAAAAAB8ARPHRAQAAAAAn8SAAAAAAAAAA
AAAAAAAAAAADAAAAAAAAAAAAAAAAAAAAAQAAAA8APfFBAAAAkABC8QUAAAABAQAAAKAAQvEFAAAA
AQAAAACwAELxBQAAAAEBAAAAQAFC8QUAAAABAQAAADABQvEFAAAAAQAAAAAfACXxGAAAAAAAKPEQ
AAAAAAAAAAAAAAAAAAAAAAAAAAAAKfEIAAAAAwAAAAAAAAAAACnxCAAAAAQAAAAAAAAAAAAp8QgA
AAAFAAAAAAAAAAAAKfEIAAAAAAAAAAAAgD8fAETx+AAAAAAAJ/EgAAAAAAAAAAAAAAADAAAAAwAA
AAAAAAAAtRMAAQAAABkAAAAPAD3xAAAAAA8AMfGgAAAAAAA68QgAAAABAAAAAQAAABAAQvERAAAA
A3YAaQBzAGkAYgBsAGUAAAAPACrxbwAAAAAAM/EQAAAABAAAAAAAAAAAAAAAAAAAAB8APvErAAAA
AABC8SMAAAADcwB0AHkAbABlAC4AdgBpAHMAaQBiAGkAbABpAHQAeQAAAA8APPEcAAAAAAD7KhQA
AAACAAAAAQAAAAMoAAC5AAAAgQEAAB8AJfEYAAAAAAAo8RAAAAAAAAAAAAAAAAAAAAAAAAAADwAC
KzgAAAAPAAgrMAAAAAAAAysQAAAAAQAAAAAAAAADKAAAAQDeBAEACSsQAAAAAQAAAAEAAAAAAAAA
AAAAAA8A7gP7AgAAAgDvAxgAAAABAAAADQ4AAAAAAAAAAACAAAAAAAcAEwAPAAwEBgIAAA8AAvD+
AQAAMAEI8AgAAAADAAAABkwAAA8AA/CWAQAADwAE8CgAAAABAAnwEAAAAAAAAAAAAAAAAAAAAAAA
AAACAArwCAAAAABMAAAFAAAADwAE8HIAAAASAArwCAAAAAJMAAAgAgAAUwAL8B4AAAB/AAAABACA
ALiVEAS/AQAAAQD/AQAAAQABAwIEAAAAABDwCAAAAK0AIAFgFX0DDwAR8BAAAAAAAMMLCAAAAAAA
AAANABMEDwAN8AwAAAAAAJ4PBAAAAAAAAAAPAATw5AAAALIECvAIAAAABEwAACAKAAADAQvwlgAA
AAQAAAAAAH8ABAAFAARBBAAAAAXBNAAAAAYBAQAAAIEB////AIIBAAABAIMB////AIQBAAABAL8B
AAABAMABAAAAAP8BAAAJAAECgICAAAEDAwQAAIHDAgAAAIgDAAAAAEUATQBMADIAMAAwADQAbwBu
AGwAaQBuAGUAaABlAGwAcABvAHYAZQByAHYAaQBlAHcAAAAAABMAIvEGAAAAvwEAAGAAAAAQ8AgA
AAAfA/kA3RV8Dw8AEfAQAAAAAADDCwgAAAD/////EwAQBA8ABPBIAAAAEgAK8AgAAAABTAAAAAwA
AIMAC/AwAAAAgQEAAAAIgwEFAAAIkwGOn4sAlAHevWgAvwESABIA/wEAAAgABAMJAAAAPwMBAAEA
EADwByAAAAD///8AAAAAAICAgAAAAAAAu+DjADMzmQAAmZkAmcwAAA8AiBOdAAAADwCKE5UAAAAA
ALoPEAAAAF8AXwBfAFAAUABUADEAMAAAAIsTdQAAAAAA6i4EAAAAAgAAAAAA6y4IAAAAAFvEAYDW
8fkAAAArBAAAAAAAAAAfAETxPQAAAAAAJ/EgAAAAAAAAAAMAAAAAAAAAAAAAAAAAAAAAuRMA////
/xIAAAAPAD3xDQAAAEABQvEFAAAAAQkAAAAPAAIrAAAAAA8A7gNPBwAAAgDvAxgAAAABAAAADQ4A
AAAAAAAAAACAAAAAAAcAEwAPAAwEpgIAAA8AAvCeAgAAUAEI8AgAAAAEAAAABlQAAA8AA/A2AgAA
DwAE8CgAAAABAAnwEAAAAAAAAAAAAAAAAAAAAAAAAAACAArwCAAAAABUAAAFAAAADwAE8HIAAAAS
AArwCAAAAAJUAAAgAgAAUwAL8B4AAAB/AAAABACAALxhEwS/AQAAAQD/AQAAAQABAwIEAAAAABDw
CAAAAK0AIAFgFX0DDwAR8BAAAAAAAMMLCAAAAAAAAAANABMEDwAN8AwAAAAAAJ4PBAAAAAAAAAAP
AATwngAAABIACvAIAAAABlQAACACAABTAAvwHgAAAH8AAAAEAIAA+L8fA78BAQABAP8BAQABAAED
AwQAAAAAEPAIAAAA8AMgAWAVEw8PABHwPAAAAA8AFBAkAAAAAQDxDxwAAAAAAAAHAAQAAAAAAAAA
AAAAAgABAAIAAAAAAAowAADDCwgAAAABAAAADgAfAw8ADfAMAAAAAACeDwQAAAABAAAADwAE8N4A
AACyBArwCAAAAARUAAAgCgAAAwEL8JAAAAAEAAAAAAB/AAQABQAEQQUAAAAFwS4AAAAGAQEAAACB
Af///wCCAQAAAQCDAf///wCEAQAAAQC/AQAAAQDAAQAAAAD/AQAACQABAoCAgAABAwMEAACBwwIA
AACIAwAAAABFAE0ATAAyADAAMAA0AG8AbgBsAGkAbgBlAGgAZQBsAHAAaQBuAGQAZQB4AAAAAAAT
ACLxBgAAAL8BAABgAAAAEPAIAAAA8gInAUUUtQ8PABHwEAAAAAAAwwsIAAAA/////xMAEAQPAATw
SAAAABIACvAIAAAAAVQAAAAMAACDAAvwMAAAAIEBAAAACIMBBQAACJMBjp+LAJQB3r1oAL8BEgAS
AP8BAAAIAAQDCQAAAD8DAQABABAA8AcgAAAA////AAAAAACAgIAAAAAAALvg4wAzM5kAAJmZAJnM
AAAPAIgTUQQAAA8AihNJBAAAAAC6DxAAAABfAF8AXwBQAFAAVAAxADAAAACLEykEAAAAAOouBAAA
AAIAAAAAAOsuCAAAAAFbxAGwfrjcAAAAKwQAAAAt752RHwBE8bkDAAAAACfxIAAAAAAAAAADAAAA
AAAAAAAAAAAAAAAAALkTAP////8SAAAADwA98Q0AAABAAULxBQAAAAEJAAAAHwBE8XQDAAAAACfx
IAAAAAAAAAAAAAAAAQAAAAAAAAAAAAAAAAAAAP////8YAAAADwA98Q0AAABAAULxBQAAAAEEAAAA
AABB8RQAAAABAAAAAQAAAAAAAAAAAAAAAwAAAD8AJfEsAAAAAAAo8RAAAAABAAAACQAAAAAAAAAA
AAAADwA88QwAAAAAAAErBAAAAAEAAABPACXxLAAAAAAAKPEQAAAAAQAAAAoAAAAAAAAAAAAAAA8A
PPEMAAAAAAABKwQAAAABAAAAHwBE8asCAAAAACfxIAAAAAAAAAAAAAAAAAAAAAMAAAAAAAAAALcT
AAAAAAABAAAADwA98QAAAAAfACXxGAAAAAAAKPEQAAAAAAAAAAAAAAAAAAAA/////x8ARPFTAgAA
AAAn8SAAAAAAAAAAAAAAAAAAAAADAAAAAAAAAAAAAAAAAAAAAQAAAA8APfEAAAAAHwAl8RgAAAAA
ACjxEAAAAAAAAAAAAAAAAAAAAAAAAAAfAETx+wEAAAAAJ/EgAAAAAAAAAAAAAAAAAAAAAwAAAAAA
AAAAAAAAAAAAAAEAAAAPAD3xSwAAAJAAQvEFAAAAAQEAAACgAELxBQAAAAEAAAAAsABC8QUAAAAB
AQAAAEABQvEFAAAAAQEAAABQAULxAgAAAAABMAFC8QUAAAABAAAAAB8AJfEYAAAAAAAo8RAAAAAA
AAAAAAAAAAAAAAAAAAAALwAl8RgAAAAAACjxEAAAAAIAAAADAAAABQAAAAAAAAAAACnxCAAAAAMA
AAAAAAAAAAAp8QgAAAAEAAAAAAAAAAAAKfEIAAAABQAAAAAAAAAAACnxCAAAAAAAAAAAAIA/HwBE
8fgAAAAAACfxIAAAAAAAAAAAAAAAAwAAAAMAAAAAAAAAALUTAAEAAAAZAAAADwA98QAAAAAPADHx
oAAAAAAAOvEIAAAAAQAAAAEAAAAQAELxEQAAAAN2AGkAcwBpAGIAbABlAAAADwAq8W8AAAAAADPx
EAAAAAQAAAAAAAAAAAAAAAAAAAAfAD7xKwAAAAAAQvEjAAAAA3MAdAB5AGwAZQAuAHYAaQBzAGkA
YgBpAGwAaQB0AHkAAAAPADzxHAAAAAAA+yoUAAAAAgAAAAEAAAAGVAAAAAAAAAEAAAAfACXxGAAA
AAAAKPEQAAAAAAAAAAAAAAAAAAAAAAAAAA8AAis4AAAADwAIKzAAAAAAAAMrEAAAAAEAAAAAAAAA
BlQAAAEA3gQBAAkrEAAAAAEAAAABAAAAAAAAAAAAAAAPAO4D+wIAAAIA7wMYAAAAAQAAAA0TAAAA
AAAAAAAAgAAAAAAHABMADwAMBAYCAAAPAALw/gEAAHABCPAIAAAAAwAAAAhcAAAPAAPwlgEAAA8A
BPAoAAAAAQAJ8BAAAAAAAAAAAAAAAAAAAAAAAAAAAgAK8AgAAAAAXAAABQAAAA8ABPByAAAAEgAK
8AgAAAACXAAAIAIAAFMAC/AeAAAAfwAAAAQAgAB4sxAEvwEAAAEA/wEAAAEAAQMCBAAAAAAQ8AgA
AACtACABYBV9Aw8AEfAQAAAAAADDCwgAAAAAAAAADQAQBA8ADfAMAAAAAACeDwQAAAAAAAAADwAE
8OQAAACyBArwCAAAAAdcAAAgCgAAAwEL8JYAAAAEAAAAAAB/AAQABQAEQQYAAAAFwTQAAAAGAQEA
AACBAf///wCCAQAAAQCDAf///wCEAQAAAQC/AQAAEQDAAQAAAAD/AQAACQABAoCAgAABAwMEAACB
wwIAAACIAwAAAABFAE0ATAAyADAAMAA0AHIAZQBsAGEAdABlAGQAaQBuAGYAbwByAG0AYQB0AGkA
bwBuAAAAAAATACLxBgAAAL8BAABgAAAAEPAIAAAATQM3AvIUGRAPABHwEAAAAAAAwwsIAAAAAQAA
ABMAEAQPAATwSAAAABIACvAIAAAAAVwAAAAMAACDAAvwMAAAAIEBAAAACIMBBQAACJMBjp+LAJQB
3r1oAL8BEgASAP8BAAAIAAQDCQAAAD8DAQABABAA8AcgAAAA////AAAAAACAgIAAAAAAALvg4wAz
M5kAAJmZAJnMAAAPAIgTnQAAAA8AihOVAAAAAAC6DxAAAABfAF8AXwBQAFAAVAAxADAAAACLE3UA
AAAAAOouBAAAAAIAAAAAAOsuCAAAAAJbxAGQ+2ESAAAAKwQAAAAAAAAAHwBE8T0AAAAAACfxIAAA
AAAAAAADAAAAAAAAAAAAAAAAAAAAALkTAP////8SAAAADwA98Q0AAABAAULxBQAAAAEJAAAADwAC
KwAAAAAPAO4D9wIAAAIA7wMYAAAAAQAAAA0TAAAAAAAAAAAAgAAAAAAHABMADwAMBAICAAAPAALw
+gEAAAACCPAIAAAAAwAAAAaAAAAPAAPwkgEAAA8ABPAoAAAAAQAJ8BAAAAAAAAAAAAAAAAAAAAAA
AAAAAgAK8AgAAAAAgAAABQAAAA8ABPByAAAAEgAK8AgAAAAFgAAAIAIAAFMAC/AeAAAAfwAAAAQA
gADgfx8DvwEAAAEA/wEAAAEAAQMCBAAAAAAQ8AgAAACtACABYBV9Aw8AEfAQAAAAAADDCwgAAAAA
AAAADQAfAw8ADfAMAAAAAACeDwQAAAAAAAAADwAE8OAAAACyBArwCAAAAASAAAAgCgAAAwEL8JIA
AAAEAAAAAAB/AAQABQAEQQcAAAAFwTAAAAAGAQEAAACBAf///wCCAQAAAQCDAf///wCEAQAAAQC/
AQAAAQDAAQAAAAD/AQAACQABAoCAgAABAwMEAACBwwIAAACIAwAAAABFAE0ATAAyADAAMAA0AG8A
bgBsAGkAbgBlAGgAZQBsAHAAcwBlAGEAcgBjAGgAAAAAABMAIvEGAAAAvwEAAGAAAAAQ8AgAAAAv
BDoF7RAKDw8AEfAQAAAAAADDCwgAAAABAAAAEwAfAw8ABPBIAAAAEgAK8AgAAAABgAAAAAwAAIMA
C/AwAAAAgQEAAAAIgwEFAAAIkwGOn4sAlAHevWgAvwESABIA/wEAAAgABAMJAAAAPwMBAAEAEADw
ByAAAAD///8AAAAAAICAgAAAAAAAu+DjADMzmQAAmZkAmcwAAA8AiBOdAAAADwCKE5UAAAAAALoP
EAAAAF8AXwBfAFAAUABUADEAMAAAAIsTdQAAAAAA6i4EAAAAAgAAAAAA6y4IAAAAA1vEAZAg9WwA
AAArBAAAAAAAAAAfAETxPQAAAAAAJ/EgAAAAAAAAAAMAAAAAAAAAAAAAAAAAAAAAph4A/////xIA
AAAPAD3xDQAAAEABQvEFAAAAAQkAAAAPAAIrAAAAAA8A7gNRCwAAAgDvAxgAAAABAAAADQ4AAAAA
AAAAAACAAAAAAAcAEwAPAAwEwAEAAA8AAvC4AQAAQAII8AgAAAADAAAAA5AAAA8AA/BQAQAADwAE
8CgAAAABAAnwEAAAAAAAAAAAAAAAAAAAAAAAAAACAArwCAAAAACQAAAFAAAADwAE8HIAAAASAArw
CAAAAAKQAAAgAgAAUwAL8B4AAAB/AAAABACAAEzOzAS/AQAAAQD/AQAAAQABAwIEAAAAABDwCAAA
AK0AIAFgFX0DDwAR8BAAAAAAAMMLCAAAAAAAAAANAMwEDwAN8AwAAAAAAJ4PBAAAAAAAAAAPAATw
ngAAABIACvAIAAAAA5AAACACAABTAAvwHgAAAH8AAAAEAIAAlNHMBL8BAAABAP8BAAABAAEDAwQA
AAAAEPAIAAAA8AMgAWAVEw8PABHwPAAAAA8AFBAkAAAAAQDxDxwAAAAAAAAHAAQAAAAAAAAAAAAA
AgABAAIAAAAAAAowAADDCwgAAAABAAAADgDMBA8ADfAMAAAAAACeDwQAAAABAAAADwAE8EgAAAAS
AArwCAAAAAGQAAAADAAAgwAL8DAAAACBAQAAAAiDAQUAAAiTAY6fiwCUAd69aAC/ARIAEgD/AQAA
CAAEAwkAAAA/AwEAAQAQAPAHIAAAAP///wAAAAAAgICAAAAAAAC74OMAMzOZAACZmQCZzAAADwCI
EzkJAAAPAIoTMQkAAAAAug8QAAAAXwBfAF8AUABQAFQAMQAwAAAAixMRCQAAAADqLgQAAAACAAAA
AADrLggAAAAKW8QBcAHhhgAAACsEAAAAxVtXXx8ARPGhCAAAAAAn8SAAAAAAAAAAAwAAAAAAAAAA
AAAAAAAAAAC5EwD/////EgAAAA8APfENAAAAQAFC8QUAAAABCQAAAB8ARPFcCAAAAAAn8SAAAAAA
AAAAAAAAAAEAAAAAAAAAAAAAAAAAAAD/////GAAAAA8APfENAAAAQAFC8QUAAAABBAAAAAAAQfEU
AAAAAQAAAAEAAAAAAAAAAAAAAAMAAAA/ACXxLAAAAAAAKPEQAAAAAQAAAAkAAAAAAAAAAAAAAA8A
PPEMAAAAAAABKwQAAAABAAAATwAl8SwAAAAAACjxEAAAAAEAAAAKAAAAAAAAAAAAAAAPADzxDAAA
AAAAASsEAAAAAQAAAB8ARPGBAgAAAAAn8SAAAAAAAAAAAAAAAAAAAAADAAAAAAAAAAC3EwAAAAAA
AQAAAA8APfEAAAAAHwAl8RgAAAAAACjxEAAAAAAAAAAAAAAAAAAAAP////8fAETxKQIAAAAAJ/Eg
AAAAAAAAAAAAAAAAAAAAAwAAAAAAAAAAAAAAAAAAAAEAAAAPAD3xAAAAAB8AJfEYAAAAAAAo8RAA
AAAAAAAAAAAAAAAAAAAAAAAAHwBE8dEBAAAAACfxIAAAAAAAAAAAAAAAAAAAAAMAAAAAAAAAAAAA
AAAAAAABAAAADwA98UEAAACQAELxBQAAAAEBAAAAoABC8QUAAAABAAAAALAAQvEFAAAAAQEAAABA
AULxBQAAAAEBAAAAMAFC8QUAAAABAAAAAB8AJfEYAAAAAAAo8RAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAp8QgAAAADAAAAAAAAAAAAKfEIAAAABAAAAAAAAAAAACnxCAAAAAUAAAAAAAAAAAAp8QgAAAAA
AAAAAACAPx8ARPH4AAAAAAAn8SAAAAAAAAAAAAAAAAMAAAADAAAAAAAAAAC1EwABAAAAGQAAAA8A
PfEAAAAADwAx8aAAAAAAADrxCAAAAAEAAAABAAAAEABC8REAAAADdgBpAHMAaQBiAGwAZQAAAA8A
KvFvAAAAAAAz8RAAAAAEAAAAAAAAAAAAAAAAAAAAHwA+8SsAAAAAAELxIwAAAANzAHQAeQBsAGUA
LgB2AGkAcwBpAGIAaQBsAGkAdAB5AAAADwA88RwAAAAAAPsqFAAAAAIAAAABAAAAA5AAAAAAAABz
AAAAHwAl8RgAAAAAACjxEAAAAAAAAAAAAAAAAAAAAAAAAAAfAETxgQIAAAAAJ/EgAAAAAAAAAAAA
AAAAAAAAAwAAAAAAAAAAtxMAAAAAAAEAAAAPAD3xAAAAAB8AJfEYAAAAAAAo8RAAAAAAAAAAAAAA
AAAAAAD/////HwBE8SkCAAAAACfxIAAAAAAAAAAAAAAAAAAAAAMAAAAAAAAAAAAAAAAAAAABAAAA
DwA98QAAAAAfACXxGAAAAAAAKPEQAAAAAAAAAAAAAAAAAAAAAAAAAB8ARPHRAQAAAAAn8SAAAAAA
AAAAAAAAAAAAAAADAAAAAAAAAAAAAAAAAAAAAQAAAA8APfFBAAAAkABC8QUAAAABAQAAAKAAQvEF
AAAAAQAAAACwAELxBQAAAAEBAAAAQAFC8QUAAAABAQAAADABQvEFAAAAAQAAAAAfACXxGAAAAAAA
KPEQAAAAAAAAAAAAAAAAAAAAAAAAAAAAKfEIAAAAAwAAAAAAAAAAACnxCAAAAAQAAAAAAAAAAAAp
8QgAAAAFAAAAAAAAAAAAKfEIAAAAAAAAAAAAgD8fAETx+AAAAAAAJ/EgAAAAAAAAAAAAAAADAAAA
AwAAAAAAAAAAtRMAAQAAABkAAAAPAD3xAAAAAA8AMfGgAAAAAAA68QgAAAABAAAAAQAAABAAQvER
AAAAA3YAaQBzAGkAYgBsAGUAAAAPACrxbwAAAAAAM/EQAAAABAAAAAAAAAAAAAAAAAAAAB8APvEr
AAAAAABC8SMAAAADcwB0AHkAbABlAC4AdgBpAHMAaQBiAGkAbABpAHQAeQAAAA8APPEcAAAAAAD7
KhQAAAACAAAAAQAAAAOQAABzAAAAEQEAAB8AJfEYAAAAAAAo8RAAAAAAAAAAAAAAAAAAAAAAAAAA
HwBE8YECAAAAACfxIAAAAAAAAAAAAAAAAAAAAAMAAAAAAAAAALcTAAAAAAABAAAADwA98QAAAAAf
ACXxGAAAAAAAKPEQAAAAAAAAAAAAAAAAAAAA/////x8ARPEpAgAAAAAn8SAAAAAAAAAAAAAAAAAA
AAADAAAAAAAAAAAAAAAAAAAAAQAAAA8APfEAAAAAHwAl8RgAAAAAACjxEAAAAAAAAAAAAAAAAAAA
AAAAAAAfAETx0QEAAAAAJ/EgAAAAAAAAAAAAAAAAAAAAAwAAAAAAAAAAAAAAAAAAAAEAAAAPAD3x
QQAAAJAAQvEFAAAAAQEAAACgAELxBQAAAAEAAAAAsABC8QUAAAABAQAAAEABQvEFAAAAAQEAAAAw
AULxBQAAAAEAAAAAHwAl8RgAAAAAACjxEAAAAAAAAAAAAAAAAAAAAAAAAAAAACnxCAAAAAMAAAAA
AAAAAAAp8QgAAAAEAAAAAAAAAAAAKfEIAAAABQAAAAAAAAAAACnxCAAAAAAAAAAAAIA/HwBE8fgA
AAAAACfxIAAAAAAAAAAAAAAAAwAAAAMAAAAAAAAAALUTAAEAAAAZAAAADwA98QAAAAAPADHxoAAA
AAAAOvEIAAAAAQAAAAEAAAAQAELxEQAAAAN2AGkAcwBpAGIAbABlAAAADwAq8W8AAAAAADPxEAAA
AAQAAAAAAAAAAAAAAAAAAAAfAD7xKwAAAAAAQvEjAAAAA3MAdAB5AGwAZQAuAHYAaQBzAGkAYgBp
AGwAaQB0AHkAAAAPADzxHAAAAAAA+yoUAAAAAgAAAAEAAAADkAAAEQEAAGMBAAAfACXxGAAAAAAA
KPEQAAAAAAAAAAAAAAAAAAAAAAAAAA8AAis4AAAADwAIKzAAAAAAAAMrEAAAAAEAAAAAAAAAA5AA
AAEA3gQBAAkrEAAAAAEAAAABAAAAAAAAAAAAAAAPAO4DaQgAAAIA7wMYAAAAAQAAAA0OAAAAAAAA
AAAAgAUBAAAHABMADwAMBMADAAAPAALwuAMAAIAACPAIAAAABgAAAAggAAAPAAPwUAMAAA8ABPAo
AAAAAQAJ8BAAAAAAAAAAAAAAAAAAAAAAAAAAAgAK8AgAAAAAIAAABQAAAA8ABPByAAAAEgAK8AgA
AAACIAAAIAIAAFMAC/AeAAAAfwAAAAQAgADUKhMEvwEAAAEA/wEAAAEAAQMCBAAAAAAQ8AgAAACt
ACABYBV9Aw8AEfAQAAAAAADDCwgAAAAAAAAADQATBA8ADfAMAAAAAACeDwQAAAAAAAAADwAE8J4A
AAASAArwCAAAAAYgAAAgAgAAUwAL8B4AAAB/AAAABACAAADLHwO/AQEAAQD/AQEAAQABAwMEAAAA
ABDwCAAAAPADIAFgFRMPDwAR8DwAAAAPABQQJAAAAAEA8Q8cAAAAAAAABwAEAAAAAAAAAAAAAAIA
AQACAAAAAAAKMAAAwwsIAAAAAQAAAA4AHwMPAA3wDAAAAAAAng8EAAAAAQAAAA8ABPDMAAAAsgQK
8AgAAAAEIAAAIAoAAOMAC/CMAAAABAAAAAAAfwAEAAUABEEDAAAABcE2AAAABgEBAAAAgQH///8A
gwH///8AvwEAAAEAwAEAAAAA/wEAAAkAAQKAgIAAAQMDBAAAgcMCAAAAiAMAAAAARQBNAEwAMgAw
ADAANABQAHIAbwBjAGUAcwBzAFcAcwBPAG4AbABpAG4AZQBoAGUAbABwAAAAAAAAABDwCAAAAAIE
gQErFbgODwAR8BAAAAAAAMMLCAAAAP////8TABAEDwAE8F4AAAAyAArwCAAAAAcgAAAACgAAkwAL
8DYAAACFAAIAAACHAAEAAACBAQQAAAiDAQAAAAi/AQAAEADAAf8AAADLAZ9vAAD/AQgACAABAgIA
AAgAABDwCAAAACIG7wV+DL4KDwAE8L4AAACiDArwCAAAAAggAAAACgAAowAL8DwAAACAAJx3EASF
AAIAAACHAAYAAAC/AAIAAgCBAQQAAAiDAQAAAAi/AQAAEADAAQEAAAj/AQAACAABAgIAAAgAABDw
CAAAALcEpQboCbEFDwAN8FIAAAAAAJ8PBAAAAAQAAAAAAKgPCgAAAEV4dHJhIHN0ZXAAAKEPGAAA
AAsAAAAAAAAAAAALAAAAAAAGABQA/wAA/gAAqg8MAAAACwAAAAYAAAAJEAAADwAE8EgAAAASAArw
CAAAAAEgAAAADAAAgwAL8DAAAACBAQAAAAiDAQUAAAiTAY6fiwCUAd69aAC/ARIAEgD/AQAACAAE
AwkAAAA/AwEAAQAQAPAHIAAAAP///wAAAAAAgICAAAAAAAC74OMAMzOZAACZmQCZzAAADwCIE1EE
AAAPAIoTSQQAAAAAug8QAAAAXwBfAF8AUABQAFQAMQAwAAAAixMpBAAAAADqLgQAAAACAAAAAADr
LggAAAD0WsQBAO7/4gAAACsEAAAALe+dkR8ARPG5AwAAAAAn8SAAAAAAAAAAAwAAAAAAAAAAAAAA
AAAAAAC5EwD/////EgAAAA8APfENAAAAQAFC8QUAAAABCQAAAB8ARPF0AwAAAAAn8SAAAAAAAAAA
AAAAAAEAAAAAAAAAAAAAAAAAAAD/////GAAAAA8APfENAAAAQAFC8QUAAAABBAAAAAAAQfEUAAAA
AQAAAAEAAAAAAAAAAAAAAAMAAAA/ACXxLAAAAAAAKPEQAAAAAQAAAAkAAAAAAAAAAAAAAA8APPEM
AAAAAAABKwQAAAABAAAATwAl8SwAAAAAACjxEAAAAAEAAAAKAAAAAAAAAAAAAAAPADzxDAAAAAAA
ASsEAAAAAQAAAB8ARPGrAgAAAAAn8SAAAAAAAAAAAAAAAAAAAAADAAAAAAAAAAC3EwAAAAAAAQAA
AA8APfEAAAAAHwAl8RgAAAAAACjxEAAAAAAAAAAAAAAAAAAAAP////8fAETxUwIAAAAAJ/EgAAAA
AAAAAAAAAAAAAAAAAwAAAAAAAAAAAAAAAAAAAAEAAAAPAD3xAAAAAB8AJfEYAAAAAAAo8RAAAAAA
AAAAAAAAAAAAAAAAAAAAHwBE8fsBAAAAACfxIAAAAAAAAAAAAAAAAAAAAAMAAAAAAAAAAAAAAAAA
AAABAAAADwA98UsAAACQAELxBQAAAAEBAAAAoABC8QUAAAABAAAAALAAQvEFAAAAAQEAAABAAULx
BQAAAAEBAAAAUAFC8QIAAAAAATABQvEFAAAAAQAAAAAfACXxGAAAAAAAKPEQAAAAAAAAAAAAAAAA
AAAAAAAAAC8AJfEYAAAAAAAo8RAAAAACAAAAAwAAAAUAAAAAAAAAAAAp8QgAAAADAAAAAAAAAAAA
KfEIAAAABAAAAAAAAAAAACnxCAAAAAUAAAAAAAAAAAAp8QgAAAAAAAAAAACAPx8ARPH4AAAAAAAn
8SAAAAAAAAAAAAAAAAMAAAADAAAAAAAAAAC1EwABAAAAGQAAAA8APfEAAAAADwAx8aAAAAAAADrx
CAAAAAEAAAABAAAAEABC8REAAAADdgBpAHMAaQBiAGwAZQAAAA8AKvFvAAAAAAAz8RAAAAAEAAAA
AAAAAAAAAAAAAAAAHwA+8SsAAAAAAELxIwAAAANzAHQAeQBsAGUALgB2AGkAcwBpAGIAaQBsAGkA
dAB5AAAADwA88RwAAAAAAPsqFAAAAAIAAAABAAAABiAAAAAAAAABAAAAHwAl8RgAAAAAACjxEAAA
AAAAAAAAAAAAAAAAAAAAAAAPAAIrOAAAAA8ACCswAAAAAAADKxAAAAABAAAAAAAAAAYgAAABAN4E
AQAJKxAAAAABAAAAAQAAAAAAAAAAAAAADwDuA8gIAAACAO8DGAAAAAEAAAANDgAAAAAAAAAAAIAA
AAAABwATAA8ADATAAQAADwAC8LgBAADwAQjwCAAAAAMAAAADfAAADwAD8FABAAAPAATwKAAAAAEA
CfAQAAAAAAAAAAAAAAAAAAAAAAAAAAIACvAIAAAAAHwAAAUAAAAPAATwcgAAABIACvAIAAAAAnwA
ACACAABTAAvwHgAAAH8AAAAEAIAAiGAQBL8BAAABAP8BAAABAAEDAgQAAAAAEPAIAAAArQAgAWAV
fQMPABHwEAAAAAAAwwsIAAAAAAAAAA0AEAQPAA3wDAAAAAAAng8EAAAAAAAAAA8ABPCeAAAAEgAK
8AgAAAADfAAAIAIAAFMAC/AeAAAAfwAAAAQAgABMWxAEvwEAAAEA/wEAAAEAAQMDBAAAAAAQ8AgA
AADwAyABYBUTDw8AEfA8AAAADwAUECQAAAABAPEPHAAAAAAAAAcABAAAAAAAAAAAAAACAAEAAgAA
AAAACjAAAMMLCAAAAAEAAAAOABAEDwAN8AwAAAAAAJ4PBAAAAAEAAAAPAATwSAAAABIACvAIAAAA
AXwAAAAMAACDAAvwMAAAAIEBAAAACIMBBQAACJMBjp+LAJQB3r1oAL8BEgASAP8BAAAIAAQDCQAA
AD8DAQABABAA8AcgAAAA////AAAAAACAgIAAAAAAALvg4wAzM5kAAJmZAJnMAAAPAIgTsAYAAA8A
ihOoBgAAAAC6DxAAAABfAF8AXwBQAFAAVAAxADAAAACLE4gGAAAAAOouBAAAAAIAAAAAAOsuCAAA
AAJbxAGwvw/fAAAAKwQAAADFW1dfHwBE8RgGAAAAACfxIAAAAAAAAAADAAAAAAAAAAAAAAAAAAAA
ALkTAP////8SAAAADwA98Q0AAABAAULxBQAAAAEJAAAAHwBE8dMFAAAAACfxIAAAAAAAAAAAAAAA
AQAAAAAAAAAAAAAAAAAAAP////8YAAAADwA98Q0AAABAAULxBQAAAAEEAAAAAABB8RQAAAABAAAA
AQAAAAAAAAAAAAAAAwAAAD8AJfEsAAAAAAAo8RAAAAABAAAACQAAAAAAAAAAAAAADwA88QwAAAAA
AAErBAAAAAEAAABPACXxLAAAAAAAKPEQAAAAAQAAAAoAAAAAAAAAAAAAAA8APPEMAAAAAAABKwQA
AAABAAAAHwBE8YECAAAAACfxIAAAAAAAAAAAAAAAAAAAAAMAAAAAAAAAALcTAAAAAAABAAAADwA9
8QAAAAAfACXxGAAAAAAAKPEQAAAAAAAAAAAAAAAAAAAA/////x8ARPEpAgAAAAAn8SAAAAAAAAAA
AAAAAAAAAAADAAAAAAAAAAAAAAAAAAAAAQAAAA8APfEAAAAAHwAl8RgAAAAAACjxEAAAAAAAAAAA
AAAAAAAAAAAAAAAfAETx0QEAAAAAJ/EgAAAAAAAAAAAAAAAAAAAAAwAAAAAAAAAAAAAAAAAAAAEA
AAAPAD3xQQAAAJAAQvEFAAAAAQEAAACgAELxBQAAAAEAAAAAsABC8QUAAAABAQAAAEABQvEFAAAA
AQEAAAAwAULxBQAAAAEAAAAAHwAl8RgAAAAAACjxEAAAAAAAAAAAAAAAAAAAAAAAAAAAACnxCAAA
AAMAAAAAAAAAAAAp8QgAAAAEAAAAAAAAAAAAKfEIAAAABQAAAAAAAAAAACnxCAAAAAAAAAAAAIA/
HwBE8fgAAAAAACfxIAAAAAAAAAAAAAAAAwAAAAMAAAAAAAAAALUTAAEAAAAZAAAADwA98QAAAAAP
ADHxoAAAAAAAOvEIAAAAAQAAAAEAAAAQAELxEQAAAAN2AGkAcwBpAGIAbABlAAAADwAq8W8AAAAA
ADPxEAAAAAQAAAAAAAAAAAAAAAAAAAAfAD7xKwAAAAAAQvEjAAAAA3MAdAB5AGwAZQAuAHYAaQBz
AGkAYgBpAGwAaQB0AHkAAAAPADzxHAAAAAAA+yoUAAAAAgAAAAEAAAADfAAAAAAAAL4AAAAfACXx
GAAAAAAAKPEQAAAAAAAAAAAAAAAAAAAAAAAAAB8ARPGBAgAAAAAn8SAAAAAAAAAAAAAAAAAAAAAD
AAAAAAAAAAC3EwAAAAAAAQAAAA8APfEAAAAAHwAl8RgAAAAAACjxEAAAAAAAAAAAAAAAAAAAAP//
//8fAETxKQIAAAAAJ/EgAAAAAAAAAAAAAAAAAAAAAwAAAAAAAAAAAAAAAAAAAAEAAAAPAD3xAAAA
AB8AJfEYAAAAAAAo8RAAAAAAAAAAAAAAAAAAAAAAAAAAHwBE8dEBAAAAACfxIAAAAAAAAAAAAAAA
AAAAAAMAAAAAAAAAAAAAAAAAAAABAAAADwA98UEAAACQAELxBQAAAAEBAAAAoABC8QUAAAABAAAA
ALAAQvEFAAAAAQEAAABAAULxBQAAAAEBAAAAMAFC8QUAAAABAAAAAB8AJfEYAAAAAAAo8RAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAp8QgAAAADAAAAAAAAAAAAKfEIAAAABAAAAAAAAAAAACnxCAAAAAUA
AAAAAAAAAAAp8QgAAAAAAAAAAACAPx8ARPH4AAAAAAAn8SAAAAAAAAAAAAAAAAMAAAADAAAAAAAA
AAC1EwABAAAAGQAAAA8APfEAAAAADwAx8aAAAAAAADrxCAAAAAEAAAABAAAAEABC8REAAAADdgBp
AHMAaQBiAGwAZQAAAA8AKvFvAAAAAAAz8RAAAAAEAAAAAAAAAAAAAAAAAAAAHwA+8SsAAAAAAELx
IwAAAANzAHQAeQBsAGUALgB2AGkAcwBpAGIAaQBsAGkAdAB5AAAADwA88RwAAAAAAPsqFAAAAAIA
AAABAAAAA3wAAL4AAAAUAQAAHwAl8RgAAAAAACjxEAAAAAAAAAAAAAAAAAAAAAAAAAAPAAIrOAAA
AA8ACCswAAAAAAADKxAAAAABAAAAAAAAAAN8AAABAN4EAQAJKxAAAAABAAAAAQAAAAAAAAAAAAAA
DwDuAxMDAAACAO8DGAAAAAEAAAANEwAAAAAAAAAAAIAAAAAABwATAA8ADAQeAgAADwAC8BYCAAAg
AgjwCAAAAAMAAAAGiAAADwAD8K4BAAAPAATwKAAAAAEACfAQAAAAAAAAAAAAAAAAAAAAAAAAAAIA
CvAIAAAAAIgAAAUAAAAPAATwkgAAABIACvAIAAAABYgAACACAACDAAvwMAAAAH8AAAAEAIAAuCIK
BIcAAAAAAIIBAAABAIQBAAABAL8BAAABAP8BAAABAAEDAgQAABMAIvEGAAAAvwEAAGAAAAAQ8AgA
AAB3ACcB6RVRAQ8AEfAQAAAAAADDCwgAAAAAAAAADQAKBA8ADfAMAAAAAACeDwQAAAAAAAAADwAE
8NwAAACyBArwCAAAAASIAAAgCgAAAwEL8I4AAAAEAAAAAAB/AAQABQAEQQgAAAAFwSwAAAAGAQEA
AACBAf///wCCAQAAAQCDAf///wCEAQAAAQC/AQAAAQDAAQAAAAD/AQAACQABAoCAgAABAwMEAACB
wwIAAACIAwAAAABFAE0ATAAyADAAMAA0AFcAcwBoAGUAbABwAG8AdgBlAHIAdgBpAGUAdwAAAAAA
EwAi8QYAAAC/AQAAYAAAABDwCAAAADwCkQKxE4MQDwAR8BAAAAAAAMMLCAAAAAEAAAATAAoEDwAE
8EgAAAASAArwCAAAAAGIAAAADAAAgwAL8DAAAACBAQAAAAiDAQUAAAiTAY6fiwCUAd69aAC/ARIA
EgD/AQAACAAEAwkAAAA/AwEAAQAQAPAHIAAAAP///wAAAAAAgICAAAAAAAC74OMAMzOZAACZmQCZ
zAAADwCIE50AAAAPAIoTlQAAAAAAug8QAAAAXwBfAF8AUABQAFQAMQAwAAAAixN1AAAAAADqLgQA
AAACAAAAAADrLggAAAAFW8QBEMLD7QAAACsEAAAAAAAAAB8ARPE9AAAAAAAn8SAAAAAAAAAAAwAA
AAAAAAAAAAAAAAAAAAC5EwD/////EgAAAA8APfENAAAAQAFC8QUAAAABCQAAAA8AAisAAAAADwDu
A/kCAAACAO8DGAAAAAEAAAANEwAAAAAAAAAAAIAAAAAABwATAA8ADAQEAgAADwAC8PwBAABQAgjw
CAAAAAMAAAAFlAAADwAD8JQBAAAPAATwKAAAAAEACfAQAAAAAAAAAAAAAAAAAAAAAAAAAAIACvAI
AAAAAJQAAAUAAAAPAATwcgAAABIACvAIAAAAApQAACACAABTAAvwHgAAAH8AAAAEAIAA8MnMBL8B
AAABAP8BAAABAAEDAgQAAAAAEPAIAAAArQAgAWAVfQMPABHwEAAAAAAAwwsIAAAAAAAAAA0AzAQP
AA3wDAAAAAAAng8EAAAAAAAAAA8ABPDiAAAAsgQK8AgAAAAElAAAIAoAAAMBC/CUAAAABAAAAAAA
fwAEAAUABEEJAAAABcEyAAAABgEBAAAAgQH///8AggEAAAEAgwH///8AhAEAAAEAvwEAAAEAwAEA
AAAA/wEAAAkAAQKAgIAAAQMDBAAAgcMCAAAAiAMAAAAARQBNAEwAMgAwADAANABQAHIAbwBjAGUA
cwBzAFAARABGAE0AYQBuAHUAYQBsAHMAAAAAABMAIvEGAAAAvwEAAGAAAAAQ8AgAAADYAgkC2BSG
Dw8AEfAQAAAAAADDCwgAAAABAAAAEwDMBA8ABPBIAAAAEgAK8AgAAAABlAAAAAwAAIMAC/AwAAAA
gQEAAAAIgwEFAAAIkwGOn4sAlAHevWgAvwESABIA/wEAAAgABAMJAAAAPwMBAAEAEADwByAAAAD/
//8AAAAAAICAgAAAAAAAu+DjADMzmQAAmZkAmcwAAA8AiBOdAAAADwCKE5UAAAAAALoPEAAAAF8A
XwBfAFAAUABUADEAMAAAAIsTdQAAAAAA6i4EAAAAAgAAAAAA6y4IAAAAC1vEAZDa1GYAAAArBAAA
AAAAAAAfAETxPQAAAAAAJ/EgAAAAAAAAAAMAAAAAAAAAAAAAAAAAAAAAuRMA/////xIAAAAPAD3x
DQAAAEABQvEFAAAAAQkAAAAPAAIrAAAAAA8A7gNnFgAAAgDvAxgAAAABAAAADQ4AAAAAAAAAAACA
AAAAAAcAEwAPAAwEwAEAAA8AAvC4AQAAcAII8AgAAAADAAAAA5wAAA8AA/BQAQAADwAE8CgAAAAB
AAnwEAAAAAAAAAAAAAAAAAAAAAAAAAACAArwCAAAAACcAAAFAAAADwAE8HIAAAASAArwCAAAAAKc
AAAgAgAAUwAL8B4AAAB/AAAABACAAFh5zAS/AQAAAQD/AQAAAQABAwIEAAAAABDwCAAAAK0AIAFg
FX0DDwAR8BAAAAAAAMMLCAAAAAAAAAANAMwEDwAN8AwAAAAAAJ4PBAAAAAAAAAAPAATwngAAABIA
CvAIAAAAA5wAACACAABTAAvwHgAAAH8AAAAEAIAAiHfMBL8BAAABAP8BAAABAAEDAwQAAAAAEPAI
AAAA8AMgAWAVEw8PABHwPAAAAA8AFBAkAAAAAQDxDxwAAAAAAAAHAAAAAAAAAAAAAAAAAgABAAIA
AAAAAAowAADDCwgAAAABAAAADgDMBA8ADfAMAAAAAACeDwQAAAABAAAADwAE8EgAAAASAArwCAAA
AAGcAAAADAAAgwAL8DAAAACBAQAAAAiDAQUAAAiTAY6fiwCUAd69aAC/ARIAEgD/AQAACAAEAwkA
AAA/AwEAAQAQAPAHIAAAAP///wAAAAAAgICAAAAAAAC74OMAMzOZAACZmQCZzAAADwCIE08UAAAP
AIoTRxQAAAAAug8QAAAAXwBfAF8AUABQAFQAMQAwAAAAixMnFAAAAADqLgQAAAACAAAAAADrLggA
AAALW8QBoEOvqQAAACsEAAAAz0aV8R8ARPG3EwAAAAAn8SAAAAAAAAAAAwAAAAAAAAAAAAAAAAAA
AAC5EwD/////EgAAAA8APfENAAAAQAFC8QUAAAABCQAAAB8ARPFyEwAAAAAn8SAAAAAAAAAAAAAA
AAEAAAAAAAAAAAAAAAAAAAD/////GAAAAA8APfENAAAAQAFC8QUAAAABBAAAAAAAQfEUAAAAAQAA
AAEAAAAAAAAAAAAAAAMAAAA/ACXxLAAAAAAAKPEQAAAAAQAAAAkAAAAAAAAAAAAAAA8APPEMAAAA
AAABKwQAAAABAAAATwAl8SwAAAAAACjxEAAAAAEAAAAKAAAAAAAAAAAAAAAPADzxDAAAAAAAASsE
AAAAAQAAAB8ARPGXDQAAAAAn8SAAAAAAAAAAAAAAAAAAAAADAAAAAAAAAAC3EwAAAAAAAQAAAA8A
PfEAAAAAHwAl8RgAAAAAACjxEAAAAAAAAAAAAAAAAAAAAP////8fAETxPw0AAAAAJ/EgAAAAAAAA
AAAAAAAAAAAAAwAAAAAAAAAAAAAAAAAAAAEAAAAPAD3xAAAAAB8AJfEYAAAAAAAo8RAAAAAAAAAA
AAAAAAAAAAAAAAAAHwBE8dEBAAAAACfxIAAAAAAAAAAAAAAAAAAAAAMAAAAAAAAAAAAAAAAAAAAB
AAAADwA98UEAAACQAELxBQAAAAEBAAAAoABC8QUAAAABAAAAALAAQvEFAAAAAQEAAABAAULxBQAA
AAEBAAAAMAFC8QUAAAABAAAAAB8AJfEYAAAAAAAo8RAAAAAAAAAAAAAAAAAAAAAAAAAAAAAp8QgA
AAADAAAAAAAAAAAAKfEIAAAABAAAAAAAAAAAACnxCAAAAAUAAAAAAAAAAAAp8QgAAAAAAAAAAACA
Px8ARPH4AAAAAAAn8SAAAAAAAAAAAAAAAAMAAAADAAAAAAAAAAC1EwABAAAAGQAAAA8APfEAAAAA
DwAx8aAAAAAAADrxCAAAAAEAAAABAAAAEABC8REAAAADdgBpAHMAaQBiAGwAZQAAAA8AKvFvAAAA
AAAz8RAAAAAEAAAAAAAAAAAAAAAAAAAAHwA+8SsAAAAAAELxIwAAAANzAHQAeQBsAGUALgB2AGkA
cwBpAGIAaQBsAGkAdAB5AAAADwA88RwAAAAAAPsqFAAAAAIAAAABAAAAA5wAAAAAAABGAAAAHwAl
8RgAAAAAACjxEAAAAAAAAAAAAAAAAAAAAAAAAAAfAETx0QEAAAAAJ/EgAAAAAAAAAAAAAAAAAAAA
AwAAAAAAAAAAAAAAAAAAAAEAAAAPAD3xQQAAAJAAQvEFAAAAAQEAAACgAELxBQAAAAEAAAAAsABC
8QUAAAABAQAAAEABQvEFAAAAAQIAAAAwAULxBQAAAAEAAAAAHwAl8RgAAAAAACjxEAAAAAAAAAAA
AAAAAAAAAAAAAAAAACnxCAAAAAMAAAAAAAAAAAAp8QgAAAAEAAAAAAAAAAAAKfEIAAAABQAAAAAA
AAAAACnxCAAAAAAAAAAAAIA/HwBE8fgAAAAAACfxIAAAAAAAAAAAAAAAAwAAAAMAAAAAAAAAALUT
AAEAAAAZAAAADwA98QAAAAAPADHxoAAAAAAAOvEIAAAAAQAAAAEAAAAQAELxEQAAAAN2AGkAcwBp
AGIAbABlAAAADwAq8W8AAAAAADPxEAAAAAQAAAAAAAAAAAAAAAAAAAAfAD7xKwAAAAAAQvEjAAAA
A3MAdAB5AGwAZQAuAHYAaQBzAGkAYgBpAGwAaQB0AHkAAAAPADzxHAAAAAAA+yoUAAAAAgAAAAEA
AAADnAAARgAAAHoAAAAfACXxGAAAAAAAKPEQAAAAAAAAAAAAAAAAAAAAAAAAAB8ARPHRAQAAAAAn
8SAAAAAAAAAAAAAAAAAAAAADAAAAAAAAAAAAAAAAAAAAAQAAAA8APfFBAAAAkABC8QUAAAABAQAA
AKAAQvEFAAAAAQAAAACwAELxBQAAAAEBAAAAQAFC8QUAAAABAgAAADABQvEFAAAAAQAAAAAfACXx
GAAAAAAAKPEQAAAAAAAAAAAAAAAAAAAAAAAAAAAAKfEIAAAAAwAAAAAAAAAAACnxCAAAAAQAAAAA
AAAAAAAp8QgAAAAFAAAAAAAAAAAAKfEIAAAAAAAAAAAAgD8fAETx+AAAAAAAJ/EgAAAAAAAAAAAA
AAADAAAAAwAAAAAAAAAAtRMAAQAAABkAAAAPAD3xAAAAAA8AMfGgAAAAAAA68QgAAAABAAAAAQAA
ABAAQvERAAAAA3YAaQBzAGkAYgBsAGUAAAAPACrxbwAAAAAAM/EQAAAABAAAAAAAAAAAAAAAAAAA
AB8APvErAAAAAABC8SMAAAADcwB0AHkAbABlAC4AdgBpAHMAaQBiAGkAbABpAHQAeQAAAA8APPEc
AAAAAAD7KhQAAAACAAAAAQAAAAOcAAB6AAAArQAAAB8AJfEYAAAAAAAo8RAAAAAAAAAAAAAAAAAA
AAAAAAAAHwBE8dEBAAAAACfxIAAAAAAAAAAAAAAAAAAAAAMAAAAAAAAAAAAAAAAAAAABAAAADwA9
8UEAAACQAELxBQAAAAEBAAAAoABC8QUAAAABAAAAALAAQvEFAAAAAQEAAABAAULxBQAAAAECAAAA
MAFC8QUAAAABAAAAAB8AJfEYAAAAAAAo8RAAAAAAAAAAAAAAAAAAAAAAAAAAAAAp8QgAAAADAAAA
AAAAAAAAKfEIAAAABAAAAAAAAAAAACnxCAAAAAUAAAAAAAAAAAAp8QgAAAAAAAAAAACAPx8ARPH4
AAAAAAAn8SAAAAAAAAAAAAAAAAMAAAADAAAAAAAAAAC1EwABAAAAGQAAAA8APfEAAAAADwAx8aAA
AAAAADrxCAAAAAEAAAABAAAAEABC8REAAAADdgBpAHMAaQBiAGwAZQAAAA8AKvFvAAAAAAAz8RAA
AAAEAAAAAAAAAAAAAAAAAAAAHwA+8SsAAAAAAELxIwAAAANzAHQAeQBsAGUALgB2AGkAcwBpAGIA
aQBsAGkAdAB5AAAADwA88RwAAAAAAPsqFAAAAAIAAAABAAAAA5wAAK0AAAD/AAAAHwAl8RgAAAAA
ACjxEAAAAAAAAAAAAAAAAAAAAAAAAAAfAETx0QEAAAAAJ/EgAAAAAAAAAAAAAAAAAAAAAwAAAAAA
AAAAAAAAAAAAAAEAAAAPAD3xQQAAAJAAQvEFAAAAAQEAAACgAELxBQAAAAEAAAAAsABC8QUAAAAB
AQAAAEABQvEFAAAAAQIAAAAwAULxBQAAAAEAAAAAHwAl8RgAAAAAACjxEAAAAAAAAAAAAAAAAAAA
AAAAAAAAACnxCAAAAAMAAAAAAAAAAAAp8QgAAAAEAAAAAAAAAAAAKfEIAAAABQAAAAAAAAAAACnx
CAAAAAAAAAAAAIA/HwBE8fgAAAAAACfxIAAAAAAAAAAAAAAAAwAAAAMAAAAAAAAAALUTAAEAAAAZ
AAAADwA98QAAAAAPADHxoAAAAAAAOvEIAAAAAQAAAAEAAAAQAELxEQAAAAN2AGkAcwBpAGIAbABl
AAAADwAq8W8AAAAAADPxEAAAAAQAAAAAAAAAAAAAAAAAAAAfAD7xKwAAAAAAQvEjAAAAA3MAdAB5
AGwAZQAuAHYAaQBzAGkAYgBpAGwAaQB0AHkAAAAPADzxHAAAAAAA+yoUAAAAAgAAAAEAAAADnAAA
/wAAADMBAAAfACXxGAAAAAAAKPEQAAAAAAAAAAAAAAAAAAAAAAAAAB8ARPHRAQAAAAAn8SAAAAAA
AAAAAAAAAAAAAAADAAAAAAAAAAAAAAAAAAAAAQAAAA8APfFBAAAAkABC8QUAAAABAQAAAKAAQvEF
AAAAAQAAAACwAELxBQAAAAEBAAAAQAFC8QUAAAABAgAAADABQvEFAAAAAQAAAAAfACXxGAAAAAAA
KPEQAAAAAAAAAAAAAAAAAAAAAAAAAAAAKfEIAAAAAwAAAAAAAAAAACnxCAAAAAQAAAAAAAAAAAAp
8QgAAAAFAAAAAAAAAAAAKfEIAAAAAAAAAAAAgD8fAETx+AAAAAAAJ/EgAAAAAAAAAAAAAAADAAAA
AwAAAAAAAAAAtRMAAQAAABkAAAAPAD3xAAAAAA8AMfGgAAAAAAA68QgAAAABAAAAAQAAABAAQvER
AAAAA3YAaQBzAGkAYgBsAGUAAAAPACrxbwAAAAAAM/EQAAAABAAAAAAAAAAAAAAAAAAAAB8APvEr
AAAAAABC8SMAAAADcwB0AHkAbABlAC4AdgBpAHMAaQBiAGkAbABpAHQAeQAAAA8APPEcAAAAAAD7
KhQAAAACAAAAAQAAAAOcAAAzAQAAbwEAAB8AJfEYAAAAAAAo8RAAAAAAAAAAAAAAAAAAAAAAAAAA
HwBE8dEBAAAAACfxIAAAAAAAAAAAAAAAAAAAAAMAAAAAAAAAAAAAAAAAAAABAAAADwA98UEAAACQ
AELxBQAAAAEBAAAAoABC8QUAAAABAAAAALAAQvEFAAAAAQEAAABAAULxBQAAAAECAAAAMAFC8QUA
AAABAAAAAB8AJfEYAAAAAAAo8RAAAAAAAAAAAAAAAAAAAAAAAAAAAAAp8QgAAAADAAAAAAAAAAAA
KfEIAAAABAAAAAAAAAAAACnxCAAAAAUAAAAAAAAAAAAp8QgAAAAAAAAAAACAPx8ARPH4AAAAAAAn
8SAAAAAAAAAAAAAAAAMAAAADAAAAAAAAAAC1EwABAAAAGQAAAA8APfEAAAAADwAx8aAAAAAAADrx
CAAAAAEAAAABAAAAEABC8REAAAADdgBpAHMAaQBiAGwAZQAAAA8AKvFvAAAAAAAz8RAAAAAEAAAA
AAAAAAAAAAAAAAAAHwA+8SsAAAAAAELxIwAAAANzAHQAeQBsAGUALgB2AGkAcwBpAGIAaQBsAGkA
dAB5AAAADwA88RwAAAAAAPsqFAAAAAIAAAABAAAAA5wAAG8BAACqAQAAHwAl8RgAAAAAACjxEAAA
AAAAAAAAAAAAAAAAAAAAAAAfAETxgQIAAAAAJ/EgAAAAAAAAAAAAAAAAAAAAAwAAAAAAAAAAtxMA
AAAAAAEAAAAPAD3xAAAAAB8AJfEYAAAAAAAo8RAAAAAAAAAAAAAAAAAAAAD/////HwBE8SkCAAAA
ACfxIAAAAAAAAAAAAAAAAAAAAAMAAAAAAAAAAAAAAAAAAAABAAAADwA98QAAAAAfACXxGAAAAAAA
KPEQAAAAAAAAAAAAAAAAAAAAAAAAAB8ARPHRAQAAAAAn8SAAAAAAAAAAAAAAAAAAAAADAAAAAAAA
AAAAAAAAAAAAAQAAAA8APfFBAAAAkABC8QUAAAABAQAAAKAAQvEFAAAAAQAAAACwAELxBQAAAAEB
AAAAQAFC8QUAAAABAQAAADABQvEFAAAAAQAAAAAfACXxGAAAAAAAKPEQAAAAAAAAAAAAAAAAAAAA
AAAAAAAAKfEIAAAAAwAAAAAAAAAAACnxCAAAAAQAAAAAAAAAAAAp8QgAAAAFAAAAAAAAAAAAKfEI
AAAAAAAAAAAAgD8fAETx+AAAAAAAJ/EgAAAAAAAAAAAAAAADAAAAAwAAAAAAAAAAtRMAAQAAABkA
AAAPAD3xAAAAAA8AMfGgAAAAAAA68QgAAAABAAAAAQAAABAAQvERAAAAA3YAaQBzAGkAYgBsAGUA
AAAPACrxbwAAAAAAM/EQAAAABAAAAAAAAAAAAAAAAAAAAB8APvErAAAAAABC8SMAAAADcwB0AHkA
bABlAC4AdgBpAHMAaQBiAGkAbABpAHQAeQAAAA8APPEcAAAAAAD7KhQAAAACAAAAAQAAAAOcAACq
AQAA/AEAAB8AJfEYAAAAAAAo8RAAAAAAAAAAAAAAAAAAAAAAAAAAHwBE8YECAAAAACfxIAAAAAAA
AAAAAAAAAAAAAAMAAAAAAAAAALcTAAAAAAABAAAADwA98QAAAAAfACXxGAAAAAAAKPEQAAAAAAAA
AAAAAAAAAAAA/////x8ARPEpAgAAAAAn8SAAAAAAAAAAAAAAAAAAAAADAAAAAAAAAAAAAAAAAAAA
AQAAAA8APfEAAAAAHwAl8RgAAAAAACjxEAAAAAAAAAAAAAAAAAAAAAAAAAAfAETx0QEAAAAAJ/Eg
AAAAAAAAAAAAAAAAAAAAAwAAAAAAAAAAAAAAAAAAAAEAAAAPAD3xQQAAAJAAQvEFAAAAAQEAAACg
AELxBQAAAAEAAAAAsABC8QUAAAABAQAAAEABQvEFAAAAAQEAAAAwAULxBQAAAAEAAAAAHwAl8RgA
AAAAACjxEAAAAAAAAAAAAAAAAAAAAAAAAAAAACnxCAAAAAMAAAAAAAAAAAAp8QgAAAAEAAAAAAAA
AAAAKfEIAAAABQAAAAAAAAAAACnxCAAAAAAAAAAAAIA/HwBE8fgAAAAAACfxIAAAAAAAAAAAAAAA
AwAAAAMAAAAAAAAAALUTAAEAAAAZAAAADwA98QAAAAAPADHxoAAAAAAAOvEIAAAAAQAAAAEAAAAQ
AELxEQAAAAN2AGkAcwBpAGIAbABlAAAADwAq8W8AAAAAADPxEAAAAAQAAAAAAAAAAAAAAAAAAAAf
AD7xKwAAAAAAQvEjAAAAA3MAdAB5AGwAZQAuAHYAaQBzAGkAYgBpAGwAaQB0AHkAAAAPADzxHAAA
AAAA+yoUAAAAAgAAAAEAAAADnAAA/AEAAP4BAAAfACXxGAAAAAAAKPEQAAAAAAAAAAAAAAAAAAAA
AAAAAA8AAis4AAAADwAIKzAAAAAAAAMrEAAAAAEAAAAAAAAAA5wAAAEA3gQBAAkrEAAAAAEAAAAB
AAAAAAAAAAAAAAAPAO4DMQgAAAIA7wMYAAAACAAAAA0TEwAAAAAAAAAAgAAAAAAHABMADwAMBIgD
AAAPAALwgAMAAIACCPAIAAAABQAAAAegAAAPAAPwGAMAAA8ABPAoAAAAAQAJ8BAAAAAAAAAAAAAA
AAAAAAAAAAAAAgAK8AgAAAAAoAAABQAAAA8ABPAGAQAAsgQK8AgAAAADoAAAIAoAAMMAC/BIAAAA
BAAAAAAAfwAAAAQAgAAIo8wEvwAAAAIABEEKAAAAggEAAAEAhAEAAAEAvwEAAAEAwAEBAAAIxAEA
AAAA/wEIAAkAAQMDBAAAEwAi8QYAAAC/AQAAYAAAABDwCAAAAKcDJwEwCywJDwAR8DwAAAAPABQQ
JAAAAAEA8Q8cAAAAAAAABwAEAAAAAAAAAAAAAAIAAQACAAAAAAAKMAAAwwsIAAAA/////w4AzAQP
AA3wPAAAAAAAnw8EAAAAAQAAAAAAoQ8UAAAAAQAAAAAAAQAAAAAAAQAAAAAAAAAAAKoPDAAAAAEA
AAAGAAAACRAAAA8ABPByAAAAEgAK8AgAAAACoAAAIAIAAFMAC/AeAAAAfwAAAAQAgACsoswEvwEA
AAEA/wEAAAEAAQMCBAAAAAAQ8AgAAACtACABYBV9Aw8AEfAQAAAAAADDCwgAAAAAAAAADQDMBA8A
DfAMAAAAAACeDwQAAAAAAAAADwAE8KgAAACyBArwCAAAAASgAAAgCgAA8wAL8FoAAAAEAAAAAAB/
AAQABQAEQQwAAACBAQQAAAiCAQAAAQCDAQAAAAiEAQAAAQCGQQAAAAC/AQAAEQDAAQEAAAjEAQAA
AAD/AQgACQABAgIAAAg/AgAAAgABAwMEAAATACLxBgAAAL8BAABgAAAAEPAIAAAAyAWVBbkOkgsP
ABHwEAAAAAAAwwsIAAAAAQAAABMB3wQPAATwqAAAALIECvAIAAAABqAAACAKAADzAAvwWgAAAAQA
AAAAAH8ABAAFAARBCwAAAIEBBAAACIIBAAABAIMBAAAACIQBAAABAIZBAAAAAL8BAAARAMABAQAA
CMQBAAAAAP8BCAAJAAECAgAACD8CAAACAAEDAwQAABMAIvEGAAAAvwEAAGAAAAAQ8AgAAAAlCRML
hRSDDg8AEfAQAAAAAADDCwgAAAACAAAAEwHfBA8ABPBIAAAAEgAK8AgAAAABoAAAAAwAAIMAC/Aw
AAAAgQEAAAAIgwEFAAAIkwGOn4sAlAHevWgAvwESABIA/wEAAAgABAMJAAAAPwMBAAEAEADwByAA
AAD///8AAAAAAICAgAAAAAAAu+DjADMzmQAAmZkAmcwAAA8AiBNRBAAADwCKE0kEAAAAALoPEAAA
AF8AXwBfAFAAUABUADEAMAAAAIsTKQQAAAAA6i4EAAAAAgAAAAAA6y4IAAAADFvEAUBsCJEAAAAr
BAAAAMVbV18fAETxuQMAAAAAJ/EgAAAAAAAAAAMAAAAAAAAAAAAAAAAAAAAAuRMA/////xIAAAAP
AD3xDQAAAEABQvEFAAAAAQkAAAAfAETxdAMAAAAAJ/EgAAAAAAAAAAAAAAABAAAAAAAAAAAAAAAA
AAAA/////xgAAAAPAD3xDQAAAEABQvEFAAAAAQQAAAAAAEHxFAAAAAEAAAABAAAAAAAAAAAAAAAD
AAAAPwAl8SwAAAAAACjxEAAAAAEAAAAJAAAAAAAAAAAAAAAPADzxDAAAAAAAASsEAAAAAQAAAE8A
JfEsAAAAAAAo8RAAAAABAAAACgAAAAAAAAAAAAAADwA88QwAAAAAAAErBAAAAAEAAAAfAETxqwIA
AAAAJ/EgAAAAAAAAAAAAAAAAAAAAAwAAAAAAAAAAtxMAAAAAAAEAAAAPAD3xAAAAAB8AJfEYAAAA
AAAo8RAAAAAAAAAAAAAAAAAAAAD/////HwBE8VMCAAAAACfxIAAAAAAAAAAAAAAAAAAAAAMAAAAA
AAAAAAAAAAAAAAABAAAADwA98QAAAAAfACXxGAAAAAAAKPEQAAAAAAAAAAAAAAAAAAAAAAAAAB8A
RPH7AQAAAAAn8SAAAAAAAAAAAAAAAAAAAAADAAAAAAAAAAAAAAAAAAAAAQAAAA8APfFLAAAAkABC
8QUAAAABAQAAAKAAQvEFAAAAAQAAAACwAELxBQAAAAEBAAAAQAFC8QUAAAABAQAAAFABQvECAAAA
AAEwAULxBQAAAAEAAAAAHwAl8RgAAAAAACjxEAAAAAAAAAAAAAAAAAAAAAAAAAAvACXxGAAAAAAA
KPEQAAAAAgAAAAMAAAAFAAAAAAAAAAAAKfEIAAAAAwAAAAAAAAAAACnxCAAAAAQAAAAAAAAAAAAp
8QgAAAAFAAAAAAAAAAAAKfEIAAAAAAAAAAAAgD8fAETx+AAAAAAAJ/EgAAAAAAAAAAAAAAADAAAA
AwAAAAAAAAAAtRMAAQAAABkAAAAPAD3xAAAAAA8AMfGgAAAAAAA68QgAAAABAAAAAQAAABAAQvER
AAAAA3YAaQBzAGkAYgBsAGUAAAAPACrxbwAAAAAAM/EQAAAABAAAAAAAAAAAAAAAAAAAAB8APvEr
AAAAAABC8SMAAAADcwB0AHkAbABlAC4AdgBpAHMAaQBiAGkAbABpAHQAeQAAAA8APPEcAAAAAAD7
KhQAAAACAAAAAQAAAAOgAAAAAAAAAQAAAB8AJfEYAAAAAAAo8RAAAAAAAAAAAAAAAAAAAAAAAAAA
DwACKzgAAAAPAAgrMAAAAAAAAysQAAAAAQAAAAAAAAADoAAAAQDeBAEACSsQAAAAAQAAAAEAAAAA
AAAAAAAAAA8A8AMQAgAAAQDxAwgAAAAAAQAABwAKMA8ADASQAQAADwAC8IgBAADQAAjwCAAAAAMA
AAADNAAADwAD8CABAAAPAATwKAAAAAEACfAQAAAAAAAAAAAAAAAAAAAAAAAAAAIACvAIAAAAADQA
AAUAAAAPAATwWAAAABIACvAIAAAAAjQAACACAABDAAvwGAAAAH8ABAAEAL8BAQABAP8BAQABAAED
BDAAAAAAEPAIAAAAsAHQAhAOIAoPABHwEAAAAAAAwwsIAAAAAAAAAAsAEwQPAATwiAAAABIACvAI
AAAAAzQAACACAABTAAvwHgAAAH8AAAAEAIAAmCUQBL8BAQABAP8BAQABAAEDBTAAAAAAEPAIAAAA
sAqwATAP0BQPABHwEAAAAAAAwwsIAAAAAQAAAAwAEwQPAA3wIgAAAAAAnw8EAAAAAgAAAAAAqg8O
AAAAAQAAAAcAAAAAAAkQAAAPAATwSAAAABIACvAIAAAAATQAAAAMAACDAAvwMAAAAIEBAAAACIMB
BQAACJMB3r1oAJQBjp+LAL8BEgASAP8BAAAIAAQDCQAAAD8DAQABABAA8AcgAAAA////AAAAAACA
gIAAAAAAALvg4wAzM5kAAJmZAJnMAAAPAIgTOAAAAA8AihMwAAAAAAC6DxAAAABfAF8AXwBQAFAA
VAAxADAAAACLExAAAAAAAOsuCAAAAPhaxAFgUhFBDwDwAxACAAABAPEDCAAAAAEBAAAHAAowDwAM
BJABAAAPAALwiAEAAOAACPAIAAAAAwAAAAM4AAAPAAPwIAEAAA8ABPAoAAAAAQAJ8BAAAAAAAAAA
AAAAAAAAAAAAAAAAAgAK8AgAAAAAOAAABQAAAA8ABPBYAAAAEgAK8AgAAAACOAAAIAIAAEMAC/AY
AAAAfwAEAAQAvwEBAAEA/wEBAAEAAQMEMAAAAAAQ8AgAAACwAdACEA4gCg8AEfAQAAAAAADDCwgA
AAAAAAAACwATBA8ABPCIAAAAEgAK8AgAAAADOAAAIAIAAFMAC/AeAAAAfwAAAAQAgACUbxAEvwEB
AAEA/wEBAAEAAQMFMAAAAAAQ8AgAAACwCrABMA/QFA8AEfAQAAAAAADDCwgAAAABAAAADAATBA8A
DfAiAAAAAACfDwQAAAACAAAAAACqDw4AAAABAAAABwAAAAAACRAAAA8ABPBIAAAAEgAK8AgAAAAB
OAAAAAwAAIMAC/AwAAAAgQEAAAAIgwEFAAAIkwHevWgAlAGOn4sAvwESABIA/wEAAAgABAMJAAAA
PwMBAAEAEADwByAAAAD///8AAAAAAICAgAAAAAAAu+DjADMzmQAAmZkAmcwAAA8AiBM4AAAADwCK
EzAAAAAAALoPEAAAAF8AXwBfAFAAUABUADEAMAAAAIsTEAAAAAAA6y4IAAAA+FrEAQDZEkEPAPAD
EAIAAAEA8QMIAAAAAwEAAAcACjAPAAwEkAEAAA8AAvCIAQAA8AAI8AgAAAADAAAAAzwAAA8AA/Ag
AQAADwAE8CgAAAABAAnwEAAAAAAAAAAAAAAAAAAAAAAAAAACAArwCAAAAAA8AAAFAAAADwAE8FgA
AAASAArwCAAAAAI8AAAgAgAAQwAL8BgAAAB/AAQABAC/AQEAAQD/AQEAAQABAwQwAAAAABDwCAAA
ALAB0AIQDiAKDwAR8BAAAAAAAMMLCAAAAAAAAAALABMEDwAE8IgAAAASAArwCAAAAAM8AAAgAgAA
UwAL8B4AAAB/AAAABACAAFACEAS/AQEAAQD/AQEAAQABAwUwAAAAABDwCAAAALAKsAEwD9AUDwAR
8BAAAAAAAMMLCAAAAAEAAAAMABMEDwAN8CIAAAAAAJ8PBAAAAAIAAAAAAKoPDgAAAAEAAAAHAAAA
AAAJEAAADwAE8EgAAAASAArwCAAAAAE8AAAADAAAgwAL8DAAAACBAQAAAAiDAQUAAAiTAd69aACU
AY6fiwC/ARIAEgD/AQAACAAEAwkAAAA/AwEAAQAQAPAHIAAAAP///wAAAAAAgICAAAAAAAC74OMA
MzOZAACZmQCZzAAADwCIEzgAAAAPAIoTMAAAAAAAug8QAAAAXwBfAF8AUABQAFQAMQAwAAAAixMQ
AAAAAADrLggAAAD4WsQBANkSQQ8A8AMQAgAAAQDxAwgAAAACAQAABwAKMA8ADASQAQAADwAC8IgB
AAAAAQjwCAAAAAMAAAADQAAADwAD8CABAAAPAATwKAAAAAEACfAQAAAAAAAAAAAAAAAAAAAAAAAA
AAIACvAIAAAAAEAAAAUAAAAPAATwWAAAABIACvAIAAAAAkAAACACAABDAAvwGAAAAH8ABAAEAL8B
AQABAP8BAQABAAEDBDAAAAAAEPAIAAAAsAHQAhAOIAoPABHwEAAAAAAAwwsIAAAAAAAAAAsAEwQP
AATwiAAAABIACvAIAAAAA0AAACACAABTAAvwHgAAAH8AAAAEAIAAuMoQBL8BAQABAP8BAQABAAED
BTAAAAAAEPAIAAAAsAqwATAP0BQPABHwEAAAAAAAwwsIAAAAAQAAAAwAEwQPAA3wIgAAAAAAnw8E
AAAAAgAAAAAAqg8OAAAAAQAAAAcAAAAAAAkQAAAPAATwSAAAABIACvAIAAAAAUAAAAAMAACDAAvw
MAAAAIEBAAAACIMBBQAACJMB3r1oAJQBjp+LAL8BEgASAP8BAAAIAAQDCQAAAD8DAQABABAA8Acg
AAAA////AAAAAACAgIAAAAAAALvg4wAzM5kAAJmZAJnMAAAPAIgTOAAAAA8AihMwAAAAAAC6DxAA
AABfAF8AXwBQAFAAVAAxADAAAACLExAAAAAAAOsuCAAAAPhaxAEA2RJBDwDwAxACAAABAPEDCAAA
AAUBAAAHAAowDwAMBJABAAAPAALwiAEAABABCPAIAAAAAwAAAANEAAAPAAPwIAEAAA8ABPAoAAAA
AQAJ8BAAAAAAAAAAAAAAAAAAAAAAAAAAAgAK8AgAAAAARAAABQAAAA8ABPBYAAAAEgAK8AgAAAAC
RAAAIAIAAEMAC/AYAAAAfwAEAAQAvwEBAAEA/wEBAAEAAQMEMAAAAAAQ8AgAAACwAdACEA4gCg8A
EfAQAAAAAADDCwgAAAAAAAAACwATBA8ABPCIAAAAEgAK8AgAAAADRAAAIAIAAFMAC/AeAAAAfwAA
AAQAgABo6BAEvwEBAAEA/wEBAAEAAQMFMAAAAAAQ8AgAAACwCrABMA/QFA8AEfAQAAAAAADDCwgA
AAABAAAADAATBA8ADfAiAAAAAACfDwQAAAACAAAAAACqDw4AAAABAAAABwAAAAAACRAAAA8ABPBI
AAAAEgAK8AgAAAABRAAAAAwAAIMAC/AwAAAAgQEAAAAIgwEFAAAIkwHevWgAlAGOn4sAvwESABIA
/wEAAAgABAMJAAAAPwMBAAEAEADwByAAAAD///8AAAAAAICAgAAAAAAAu+DjADMzmQAAmZkAmcwA
AA8AiBM4AAAADwCKEzAAAAAAALoPEAAAAF8AXwBfAFAAUABUADEAMAAAAIsTEAAAAAAA6y4IAAAA
+FrEAQDZEkEPAPADEAIAAAEA8QMIAAAABAEAAAcACjAPAAwEkAEAAA8AAvCIAQAAIAEI8AgAAAAD
AAAAA0gAAA8AA/AgAQAADwAE8CgAAAABAAnwEAAAAAAAAAAAAAAAAAAAAAAAAAACAArwCAAAAABI
AAAFAAAADwAE8FgAAAASAArwCAAAAAJIAAAgAgAAQwAL8BgAAAB/AAQABAC/AQEAAQD/AQEAAQAB
AwQwAAAAABDwCAAAALAB0AIQDiAKDwAR8BAAAAAAAMMLCAAAAAAAAAALABMEDwAE8IgAAAASAArw
CAAAAANIAAAgAgAAUwAL8B4AAAB/AAAABACAABCEEAS/AQEAAQD/AQEAAQABAwUwAAAAABDwCAAA
ALAKsAEwD9AUDwAR8BAAAAAAAMMLCAAAAAEAAAAMABMEDwAN8CIAAAAAAJ8PBAAAAAIAAAAAAKoP
DgAAAAEAAAAHAAAAAAAJEAAADwAE8EgAAAASAArwCAAAAAFIAAAADAAAgwAL8DAAAACBAQAAAAiD
AQUAAAiTAd69aACUAY6fiwC/ARIAEgD/AQAACAAEAwkAAAA/AwEAAQAQAPAHIAAAAP///wAAAAAA
gICAAAAAAAC74OMAMzOZAACZmQCZzAAADwCIEzgAAAAPAIoTMAAAAAAAug8QAAAAXwBfAF8AUABQ
AFQAMQAwAAAAixMQAAAAAADrLggAAAD4WsQBANkSQQAAchdsAAAAAQCgAQAAAAATIAAA4TMAACg6
AADvQAAAIU4AAEBVAABQfwAAvykAAMEvAABVtQAAbbcAAIW5AACduwAAtb0AAM2/AACbYwAAnmYA
APVtAAD4cAAAwYcAAJGQAAD3cwAArJMAAK2WAAAcrQAAAAD1DxwAAAACAQAAbRAAAwAAAADlwQAA
AQAAABoAAAAPAPYDDwDoAwsgAAABAOkDKAAAAIAWAADgEAAA4BAAAIAWAAAFAAAACgAAAAkAAAAK
AAAAAQAAAAAAAAEPAPIDFgEAAC8AyA8MAAAAMADSDwQAAAABAAAADwDVB0wAAAAAALcPRAAAAEEA
cgBpAGEAbAAAAAgAAAAAAAAAvKYTALymEwCAfpcAPKUTACSlEwCh0AcwCAAAAAAAAAA8pRMAOkEJ
MDSlEwAAAAQAAACkDwoAAACAAEIAAAD//xQAAAClDwwAAAAAAAAILgAAAAcAAAAAAKkPCgAAAAcA
AAACAAkEAABAAKMPbgAAAAUA//0/AAAAIiAAAGQAAAAA/wAAZAAAAAAAAAAAAEACAAAAAAcAAAD/
/+8AAAAAAP///////xIAAAAAAQAAAAUAACABIAEAAAAAAAUAAEACQAIAAAAAAAUAAGADYAMAAAAA
AAUAAIAEgAQAAAAADwALBOwDAAAPAADw5AMAAAAABvBoAQAABKwAACwAAABbAAAAGQAAAAEAAAAH
HgAAAA8AAABPbi1zY3JlZW4gU2hvdwAAHgAAAAkAAABJWElBU09GVAAgU2gDAAAAvTICAAMAAAAu
AAAAAwAAABAAAAADAAAABgAAAAMAAAAAAAAAAwAAAAAAAAADAAAAexAKAAsAAAAAAAAACwAAAAAA
AAALAAAAAAAAAAsAAAAAAAAAHhAAABUAAAAGAAAAQXJpYWwAEAAAAFRpbWVzIE5ldyBSb21hbgAI
AAAAVmVyZGFuYQAKAAAAV2luZ2RpbmdzABQAAABJWElBU09GVF9Nb2RlbGUyMDA0ADsAAABDRURS
T00tU05pknMgRElUQS1iYXNlZCBQcm9qZWN0ICBGcm9tIEFuYWx5c2lzIHRvIERlbGl2ZXJ5ADEA
AABPdmVydmlldyBvZiB0aGUgcHJvamVjdCBkZWxpdmVyYWJsZXMgYW5kIGNvbnRlbnQACwAAAEhp
Z2hsaWdodHMAHQAAAE9ubGluZSBIZWxwIERlbGl2ZXJ5IFByb2Nlc3MACwAAAEhpZ2hsaWdodHMA
IAAAAFByZS1wcm9jZXNzZWQgVGFibGUgb2YgQ29udGVudCAAFAAAAFByZS1wcm9jZXNzZWQgSW5k
ZXgAHQAAAFByZS1wcm9jZXNzZWQgUmVsYXRlZCBMaW5rcyAANQAAAFNlYXJjaCB3aXRoIE9wdGlv
bnMgYW5kIFJlc3VsdHMgYmFzZWQgb24gVG9waWMgVHlwZXMACwAAAEhpZ2hsaWdodHMAJgAAAENy
ZWF0aW5nIHRoZSBXZWIgU2VydmljZXMgT25saW5lIEhlbHAACwAAAEhpZ2hsaWdodHMAFQAAAFdl
YiBTZXJ2aWNlcyBNZXRob2RzAB8AAABDcmVhdGluZyBhIFBERiBUcmFpbmluZyBNYW51YWwACwAA
AEhpZ2hsaWdodHMALQAAAEVsZW1lbnRzIG9mIFBERiBEb2N1bWVudHMgYmFzZWQgb24gRElUQSBt
YXBzAAwQAAAGAAAAHgAAAAsAAABGb250cyBVc2VkAAMAAAAEAAAAHgAAABAAAABEZXNpZ24gVGVt
cGxhdGUAAwAAAAEAAAAeAAAADQAAAFNsaWRlIFRpdGxlcwADAAAAEAAAAAAAAAAQAAAAAAAABAAA
APABAwAcAAAA+wLD/wAAAAAAAJABAAAAAABAAABBcmlhbAAAAAAAAAAAAPYPJAAAABQAAABfwJHj
6WABAAwA9AMDAJcARnJhbmNlIEJhcmlsCAAAAEYAcgBhAG4AYwBlACAAQgBhAHIAaQBsAFNOaZJz
TSkALAAOAA4AHwAEAAAALgEAAAQAAAAtAQQABAAAAPABAwAcAAAA+wLD/wAAAAAAAJABAAAAAAAC
AAkEAABAAKMPbgAAAAUA//0/AAAAIiAAAGQAAAAA/wAAZAAAAAAAAAAAAEACAAAAAAcAAAD//+8A
AAAAAP///////xIAAAAAAQAAAAUAACABIAEAAAAAAAUAAEACQAIAAAAAAAUAAGADYAMAAAAAAAUA
AIAEgAQAAAAADwALBOwDAAAPAADw5AMAAAAABvBoAQAABKwAACwAAABbAAAAGQAAAAEAAAAHAAAA
AgAAAAQAAAADAAAAOgAAAAAAAAAGAAAABQAAAAgAAAAAAAAABgAAAAcAAAAGAAAACAAAAAkAAAAA
AAAABgAAAAoAAAAEAAAACwAAAAYAAAAMAAAACAAAAA0AAAAEAAAADgAAAAQAAAAPAAAABAAAABAA
AAAEAAAAEQAAAAQAAAASAAAABAAAABMAAAAHAAAAAAAAAAYAAAAVAAAABwAAAAAAAAAGAAAAFwAA
AAkAAAAAAAAABgAAAAAAAAAGAAAAAAAAAAYAAAAAAAAABgAAAAAAAAAGAAAAAAAAAAYAAAAAAAAA
BgAAAB8AAAAEAAAAIAAAAAcAAAAAAAAABgAAACIAAAAHAAAAAAAAAAYAAAAkAAAABAAAACUAAAAG
AAAAAAAAAAYAAAAnAAAABAAAACgAAAAIAAAAAAAAAAYAAAAAAAAACAAAAAAAAAAEAAAAzwAB8BAC
AABiAAfwJAAAAAYGHpbxkT13cz09/q5G3VtWGv8AQTUAAAEAAAAAAAAAAAAAAFIAB/AkAAAABQWW
5qDgLXeZlz8oD5Ia7+mb/wCrNAEAAQAAAEE1AAAAAAAAUgAH8CQAAAAFBbw6Ao1pc+wKIQHAzQNC
OzT/AH2uAAABAAAA7GkBAAAAAABSAAfwJAAAAAUFIDcoDQvAOrZ8j2cw4QgWD/8AY4QBAAEAAABp
GAIAAAAAAFIAB/AkAAAABQUKW3IjojZRGVyuIYCBDDL1/wCg6wAAAQAAAMycAwAAAAAAUgAH8CQA
AAAFBe0XTJzrGmL/MAFqqN4ZhJ7/ABIaAQABAAAAbIgEAAAAAABSAAfwJAAAAAUF7DAIU0bz6YUl
J/zypFCM+v8AKE8AAAEAAAB+ogUAAAAAAFIAB/AkAAAABQW+SW3B2RPXp5tbBslNZGh3/wAuawEA
AQAAAKbxBQAAAAAAUgAH8CQAAAAFBXjg3HjKtv6cRml1dFBD9cv/AFkKAQABAAAA1FwHAAAAAABi
AAfwJAAAAAYGGGScbxztKTN+ontCLkqfQv8ASiIAAAEAAAAtZwgAAAAAAGIAB/AkAAAABgY2pjAG
J5ZUtpNZ9sU9fT8I/wArKgAAAQAAAHeJCAAAAAAAYgAH8CQAAAAGBnKLnssYQL3X2qBUxXCoKpX/
ABNRAAABAAAAorMIAAAAAACDAAvwMAAAAIEBBAAACIMBAAAACIZBAAAAAL8BEAAQAMABAQAACMVB
AAAAAP8BCAAIAAECAgAACBAAGvEEAAAA/wAAAEAAHvEQAAAA//////8AAAACAAAI9wAAEB8A8A8c
AAAAAADzAxQAAAACAAAAAAAAAAAAAAAAAACAAAAAAA8A0AdxAQAAHwAUBBwAAAAAABUEFAAAAJso
3QoAypo7rQeUxwDKmjsBAQAADwD6A2cAAAAAAP4DAwAAAAABAAAA/QM0AAAAQQAAAGQAAABBAAAA
ZAAAAAgAAAAAAAAAVKUTADpBCTAAAAAAAAAAAKD////4/v//AQATAHAA+wMIAAAAAAAAAHAIAABw
APsDCAAAAAEAAABACwAAHwATBDwAAAAAAP0DNAAAAGQAAABkAAAAZAAAAGQAAACApRMA6iQJMLym
EwBYfpcAAAAAAAAAAAAAAAAAAAAAAAABEwAfAP8DFAAAAAIAAAQMAAAAAAAAAAAAAAACAAAADwCI
E3YAAAAPAIoTMAAAAAAAug8QAAAAXwBfAF8AUABQAFQAMQAwAAAAixMQAAAAAAANBAgAAABwtQAA
cLUAAA8AihM2AAAAAAC6Dw4AAABfAF8AXwBQAFAAVAA5AAAAixMYAAAAAAB7FxAAAAAcpRMA5AQA
AAMAAwACD0EwPwDZDwwAAAAAANoPBAAAAA0AJQAPAPAP0RUAAAAA8wMUAAAAAwAAAAAAAAACAAAA
AAEAAAAAAAAAAJ8PBAAAAAYAAAAAAKAPUAAAAEMARQBEAFIATwBNAC0AUwBOAGkAGSBzACAARABJ
AFQAQQAtAGIAYQBzAGUAZAAgAHAAcgBvAGoAZQBjAHQAIABjAHIAZQBhAHQAaQBvAG4AAACqDyYA
AAAHAAAABgAAAAkQAAAFAAAABwAAAAMACRAAAB0AAAAGAAAACRAAABAAnw8EAAAABQAAAAAAqA8d
AAAARnJvbSBhbmFseXNpcyB0byBkZWxpdmVyYWJsZXMAAKoPDAAAAB4AAAAGAAAACRAAAAAA8wMU
AAAABAAAAAAAAAACAAAAAQEAAAAAAAAAAJ8PBAAAAAAAAAAAAKgPMAAAAE92ZXJ2aWV3IG9mIHRo
ZSBwcm9qZWN0IGRlbGl2ZXJhYmxlcyBhbmQgY29udGVudAAAoQ8WAAAAMQAAAAAAAAgAAAAAMQAA
AAAAAgAoAAAAqg8MAAAAMQAAAAYAAAAJEAAAEACfDwQAAAABAAAAAACqDw4AAAABAAAABwAAAAAA
CRAAAAAA8wMUAAAABQAAAAAAAAACAAAAAwEAAAAAAAAAAJ8PBAAAAAAAAAAAAKgPCgAAAEhpZ2hs
aWdodHMAAKEPFAAAAAsAAAAAAAAIAAAAAAsAAAAAAAAAAACqDwwAAAALAAAABgAAAAkQAAAQAJ8P
BAAAAAEAAAAAAKgPVwEAAFRoZXJlIGlzIGEgZ3JlYXQgb3Bwb3J0dW5pdHkgZm9yIHJldXNlIGF0
IHRoZSBmdW5jdGlvbmFsaXR5IGFuZCB0YXNrIGxldmVscy4NKiBGdW5jdGlvbmFsaXRpZXMgYXJl
IHByZXNlbnRlZCBhcyBjb25jZXB0cyBUcmFpbmluZyBndWlkZXMgdmFyeSBmcm9tIG9uZSB0cmFp
bmluZyBjbGFzcyB0byB0aGUgbmV4dDogdGhlcmUgaXMgYSBncmVhdCBuZWVkIGZvciBhIGZsZXhp
YmxlIHRvcGljIG9yZ2FuaXNhdGlvbi4NTXVsdGlwbGUgdXNlciB0eXBlcyB3aXRoIGRpZmZlcmVu
dCBhY2Nlc3MgdG8gZnVuY3Rpb25hbGl0aWVzLCBuZWVkIGZvciBjb25kaXRpb25hbCB0ZXh0IGJh
c2VkIG9uIGF1ZGllbmNlcy4AAKEPNgAAAE0AAAAAAAAAAACfAAAAAQAAAAAAbAAAAAAAAAAAAE0A
AAAAAAAAnwAAAAAAAABsAAAAAAAAAAAAqg8MAAAAWAEAAAYAAAAJEAAAAADzAxQAAAAGAAAABAAA
AAIAAAACAQAAAAAAAAAAnw8EAAAAAAAAAAAAqA8cAAAAT25saW5lIEhlbHAgRGVsaXZlcnkgUHJv
Y2VzcwAAoQ8UAAAAHQAAAAAAAAgAAAAAHQAAAAAAAAAAAKoPDAAAAB0AAAAGAAAACRAAABAAnw8E
AAAAAQAAAAAAqA8BAAAAIAAAoQ8UAAAAAgAAAAAAAQAAAAAAAgAAAAAAAAAAAKoPDAAAAAIAAAAG
AAAACRAAAAAA8wMUAAAABwAAAAAAAAACAAAABQEAAAAAAAAAAJ8PBAAAAAAAAAAAAKgPCgAAAEhp
Z2hsaWdodHMAAKEPFAAAAAsAAAAAAAAIAAAAAAsAAAAAAAAAAACqDwwAAAALAAAABgAAAAkQAAAQ
AJ8PBAAAAAEAAAAAAKgPgAEAAFRoZSBwcm9kdWN0aW9uIGFuZCBkZWxpdmVyeSBtb2RlIGFyZSB1
c2VmdWwgdG8gcHJldmVudCB1c2VycyBmcm9tIHdhaXRpbmcgdG9vIGxvbmcgZm9yIHRvcGljIGRp
c3BsYXkuIFByZS1wcm9jZXNzZWQgZWxlbWVudHMgaW5jbHVkZTogDVRoZSB0YWJsZSBvZiBjb250
ZW50DVRoZSBpbmRleA1UaGUgcmVsYXRlZCBsaW5rcyANVGhlcmUgaXMgYWxzbyBhIG5lZWQgdG8g
c2F2ZSBvbmx5IHRoZSByZWxldmFudCBmaWxlcyBpbiB0aGUgZG9jdW1lbnQgYmFzZSwgc28gdGhh
dCBvdGhlciBmaWxlcyBhcmUgbm90IHJldHVybmVkIGJ5IHRoZSBzZWFyY2ggZW5naW5lLiBJdHMg
ZmFzdGVyIHRoYW4gY2hlY2tpbmcgdGhlIG1hcCBldmVyeSB0aW1lIGZvciBwcm9qZWN0IHJlbGV2
YW5jZQAAoQ9CAAAAhwAAAAAAABAAAFoAMgAAAAEAABAAAFoAyAAAAAAAABAAAFoAhwAAAAAAAgAc
ADIAAAAAAAIAGADIAAAAAAACABwAAACqDwwAAACBAQAABgAAAAkQAAAAAPMDFAAAABEAAAAEAAAA
AgAAAAYBAAAAAAAAAACfDwQAAAAAAAAAAACoDx8AAABQcmUtcHJvY2Vzc2VkIFRhYmxlIG9mIENv
bnRlbnQgAAChDxQAAAAgAAAAAAAACAAAAAAgAAAAAAAAAAAAqg8MAAAAIAAAAAYAAAAJEAAAEACf
DwQAAAABAAAAAACqDw4AAAABAAAABwAAAAAACRAAAAAA8wMUAAAAEgAAAAQAAAACAAAABwEAAAAA
AAAAAJ8PBAAAAAAAAAAAAKgPEwAAAFByZS1wcm9jZXNzZWQgSW5kZXgAAKEPFAAAABQAAAAAAAAI
AAAAABQAAAAAAAAAAACqDwwAAAAUAAAABgAAAAkQAAAQAJ8PBAAAAAEAAAAAAKoPDAAAAAEAAAAG
AAAACRAAAAAA8wMUAAAAEwAAAAAAAAABAAAACAEAAAAAAAAAAJ8PBAAAAAAAAAAAAKgPWAAAAFBy
ZS1wcm9jZXNzZWQgUmVsYXRlZCBMaW5rcwsqSW5jbHVkZWQgaW4gdG9waWNzLCB0byBiZSBtb3Zl
ZCBpbiBtYXBzIHRvIGFkYXB0IHRvIGNvbnRleHQAAKEPHgAAAFkAAAAAAAAIAAAAABwAAAAAAAAA
PQAAAAAAAgAQAAAAqg8MAAAAWQAAAAYAAAAJEAAAAADzAxQAAAAUAAAAAAAAAAEAAAAKAQAAAAAA
AAAAnw8EAAAAAAAAAAAAqA9FAAAAU2VhcmNoIHdpdGggT3B0aW9ucyBhbmQgUmVzdWx0cyBiYXNl
ZCBvbiBUb3BpYyBUeXBlcyAoKnRhc2sgb3Igb3RoZXIpAAChDyAAAABGAAAAAAAACAAAAAA1AAAA
AAACACgAEQAAAAAAAgAQAAAAqg8MAAAARgAAAAYAAAAJEAAAAADzAxQAAAAXAAAAAAAAAAIAAAAM
AQAAAAAAAAAAnw8EAAAAAAAAAAAAqA8KAAAASGlnaGxpZ2h0cwAAoQ8UAAAACwAAAAAAAAgAAAAA
CwAAAAAAAAAAAKoPDAAAAAsAAAAGAAAACRAAABAAnw8EAAAAAQAAAAAAqA9iAQAAVGl0bGVzIGFu
ZCB0aGUgY29udGVudCBhcmUgaW5kZXhlZCBzZXBhcmF0ZWx5IGluIFRFWFRNTCBTZXJ2ZXIgdG8g
b2ZmZXIgbW9yZSBwcmVjaXNlIHNlYXJjaCBjYXBhYmlsaXRpZXMgdG8gdXNlcnMuDVN5bm9ueW1v
dXMgYXJlIGluY2x1ZGVkIGluIHRoZSBwcm9sb2cva2V5d29yZCBlbGVtZW50LiBTbyB3aGVuIGEg
dXNlcnMgZG8gbm90IGtub3cgdGhlIGV4YWN0IGV4cHJlc3Npb24gdXNlZCBpbiB0aGUgdGV4dCwg
dGhleSBjYW4gZmluZCByZWxhdGVkIGluZm9ybWF0aW9uLiANUmVzdWx0cyBhcmUgc2VwYXJhdGVk
IGludG8gZGVzY3JpcHRpb25zIChjb25jZXB0cywgdG9waWNzLCByZWZlcmVuY2VzKSBhbmQgdGFz
a3MuAAChDxQAAABjAQAAAAAAEAAAWgBjAQAAAAAAAAAAqg8mAAAAkgAAAAYAAAAJEAAABgAAAAcA
AAADAAkQAADLAAAABgAAAAkQAAAAAPMDFAAAAAgAAAAEAAAAAgAAAAQBAAAAAAAAAACfDwQAAAAA
AAAAAACoDyUAAABDcmVhdGluZyB0aGUgV2ViIFNlcnZpY2VzIE9ubGluZSBIZWxwAAChDxYAAAAm
AAAAAAAACAAAAAAmAAAAAAACACgAAACqDwwAAAAmAAAABgAAAAkQAAAQAJ8PBAAAAAEAAAAAAKoP
DAAAAAEAAAAGAAAACRAAAAAA8wMUAAAAFQAAAAAAAAACAAAACQEAAAAAAAAAAJ8PBAAAAAAAAAAA
AKgPCgAAAEhpZ2hsaWdodHMAAKEPFAAAAAsAAAAAAAAIAAAAAAsAAAAAAAAAAACqDwwAAAALAAAA
BgAAAAkQAAAQAJ8PBAAAAAEAAAAAAKAPJgIAAEQAbwBjAHUAbQBlAG4AdABhAHQAaQBvAG4AIABm
AG8AcgAgAFcAZQBiACAAcwBlAHIAdgBpAGMAZQBzACAAbwBwAGUAcgBhAHQAaQBvAG4AcwAgAGkA
cwAgAGEAIABtAGkAeABlAGQAIABvAGYAIABXAFMARABMACAAaQBuAGYAbwByAG0AYQB0AGkAbwBu
ACAAYQBuAGQAIABjAG8AZABlACAAYwBvAG0AbQBlAG4AdABzAC4AIABUAGgAZQAgAGkAbgBmAG8A
cgBtAGEAdABpAG8AbgAgAGkAcwAgAG0AZQByAGcAZQBkACAAdABvAGcAZQB0AGgAZQByAC4AIABF
AGEAYwBoACAAcwBlAHIAdgBpAGMAZQAgAGEAbgBkACAAZQBhAGMAaAAgAG0AZQB0AGgAbwBkAHMA
IABiAGUAYwBvAG0AZQBzACAAYQAgAEQASQBUAEEAIAByAGUAZgBlAHIAZQBuAGMAZQAgAHQAbwBw
AGkAYwAuAA0AIABBACAAHCBzAHUAYgBtAGEAcAAdICAAZgBvAHIAIABhAGwAbAAgAFcAZQBiACAA
UwBlAHIAdgBpAGMAZQBzACAAaQBzACAAYwByAGUAYQB0AGUAZAAgAGEAbgBkACAAcgBlAGYAZQBy
AGUAbgBjAGUAZAAgAGIAeQAgAHQAaABlACAAZwBsAG8AYgBhAGwAIABwAHIAbwBqAGUAYwB0ACAA
bQBhAHAALgAAAKEPFAAAABQBAAAAAAAAAAAUAQAAAAACABwAAACqDyYAAADCAAAABgAAAAkQAAAG
AAAABwAAAAMACRAAAEwAAAAGAAAACRAAAAAA8wMUAAAAFgAAAAAAAAABAAAACwEAAAAAAAAAAJ8P
BAAAAAAAAAAAAKgPFAAAAFdlYiBTZXJ2aWNlcyBNZXRob2RzAAChDxYAAAAVAAAAAAAACAAAAAAV
AAAAAAACACgAAACqDwwAAAAVAAAABgAAAAkQAAAAAPMDFAAAABgAAAAAAAAAAQAAAA0BAAAAAAAA
AACfDwQAAAAAAAAAAACoDx4AAABDcmVhdGluZyBhIFBERiBUcmFpbmluZyBNYW51YWwAAKEPFAAA
AB8AAAAAAAAIAAAAAB8AAAAAAAAAAACqDwwAAAAfAAAABgAAAAkQAAAAAPMDFAAAABkAAAAAAAAA
AgAAAA4BAAAAAAAAAACfDwQAAAAAAAAAAACoDwoAAABIaWdobGlnaHRzAAChDxQAAAALAAAAAAAA
CAAAAAALAAAAAAAAAAAAqg8MAAAACwAAAAYAAAAJEAAAEACfDwQAAAABAAAAAACgD/oDAABUAHIA
YQBpAG4AaQBuAGcAIABzAGUAcwBzAGkAbwBuAHMAIABhAHIAZQAgAGEAbABtAG8AcwB0ACAAYQBs
AHcAYQB5AHMAIABkAGkAZgBmAGUAcgBlAG4AdAAgAGIAZQBjAGEAdQBzAGUAIAB0AGgAZQAgAG4A
ZQBlAGQAcwAgAHYAYQByAHkAOgANAE4AZQB3ACAAdQBzAGUAcgBzACAAdwBoAG8AIAB3AGEAbgB0
ACAAdABoAGUAIABwAHIAbwBkAHUAYwB0ACAAZgBvAHIAIABtAGUAZABpAGEAIABtAG8AbgBpAHQA
bwByAGkAbgBnAA0ATgBlAHcAIAB1AHMAZQByAHMAIAB3AGgAbwAgAHcAYQBuAHQAIAB0AG8AIABz
AGgAYQByAGUAIABuAGUAdwBzACAAbwBuACAAdABoAGUAaQByACAAaQBuAHQAcgBhAG4AZQB0AA0A
TgBlAHcAIAAcIGsAbgBvAHcAbABlAGQAZwBlACAAbQBhAG4AYQBnAGUAbQBlAG4AdAAdICAAdQBz
AGUAcgAgAHcAaABvACAAbgBlAGUAZABzACAAdABvACAAbABlAGEAcgBuACAAaABvAHcAIAB0AG8A
IABjAHIAZQBhAHQAZQAgAGEAZAB2AGEAbgBjAGUAZAAgAHEAdQBlAHIAaQBlAHMADQBSAGUAZwB1
AGwAYQByACAAdQBzAGUAcgBzACAAdwBoAG8AIAB3AGEAbgB0ACAAdABvACAAbABlAGEAcgBuACAA
bgBlAHcAIABmAHUAbgBjAHQAaQBvAG4AYQBsAGkAdABpAGUAcwANAFIAZQBnAHUAbABhAHIAIAB1
AHMAZQByACAAdwBoAG8AIABhAHIAZQAgAGcAbwBpAG4AZwAgAHQAbwAgAHUAcwBlACAAdABoAGUA
IAB0AG8AbwBsACAAZgBvAHIAIABuAGUAdwAgAHAAdQByAHAAbwBzAGUAcwANAEMAbwBtAHAAdQB0
AGUAcgAgAGwAaQB0AGUAcgBhAHQAZQAgAHUAcwBlAHIAcwAgAHYAcwAgAG4AbwB0AC0AcwBvAC0A
YwBvAG0AcAB1AHQAZQByACAAbABpAHQAZQByAGEAdABlACAAdQBzAGUAcgBzACYgDQBEAG8AYwB1
AG0AZQBuAHQAcwAgAGkAbgBjAGwAdQBkAGUAIAB0AGgAZQAgAHMAYQBtAGUAIABrAGkAbgBkACAA
bwBmACAAdABhAGIAbABlACAAbwBmACAAYwBvAG4AdABlAG4AdAAgAGEAbgBkACAAaQBuAGQAZQB4
ACAAYQBzACAAdABoAGUAIABvAG4AbABpAG4AZQAgAGgAZQBsAHAALgANACAAAAChD1AAAABGAAAA
AAAAEAAAWgBkAQAAAQAAEAAAWgBSAAAAAAAAEAAAWgACAAAAAAABEAAAAABaAEYAAAAAAAIAGABk
AQAAAAACABQAVAAAAAAAAgAYAAAAqg8mAAAAhwEAAAYAAAAJEAAAAgAAAAcAAAADAAkQAAB1AAAA
BgAAAAkQAAAAAPMDFAAAABoAAAAEAAAAAQAAAA8BAAAAAAAAAACfDwQAAAAAAAAAAACoDywAAABF
bGVtZW50cyBvZiBQREYgRG9jdW1lbnRzIGJhc2VkIG9uIERJVEEgbWFwcwAAoQ8WAAAALQAAAAAA
AAgAAAAALQAAAAAAAgAoAAAAqg8MAAAALQAAAAYAAAAJEAAALwDwD6gAAAAAAPMDFAAAAAsAAAAA
AAAAAAAAAAABAAAAAAAAAADzAxQAAAAMAAAAAAAAAAAAAAABAQAAAAAAAAAA8wMUAAAADQAAAAAA
AAAAAAAAAgEAAAAAAAAAAPMDFAAAAA4AAAAAAAAAAAAAAAMBAAAAAAAAAADzAxQAAAAPAAAAAAAA
AAAAAAAEAQAAAAAAAAAA8wMUAAAAEAAAAAAAAAAAAAAABQEAAAAAAAAAAOoDAAAAAA8A7gOhCgAA
AgDvAxgAAAABAAAADQ4AAAAAAAAAAACAAgEAAAcAEwAPAAwEwAEAAA8AAvC4AQAAcAAI8AgAAAAD
AAAABRwAAA8AA/BQAQAADwAE8CgAAAABAAnwEAAAAAAAAAAAAAAAAAAAAAAAAAACAArwCAAAAAAc
AAAFAAAADwAE8HIAAAASAArwCAAAAAQcAAAgAgAAUwAL8B4AAAB/AAAABACAAJTtDQO/AQAAAQD/
AQAAAQABAwIEAAAAABDwCAAAAK0AIAFgFX0DDwAR8BAAAAAAAMMLCAAAAAAAAAANAA0DDwAN8AwA
AAAAAJ4PBAAAAAAAAAAPAATwngAAABIACvAIAAAABRwAACACAABTAAvwHgAAAH8AAAAEAIAAkO4N
A78BAAABAP8BAAABAAEDAwQAAAAAEPAIAAAA8AMgAWAVEw8PABHwPAAAAA8AFBAkAAAAAQDxDxwA
AAAAAAAHAAAAAAAAAAAAAAAAAgABAAIAAAAAAAowAADDCwgAAAABAAAADgANAw8ADfAMAAAAAACe
DwQAAAABAAAADwAE8EgAAAASAArwCAAAAAEcAAAADAAAgwAL8DAAAACBAQAAAAiDAQUAAAiTAY6f
iwCUAd69aAC/ARIAEgD/AQAACAAEAwkAAAA/AwEAAQAQAPAHIAAAAP///wAAAAAAgICAAAAAAAC7
4OMAMzOZAACZmQCZzAAADwCIE4kIAAAPAIoTgQgAAAAAug8QAAAAXwBfAF8AUABQAFQAMQAwAAAA
ixNhCAAAAADqLgQAAAACAAAAAADrLggAAAD0WsQBUFt1RwAAACsEAAAA3W4MKR8ARPHxBwAAAAAn
8SAAAAAAAAAAAwAAAAAAAAAAAAAAAAAAAACmEwD/////EgAAAA8APfENAAAAQAFC8QUAAAABCQAA
AB8ARPGsBwAAAAAn8SAAAAAAAAAAAAAAAAEAAAAAAAAAAAAAAAAAAAD/////GAAAAA8APfENAAAA
QAFC8QUAAAABBAAAAAAAQfEUAAAAAQAAAAEAAAAAAAAAAAAAAAMAAAA/ACXxLAAAAAAAKPEQAAAA
AQAAAAkAAAAAAAAAAAAAAA8APPEMAAAAAAABKwQAAAABAAAATwAl8SwAAAAAACjxEAAAAAEAAAAK
AAAAAAAAAAAAAAAPADzxDAAAAAAAASsEAAAAAQAAAB8ARPFaBAAAAAAn8SAAAAAAAAAAAAAAAAAA
AAADAAAAAAAAAACkEwAAAAAAAQAAAA8APfEAAAAAHwAl8RgAAAAAACjxEAAAAAAAAAAAAAAAAAAA
AP////8fAETxAgQAAAAAJ/EgAAAAAAAAAAAAAAAAAAAAAwAAAAAAAAAAAAAAAAAAAAEAAAAPAD3x
AAAAAB8AJfEYAAAAAAAo8RAAAAAAAAAAAAAAAAAAAAAAAAAAHwBE8dEBAAAAACfxIAAAAAAAAAAA
AAAAAAAAAAMAAAAAAAAAAAAAAAAAAAABAAAADwA98UEAAACQAELxBQAAAAEBAAAAoABC8QUAAAAB
AAAAALAAQvEFAAAAAQEAAABAAULxBQAAAAEBAAAAMAFC8QUAAAABAAAAAB8AJfEYAAAAAAAo8RAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAp8QgAAAADAAAAAAAAAAAAKfEIAAAABAAAAAAAAAAAACnxCAAA
AAUAAAAAAAAAAAAp8QgAAAAAAAAAAACAPx8ARPH4AAAAAAAn8SAAAAAAAAAAAAAAAAMAAAADAAAA
AAAAAACiEwABAAAAGQAAAA8APfEAAAAADwAx8aAAAAAAADrxCAAAAAEAAAABAAAAEABC8REAAAAD
dgBpAHMAaQBiAGwAZQAAAA8AKvFvAAAAAAAz8RAAAAAEAAAAAAAAAAAAAAAAAAAAHwA+8SsAAAAA
AELxIwAAAANzAHQAeQBsAGUALgB2AGkAcwBpAGIAaQBsAGkAdAB5AAAADwA88RwAAAAAAPsqFAAA
AAIAAAABAAAABRwAAAAAAABNAAAAHwAl8RgAAAAAACjxEAAAAAAAAAAAAAAAAAAAAAAAAAAfAETx
0QEAAAAAJ/EgAAAAAAAAAAAAAAAAAAAAAwAAAAAAAAAAAAAAAAAAAAEAAAAPAD3xQQAAAJAAQvEF
AAAAAQEAAACgAELxBQAAAAEAAAAAsABC8QUAAAABAQAAAEABQvEFAAAAAQIAAAAwAULxBQAAAAEA
AAAAHwAl8RgAAAAAACjxEAAAAAAAAAAAAAAAAAAAAAAAAAAAACnxCAAAAAMAAAAAAAAAAAAp8QgA
AAAEAAAAAAAAAAAAKfEIAAAABQAAAAAAAAAAACnxCAAAAAAAAAAAAIA/HwBE8fgAAAAAACfxIAAA
AAAAAAAAAAAAAwAAAAMAAAAAAAAAAKITAAEAAAAZAAAADwA98QAAAAAPADHxoAAAAAAAOvEIAAAA
AQAAAAEAAAAQAELxEQAAAAN2AGkAcwBpAGIAbABlAAAADwAq8W8AAAAAADPxEAAAAAQAAAAAAAAA
AAAAAAAAAAAfAD7xKwAAAAAAQvEjAAAAA3MAdAB5AGwAZQAuAHYAaQBzAGkAYgBpAGwAaQB0AHkA
AAAPADzxHAAAAAAA+yoUAAAAAgAAAAEAAAAFHAAATQAAAOwAAAAfACXxGAAAAAAAKPEQAAAAAAAA
AAAAAAAAAAAAAAAAAB8ARPGBAgAAAAAn8SAAAAAAAAAAAAAAAAAAAAADAAAAAAAAAACkEwAAAAAA
AQAAAA8APfEAAAAAHwAl8RgAAAAAACjxEAAAAAAAAAAAAAAAAAAAAP////8fAETxKQIAAAAAJ/Eg
AAAAAAAAAAAAAAAAAAAAAwAAAAAAAAAAAAAAAAAAAAEAAAAPAD3xAAAAAB8AJfEYAAAAAAAo8RAA
AAAAAAAAAAAAAAAAAAAAAAAAHwBE8dEBAAAAACfxIAAAAAAAAAAAAAAAAAAAAAMAAAAAAAAAAAAA
AAAAAAABAAAADwA98UEAAACQAELxBQAAAAEBAAAAoABC8QUAAAABAAAAALAAQvEFAAAAAQEAAABA
AULxBQAAAAEBAAAAMAFC8QUAAAABAAAAAB8AJfEYAAAAAAAo8RAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAp8QgAAAADAAAAAAAAAAAAKfEIAAAABAAAAAAAAAAAACnxCAAAAAUAAAAAAAAAAAAp8QgAAAAA
AAAAAACAPx8ARPH4AAAAAAAn8SAAAAAAAAAAAAAAAAMAAAADAAAAAAAAAACiEwABAAAAGQAAAA8A
PfEAAAAADwAx8aAAAAAAADrxCAAAAAEAAAABAAAAEABC8REAAAADdgBpAHMAaQBiAGwAZQAAAA8A
KvFvAAAAAAAz8RAAAAAEAAAAAAAAAAAAAAAAAAAAHwA+8SsAAAAAAELxIwAAAANzAHQAeQBsAGUA
LgB2AGkAcwBpAGIAaQBsAGkAdAB5AAAADwA88RwAAAAAAPsqFAAAAAIAAAABAAAABRwAAOwAAABY
AQAAHwAl8RgAAAAAACjxEAAAAAAAAAAAAAAAAAAAAAAAAAAPAAIrOAAAAA8ACCswAAAAAAADKxAA
AAABAAAAAAAAAAUcAAABAA0DAQAJKxAAAAABAAAAAQAAAAAAAAAAAAAADwDuA8gIAAACAO8DGAAA
AAEAAAANDgAAAAAAAAAAAIAAAAAABwATAA8ADATAAQAADwAC8LgBAADwAQjwCAAAAAMAAAADfAAA
DwAD8FABAAAPAATwKAAAAAEACfAQAAAAAAAAAAAAAAAAAAAAAAAAAAIACvAIAAAAAHwAAAUAAAAP
AATwcgAAABIACvAIAAAAAnwAACACAABTAAvwHgAAAH8AAAAEAIAAIE8tA78BAAABAP8BAAABAAED
AgQAAAAAEPAIAAAArQAgAWAVfQMPABHwEAAAAAAAwwsIAAAAAAAAAA0ALQMPAA3wDAAAAAAAng8E
AAAAAAAAAA8ABPCeAAAAEgAK8AgAAAADfAAAIAIAAFMAC/AeAAAAfwAAAAQAgACsQy0DvwEAAAEA
/wEAAAEAAQMDBAAAAAAQ8AgAAADwAyABYBUTDw8AEfA8AAAADwAUECQAAAABAPEPHAAAAAAAAAcA
BAAAAAAAAAAAAAACAAEAAgAAAAAACjAAAMMLCAAAAAEAAAAOAC0DDwAN8AwAAAAAAJ4PBAAAAAEA
AAAPAATwSAAAABIACvAIAAAAAXwAAAAMAACDAAvwMAAAAIEBAAAACIMBBQAACJMBjp+LAJQB3r1o
AL8BEgASAP8BAAAIAAQDCQAAAD8DAQABABAA8AcgAAAA////AAAAAACAgIAAAAAAALvg4wAzM5kA
AJmZAJnMAAAPAIgTsAYAAA8AihOoBgAAAAC6DxAAAABfAF8AXwBQAFAAVAAxADAAAACLE4gGAAAA
AOouBAAAAAIAAAAAAOsuCAAAAAJbxAGwvw/fAAAAKwQAAADFW1dfHwBE8RgGAAAAACfxIAAAAAAA
AAADAAAAAAAAAAAAAAAAAAAAAKYTAP////8SAAAADwA98Q0AAABAAULxBQAAAAEJAAAAHwBE8dMF
AAAAACfxIAAAAAAAAAAAAAAAAQAAAAAAAAAAAAAAAAAAAP////8YAAAADwA98Q0AAABAAULxBQAA
AAEEAAAAAABB8RQAAAABAAAAAQAAAAAAAAAAAAAAAwAAAD8AJfEsAAAAAAAo8RAAAAABAAAACQAA
AAAAAAAAAAAADwA88QwAAAAAAAErBAAAAAEAAABPACXxLAAAAAAAKPEQAAAAAQAAAAoAAAAAAAAA
AAAAAA8APPEMAAAAAAABKwQAAAABAAAAHwBE8YECAAAAACfxIAAAAAAAAAAAAAAAAAAAAAMAAAAA
AAAAAKQTAAAAAAABAAAADwA98QAAAAAfACXxGAAAAAAAKPEQAAAAAAAAAAAAAAAAAAAA/////x8A
RPEpAgAAAAAn8SAAAAAAAAAAAAAAAAAAAAADAAAAAAAAAAAAAAAAAAAAAQAAAA8APfEAAAAAHwAl
8RgAAAAAACjxEAAAAAAAAAAAAAAAAAAAAAAAAAAfAETx0QEAAAAAJ/EgAAAAAAAAAAAAAAAAAAAA
AwAAAAAAAAAAAAAAAAAAAAEAAAAPAD3xQQAAAJAAQvEFAAAAAQEAAACgAELxBQAAAAEAAAAAsABC
8QUAAAABAQAAAEABQvEFAAAAAQEAAAAwAULxBQAAAAEAAQAAAAIAAAADAAAABAAAAAUAAAAGAAAA
BwAAAAgAAAAJAAAACgAAAAsAAAAMAAAADQAAAA4AAAAPAAAAEAAAABEAAAASAAAAEwAAABQAAAAV
AAAAFgAAABcAAAAYAAAAGQAAABoAAAAbAAAAHAAAAB0AAAAeAAAAHwAAACAAAAAhAAAAIgAAACMA
AAAkAAAAJQAAACYAAAAnAAAAKAAAACkAAAAqAAAAKwAAACwAAAAtAAAALgAAAC8AAAAwAAAAMQAA
ADIAAAAzAAAANAAAADUAAAA2AAAANwAAADgAAAA5AAAAOgAAADsAAAA8AAAAPQAAAD4AAAA/AAAA
QAAAAEEAAABCAAAAQwAAAEQAAABFAAAARgAAAEcAAABIAAAASQAAAEoAAABLAAAATAAAAE0AAABO
AAAATwAAAFAAAABRAAAAUgAAAFMAAABUAAAAVQAAAFYAAABXAAAAWAAAAFkAAABaAAAAWwAAAFwA
AABdAAAAXgAAAF8AAABgAAAAYQAAAGIAAABjAAAAZAAAAGUAAABmAAAAZwAAAGgAAABpAAAAagAA
AGsAAABsAAAAbQAAAG4AAABvAAAAcAAAAHEAAAByAAAAcwAAAHQAAAB1AAAAdgAAAHcAAAB4AAAA
eQAAAHoAAAB7AAAAfAAAAH0AAAB+AAAAfwAAAIAAAACBAAAAggAAAIMAAACEAAAAhQAAAIYAAACH
AAAAiAAAAIkAAACKAAAAiwAAAIwAAACNAAAAjgAAAI8AAACQAAAAkQAAAJIAAACTAAAAlAAAAJUA
AACWAAAAlwAAAJgAAACZAAAAmgAAAJsAAACcAAAAnQAAAJ4AAACfAAAAoAAAAKEAAACiAAAAowAA
AKQAAAClAAAApgAAAKcAAACoAAAAqQAAAKoAAACrAAAArAAAAK0AAACuAAAArwAAALAAAACxAAAA
sgAAALMAAAC0AAAAtQAAALYAAAC3AAAAuAAAALkAAAC6AAAAuwAAALwAAAC9AAAAvgAAAL8AAADA
AAAAwQAAAMIAAADDAAAAxAAAAMUAAADGAAAAxwAAAMgAAADJAAAAygAAAMsAAADMAAAAzQAAAM4A
AADPAAAA0AAAANEAAADSAAAA0wAAANQAAADVAAAA1gAAANcAAADYAAAA2QAAANoAAADbAAAA3AAA
AN0AAADeAAAA3wAAAOAAAADhAAAA4gAAAOMAAADkAAAA5QAAAOYAAADnAAAA6AAAAOkAAADqAAAA
6wAAAOwAAADtAAAA7gAAAO8AAADwAAAA8QAAAPIAAADzAAAA9AAAAPUAAAD2AAAA9wAAAPgAAAD5
AAAA+gAAAPsAAAD8AAAA/QAAAP4AAAD/AAAAAAEAAAEBAAACAQAAAwEAAAQBAAAFAQAABgEAAAcB
AAAIAQAACQEAAAoBAAALAQAADAEAAA0BAAAOAQAADwEAABABAAARAQAAEgEAABMBAAAUAQAAFQEA
ABYBAAAXAQAAGAEAABkBAAAaAQAAGwEAABwBAAAdAQAAHgEAAB8BAAAgAQAAIQEAACIBAAAjAQAA
JAEAACUBAAAmAQAAJwEAACgBAAApAQAAKgEAACsBAAAsAQAALQEAAC4BAAAvAQAAMAEAADEBAAAy
AQAAMwEAADQBAAA1AQAANgEAADcBAAA4AQAAOQEAADoBAAA7AQAAPAEAAD0BAAA+AQAAPwEAAEAB
AABBAQAAQgEAAEMBAABEAQAARQEAAEYBAABHAQAASAEAAEkBAABKAQAASwEAAEwBAABNAQAATgEA
AE8BAABQAQAAUQEAAFIBAABTAQAAVAEAAFUBAABWAQAAVwEAAFgBAABZAQAAWgEAAFsBAABcAQAA
XQEAAF4BAABfAQAAYAEAAGEBAABiAQAAYwEAAGQBAABlAQAAZgEAAGcBAABoAQAAaQEAAGoBAABr
AQAAbAEAAG0BAABuAQAAbwEAAHABAABxAQAAcgEAAHMBAAB0AQAAdQEAAHYBAAB3AQAAeAEAAHkB
AAB6AQAAewEAAHwBAAB9AQAAfgEAAH8BAACAAQAAgQEAAIIBAACDAQAAhAEAAIUBAACGAQAAhwEA
AIgBAACJAQAAigEAAIsBAACMAQAAjQEAAI4BAACPAQAAkAEAAJEBAACSAQAAkwEAAJQBAACVAQAA
lgEAAJcBAACYAQAAmQEAAJoBAACbAQAAnAEAAJ0BAACeAQAAnwEAAKABAAChAQAAogEAAKMBAACk
AQAApQEAAKYBAACnAQAAqAEAAKkBAACqAQAAqwEAAKwBAACtAQAArgEAAK8BAACwAQAAsQEAALIB
AACzAQAAtAEAALUBAAC2AQAAtwEAALgBAAC5AQAAugEAALsBAAC8AQAAvQEAAL4BAAC/AQAAwAEA
AMEBAADCAQAAwwEAAMQBAADFAQAAxgEAAMcBAADIAQAAyQEAAMoBAADLAQAAzAEAAM0BAADOAQAA
zwEAANABAADRAQAA0gEAANMBAADUAQAA1QEAANYBAADXAQAA2AEAANkBAADaAQAA2wEAANwBAADd
AQAA3gEAAN8BAADgAQAA4QEAAOIBAADjAQAA5AEAAOUBAADmAQAA5wEAAOgBAADpAQAA6gEAAOsB
AADsAQAA7QEAAO4BAADvAQAA8AEAAPEBAADyAQAA8wEAAPQBAAD1AQAA9gEAAPcBAAD4AQAA+QEA
APoBAAD7AQAA/AEAAP0BAAD+AQAA/wEAAAACAAABAgAAAgIAAAMCAAAEAgAABQIAAAYCAAAHAgAA
CAIAAAkCAAAKAgAACwIAAAwCAAANAgAADgIAAA8CAAAQAgAAEQIAABICAAATAgAAFAIAABUCAAAW
AgAAFwIAABgCAAAZAgAAGgIAABsCAAAcAgAAHQIAAB4CAAAfAgAAIAIAACECAAAiAgAAIwIAACQC
AAAlAgAAJgIAACcCAAAoAgAAKQIAACoCAAArAgAALAIAAC0CAAAuAgAALwIAADACAAAxAgAAMgIA
ADMCAAA0AgAANQIAADYCAAA3AgAAOAIAADkCAAA6AgAAOwIAADwCAAA9AgAAPgIAAD8CAABAAgAA
QQIAAEICAABDAgAARAIAAEUCAABGAgAARwIAAEgCAABJAgAASgIAAEsCAABMAgAATQIAAE4CAABP
AgAAUAIAAFECAABSAgAAUwIAAFQCAABVAgAAVgIAAFcCAABYAgAAWQIAAFoCAABbAgAAXAIAAF0C
AABeAgAAXwIAAGACAABhAgAAYgIAAGMCAABkAgAAZQIAAGYCAABnAgAAaAIAAGkCAABqAgAAawIA
AGwCAABtAgAAbgIAAG8CAABwAgAAcQIAAHICAABzAgAAdAIAAHUCAAB2AgAAdwIAAHgCAAB5AgAA
egIAAHsCAAB8AgAAfQIAAH4CAAB/AgAAgAIAAIECAACCAgAAgwIAAIQCAACFAgAAhgIAAIcCAACI
AgAAiQIAAIoCAACLAgAAjAIAAI0CAACOAgAAjwIAAJACAACRAgAAkgIAAJMCAACUAgAAlQIAAJYC
AACXAgAAmAIAAJkCAACaAgAAmwIAAJwCAACdAgAAngIAAJ8CAACgAgAAoQIAAKICAACjAgAApAIA
AKUCAACmAgAApwIAAKgCAACpAgAAqgIAAKsCAACsAgAArQIAAK4CAACvAgAAsAIAALECAACyAgAA
swIAALQCAAC1AgAAtgIAALcCAAC4AgAAuQIAALoCAAC7AgAAvAIAAL0CAAC+AgAAvwIAAMACAADB
AgAAwgIAAMMCAADEAgAAxQIAAMYCAADHAgAAyAIAAMkCAADKAgAAywIAAMwCAADNAgAAzgIAAM8C
AADQAgAA0QIAANICAADTAgAA1AIAANUCAADWAgAA1wIAANgCAADZAgAA2gIAANsCAADcAgAA3QIA
AN4CAADfAgAA4AIAAOECAADiAgAA4wIAAOQCAADlAgAA5gIAAOcCAADoAgAA6QIAAOoCAADrAgAA
7AIAAO0CAADuAgAA7wIAAPACAADxAgAA8gIAAPMCAAD0AgAA9QIAAPYCAAD3AgAA+AIAAPkCAAD6
AgAA+wIAAPwCAAD9AgAA/gIAAP8CAAAAAwAAAQMAAAIDAAADAwAABAMAAAUDAAAGAwAABwMAAAgD
AAAJAwAACgMAAAsDAAAMAwAADQMAAA4DAAAPAwAAEAMAABEDAAASAwAAEwMAABQDAAAVAwAAFgMA
ABcDAAAYAwAAGQMAABoDAAAbAwAAHAMAAB0DAAAeAwAAHwMAACADAAAhAwAAIgMAACMDAAAkAwAA
JQMAACYDAAAnAwAAKAMAACkDAAAqAwAAKwMAACwDAAAtAwAALgMAAC8DAAAwAwAAMQMAADIDAAAz
AwAANAMAADUDAAA2AwAANwMAADgDAAA5AwAAOgMAADsDAAA8AwAAPQMAAD4DAAA/AwAAQAMAAEED
AABCAwAAQwMAAEQDAABFAwAARgMAAEcDAABIAwAASQMAAEoDAABLAwAATAMAAE0DAABOAwAATwMA
AFADAABRAwAAUgMAAFMDAABUAwAAVQMAAFYDAABXAwAAWAMAAFkDAABaAwAAWwMAAFwDAABdAwAA
XgMAAF8DAABgAwAAYQMAAGIDAABjAwAAZAMAAGUDAABmAwAAZwMAAGgDAABpAwAAagMAAGsDAABs
AwAAbQMAAG4DAABvAwAAcAMAAHEDAAByAwAAcwMAAHQDAAB1AwAAdgMAAHcDAAB4AwAAeQMAAHoD
AAB7AwAAfAMAAH0DAAB+AwAAfwMAAIADAACBAwAAggMAAIMDAACEAwAAhQMAAIYDAACHAwAAiAMA
AIkDAACKAwAAiwMAAIwDAACNAwAAjgMAAI8DAACQAwAAkQMAAJIDAACTAwAAlAMAAJUDAACWAwAA
lwMAAJgDAACZAwAAmgMAAJsDAACcAwAAnQMAAJ4DAACfAwAAoAMAAKEDAACiAwAAowMAAKQDAACl
AwAApgMAAKcDAACoAwAAqQMAAKoDAACrAwAArAMAAK0DAACuAwAArwMAALADAACxAwAAsgMAALMD
AAC0AwAAtQMAALYDAAC3AwAAuAMAALkDAAC6AwAAuwMAALwDAAC9AwAAvgMAAL8DAADAAwAAwQMA
AMIDAADDAwAAxAMAAMUDAADGAwAAxwMAAMgDAADJAwAAygMAAMsDAADMAwAAzQMAAM4DAADPAwAA
0AMAANEDAADSAwAA0wMAANQDAADVAwAA1gMAANcDAADYAwAA2QMAANoDAADbAwAA3AMAAN0DAADe
AwAA3wMAAOADAADhAwAA4gMAAOMDAADkAwAA5QMAAOYDAADnAwAA6AMAAOkDAADqAwAA6wMAAOwD
AADtAwAA7gMAAO8DAADwAwAA8QMAAPIDAADzAwAA9AMAAPUDAAD2AwAA9wMAAPgDAAD5AwAA+gMA
APsDAAD8AwAA/QMAAP4DAAD/AwAAAAQAAAEEAAACBAAAAwQAAAQEAAAFBAAABgQAAAcEAAAIBAAA
CQQAAAoEAAALBAAADAQAAA0EAAAOBAAADwQAABAEAAARBAAAEgQAABMEAAAUBAAAFQQAABYEAAAX
BAAAGAQAABkEAAAaBAAAGwQAABwEAAAdBAAAHgQAAB8EAAAgBAAAIQQAACIEAAAjBAAAJAQAACUE
AAAmBAAAJwQAACgEAAApBAAAKgQAACsEAAAsBAAALQQAAC4EAAAvBAAAMAQAADEEAAAyBAAAMwQA
ADQEAAA1BAAANgQAADcEAAA4BAAAOQQAADoEAAA7BAAAPAQAAD0EAAA+BAAAPwQAAEAEAABBBAAA
QgQAAEMEAABEBAAARQQAAEYEAABHBAAASAQAAEkEAABKBAAASwQAAEwEAABNBAAATgQAAE8EAABQ
BAAAUQQAAFIEAABTBAAAVAQAAFUEAABWBAAAVwQAAFgEAABZBAAAWgQAAFsEAABcBAAAXQQAAF4E
AABfBAAAYAQAAGEEAABiBAAAYwQAAGQEAABlBAAAZgQAAGcEAABoBAAAaQQAAGoEAABrBAAAbAQA
AG0EAABuBAAAbwQAAHAEAABxBAAAcgQAAHMEAAB0BAAAdQQAAHYEAAB3BAAAeAQAAHkEAAB6BAAA
ewQAAHwEAAB9BAAAfgQAAH8EAACABAAAgQQAAIIEAABKBQAAhAQAAIUEAACGBAAAhwQAAIgEAACJ
BAAAigQAAIsEAACMBAAAjQQAAI4EAACPBAAAkAQAAJEEAACSBAAAkwQAAJQEAACVBAAAlgQAAJcE
AACYBAAAmQQAAJoEAACbBAAAnAQAAJ0EAACeBAAAnwQAAKAEAAChBAAAogQAAKMEAACkBAAApQQA
AKYEAACnBAAAqAQAAKkEAACqBAAAqwQAAKwEAACtBAAArgQAAK8EAACwBAAAsQQAALIEAACzBAAA
tAQAALUEAAC2BAAAtwQAALgEAAC5BAAAugQAALsEAAC8BAAAvQQAAL4EAAC/BAAAwAQAAMEEAADC
BAAAwwQAAMQEAADFBAAAxgQAAMcEAADIBAAAyQQAAMoEAADLBAAAzAQAAM0EAADOBAAAzwQAANAE
AADRBAAA0gQAANMEAADUBAAA1QQAANYEAADXBAAA2AQAANkEAADaBAAA2wQAANwEAADdBAAA3gQA
AN8EAADgBAAA4QQAAOIEAADjBAAA5AQAAAoFAADmBAAA/v///+gEAADpBAAA6gQAAOsEAADsBAAA
7QQAAO4EAADvBAAA8AQAAPEEAADyBAAA8wQAAPQEAAD1BAAA9gQAAPcEAAD4BAAA+QQAAPoEAAD7
BAAA/AQAACYFAAD9/////f////3////9/////f////3////9/////f////3////9/////f///wkF
AAD+////CwUAAAwFAAANBQAADgUAAA8FAAAQBQAAEQUAABIFAAATBQAAFAUAABUFAAAWBQAAFwUA
ABgFAAAZBQAAGgUAABsFAAAcBQAAHQUAAB4FAAAfBQAAIAUAAOcEAAD+////IwUAACQFAAAlBQAA
5QQAACcFAAAoBQAAKQUAACoFAAArBQAALAUAAC0FAAAuBQAALwUAADAFAAAxBQAAMgUAADMFAAA0
BQAANQUAADYFAAA3BQAAOQUAAL4GAAA6BQAAOwUAADwFAAA9BQAAPgUAAD8FAABABQAAQQUAAEIF
AABDBQAARAUAAEUFAABGBQAARwUAAEgFAAA9BgAA/f///0sFAABMBQAATQUAAE4FAABPBQAAUAUA
AFEFAABSBQAAUwUAAFQFAABVBQAAVgUAAFcFAABYBQAAWQUAAFoFAABbBQAAXAUAAF0FAABeBQAA
XwUAAGAFAABhBQAAYgUAAGMFAABkBQAAZQUAAGYFAABnBQAAaAUAAGkFAABqBQAAawUAAGwFAABt
BQAAbgUAAG8FAABwBQAAcQUAAHIFAABzBQAAdAUAAHUFAAB2BQAAdwUAAHgFAAB5BQAAegUAAHsF
AAB8BQAAfQUAAH4FAAB/BQAAgAUAAFIAbwBvAHQAIABFAG4AdAByAHkAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAWAAUB//////////8DAAAAEI2BZJtPzxGG6gCq
ALkp6AAAAAAAAAAAAAAAABBJQQsZXcQBIgUAAIALAAAAAAAAUABpAGMAdAB1AHIAZQBzAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAABIAAgH/////AgAAAP//
//8AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAmegKAAAAAABDAHUAcgBy
AGUAbgB0ACAAVQBzAGUAcgAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
GgACAP///////////////wAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAABE
AAAAAAAAAAUAUwB1AG0AbQBhAHIAeQBJAG4AZgBvAHIAbQBhAHQAaQBvAG4AAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAoAAIBAQAAAAUAAAD/////AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAkwYAAChVAAAAAAAAUABvAHcAZQByAFAAbwBpAG4AdAAgAEQAbwBjAHUAbQBlAG4A
dAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACgAAgH///////////////8AAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAACDBAAAvTICAAAAAAAFAEQAbwBjAHUAbQBlAG4AdABTAHUA
bQBtAGEAcgB5AEkAbgBmAG8AcgBtAGEAdABpAG8AbgAAAAAAAAAAAAAAOAACAQQAAAD/////////
/wAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAB0AAAAMBAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAA////////////////AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAD///////////////8AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACAAAABAAAAAMAAAA6AAAAAAAAAAYAAAAFAAAACAAAAAAA
AAAGAAAABwAAAAYAAAAIAAAACQAAAAAAAAAGAAAACgAAAAQAAAALAAAABgAAAAwAAAAIAAAADQAA
AAQAAAAOAAAABAAAAA8AAAAEAAAAEAAAAAQAAAARAAAABAAAABIAAAAEAAAAEwAAAAcAAAAAAAAA
BgAAABUAAAAHAAAAAAAAAAYAAAAXAAAACQAAAAAAAAAGAAAAAAAAAAYAAAAAAAAABgAAAAAAAAAG
AAAAAAAAAAYAAAAAAAAABgAAAAAAAAAGAAAAHwAAAAQAAAAgAAAABwAAAAAAAAAGAAAAIgAAAAcA
AAAAAAAABgAAACQAAAAEAAAAJQAAAAYAAAAAAAAABgAAACcAAAAEAAAAKAAAAAgAAAAAAAAABgAA
AAAAAAAIAAAAAAAAAAQAAADPAAHwEAIAAGIAB/AkAAAABgYelvGRPXdzPT3+rkbdW1Ya/wBBNQAA
AQAAAAAAAAAAAAAAUgAH8CQAAAAFBZbmoOAtd5mXPygPkhrv6Zv/AKs0AQABAAAAQTUAAAAAAABS
AAfwJAAAAAUFvDoCjWlz7AohAcDNA0I7NP8Afa4AAAEAAADsaQEAAAAAAFIAB/AkAAAABQUgNygN
C8A6tnyPZzDhCBYP/wBjhAEAAQAAAGkYAgAAAAAAUgAH8CQAAAAFBQpbciOiNlEZXK4hgIEMMvX/
AKDrAAABAAAAzJwDAAAAAABSAAfwJAAAAAUF7RdMnOsaYv8wAWqo3hmEnv8AEhoBAAEAAABsiAQA
AAAAAFIAB/AkAAAABQXsMAhTRvPphSUn/PKkUIz6/wAoTwAAAQAAAH6iBQAAAAAAUgAH8CQAAAAF
Bb5JbcHZE9enm1sGyU1kaHf/AC5rAQABAAAApvEFAAAAAABSAAfwJAAAAAUFeODceMq2/pxGaXV0
UEP1y/8AWQoBAAEAAADUXAcAAAAAAGIAB/AkAAAABgYYZJxvHO0pM36ie0IuSp9C/wBKIgAAAQAA
AC1nCAAAAAAAYgAH8CQAAAAGBjamMAYnllS2k1n2xT19Pwj/ACsqAAABAAAAd4kIAAAAAABiAAfw
JAAAAAYGcoueyxhAvdfaoFTFcKgqlf8AE1EAAAEAAACiswgAAAAAAIMAC/AwAAAAgQEEAAAIgwEA
AAAIhkEAAAAAvwEQABAAwAEBAAAIxUEAAAAA/wEIAAgAAQICAAAIEAAa8QQAAAD/AAAAQAAe8RAA
AAD//////wAAAAIAAAj3AAAQHwDwDxwAAAAAAPMDFAAAAAIAAAAAAAAAAAAAAAAAAIAAAAAADwDQ
B3EBAAAfABQEHAAAAAAAFQQUAAAAmyjdCgDKmjutB5THAMqaOwEBAAAPAPoDZwAAAAAA/gMDAAAA
AAEAAAD9AzQAAABBAAAAZAAAAEEAAABkAAAACAAAAAAAAABUpRMAOkEJMAAAAAAAAAAAoP////j+
//8BABMAcAD7AwgAAAAAAAAAcAgAAHAA+wMIAAAAAQAAAEALAAAfABMEPAAAAAAA/QM0AAAAZAAA
AGQAAABkAAAAZAAAAIClEwDqJAkwvKYTAFh+lwAAAAAAAAAAAAAAAAAAAAAAAAETAB8A/wMUAAAA
AgAABAwAAAAAAAAAAAAAAAIAAAAPAIgTdgAAAA8AihMwAAAAAAC6DxAAAABfAF8AXwBQAFAAVAAx
ADAAAACLExAAAAAAAA0ECAAAAHC1AABwtQAADwCKEzYAAAAAALoPDgAAAF8AXwBfAFAAUABUADkA
AACLExgAAAAAAHsXEAAAABylEwDkBAAAAwADAAIPQTA/ANkPDAAAAAAA2g8EAAAADQAlAA8A8A9Y
GAAAAADzAxQAAAADAAAAAAAAAAIAAAAAAQAAAAAAAAAAnw8EAAAABgAAAAAAoA9QAAAAQwBFAEQA
UgBPAE0ALQBTAE4AaQAZIHMAIABEAEkAVABBAC0AYgBhAHMAZQBkACAAcAByAG8AagBlAGMAdAAg
AGMAcgBlAGEAdABpAG8AbgAAAKoPJgAAAAcAAAAGAAAACRAAAAUAAAAHAAAAAwAJEAAAHQAAAAYA
AAAJEAAAEACfDwQAAAAFAAAAAACoDx0AAABGcm9tIGFuYWx5c2lzIHRvIGRlbGl2ZXJhYmxlcwAA
qg8MAAAAHgAAAAYAAAAJEAAAAADzAxQAAAAEAAAAAAAAAAIAAAABAQAAAAAAAAAAnw8EAAAAAAAA
AAAAqA8wAAAAT3ZlcnZpZXcgb2YgdGhlIHByb2plY3QgZGVsaXZlcmFibGVzIGFuZCBjb250ZW50
AAChDxYAAAAxAAAAAAAACAAAAAAxAAAAAAACACgAAACqDwwAAAAxAAAABgAAAAkQAAAQAJ8PBAAA
AAEAAAAAAKoPDgAAAAEAAAAHAAAAAAAJEAAAAADzAxQAAAAFAAAAAAAAAAIAAAADAQAAAAAAAAAA
nw8EAAAAAAAAAAAAqA8KAAAASGlnaGxpZ2h0cwAAoQ8UAAAACwAAAAAAAAgAAAAACwAAAAAAAAAA
AKoPDAAAAAsAAAAGAAAACRAAABAAnw8EAAAAAQAAAAAAoA+4AwAAVABoAGUAcgBlACAAaQBzACAA
YQAgAGcAcgBlAGEAdAAgAG8AcABwAG8AcgB0AHUAbgBpAHQAeQAgAGYAbwByACAAcgBlAHUAcwBl
ACAAYQB0ACAAdABoAGUAIABmAHUAbgBjAHQAaQBvAG4AYQBsAGkAdAB5ACAAYQBuAGQAIAB0AGEA
cwBrACAAbABlAHYAZQBsAHMALgANACoAIABGAHUAbgBjAHQAaQBvAG4AYQBsAGkAdABpAGUAcwAg
AGEAcgBlACAAcAByAGUAcwBlAG4AdABlAGQAIABhAHMAIABjAG8AbgBjAGUAcAB0AHMAIABiAGUA
YwBhAHUAcwBlACAAdABoAGUAeQAgAGEAbgBzAHcAZQByACAAdABoAGUAIABxAHUAZQBzAHQAaQBv
AG4AcwAgABwgVwBoAGEAdAAgAGkAcwA/AB0gIABvAHIAIAAcIFcAaABhAHQAIABpAHMAIABpAHQA
IAB1AHMAZQBmAHUAbAAgAGYAbwByAD8AHSAuACAAVwBoAGEAdAAgAGkAcwAgAGEAIABzAGUAYQBy
AGMAaAA/ACAAVwBoAGEAdAAgAGkAcwAgAGEAIAB0AGgAZQBtAGUAIABhAG4AZAAgAHcAaAB5ACAA
dwBvAHUAbABkACAASQAgAHUAcwBlACAAbwBuAGUAPwANAFQAcgBhAGkAbgBpAG4AZwAgAGcAdQBp
AGQAZQBzACAAdgBhAHIAeQAgAGYAcgBvAG0AIABvAG4AZQAgAHQAcgBhAGkAbgBpAG4AZwAgAGMA
bABhAHMAcwAgAHQAbwAgAHQAaABlACAAbgBlAHgAdAA6ACAAdABoAGUAcgBlACAAaQBzACAAYQAg
AGcAcgBlAGEAdAAgAG4AZQBlAGQAIABmAG8AcgAgAGEAIABmAGwAZQB4AGkAYgBsAGUAIAB0AG8A
cABpAGMAIABvAHIAZwBhAG4AaQBzAGEAdABpAG8AbgAuAA0ATQB1AGwAdABpAHAAbABlACAAdQBz
AGUAcgAgAHQAeQBwAGUAcwAgAHcAaQB0AGgAIABkAGkAZgBmAGUAcgBlAG4AdAAgAGEAYwBjAGUA
cwBzACAAdABvACAAZgB1AG4AYwB0AGkAbwBuAGEAbABpAHQAaQBlAHMALAAgAG4AZQBlAGQAIABm
AG8AcgAgAGMAbwBuAGQAaQB0AGkAbwBuAGEAbAAgAHQAZQB4AHQAIABiAGEAcwBlAGQAIABvAG4A
IABhAHUAZABpAGUAbgBjAGUAcwAuAAAAoQ9CAAAATQAAAAAAABAAAFAAsQAAAAEAABAAAFAA3wAA
AAAAABAAAFAATQAAAAAAAgAcALEAAAAAAAIAGADfAAAAAAACABwAAACqDwwAAADdAQAABgAAAAkQ
AAAAAPMDFAAAAAYAAAAEAAAAAgAAAAIBAAAAAAAAAACfDwQAAAAAAAAAAACoDxwAAABPbmxpbmUg
SGVscCBEZWxpdmVyeSBQcm9jZXNzAAChDxQAAAAdAAAAAAAACAAAAAAdAAAAAAAAAAAAqg8MAAAA
HQAAAAYAAAAJEAAAEACfDwQAAAABAAAAAACoDwEAAAAgAAChDxQAAAACAAAAAAABAAAAAAACAAAA
AAAAAAAAqg8MAAAAAgAAAAYAAAAJEAAAAADzAxQAAAAHAAAAAAAAAAIAAAAFAQAAAAAAAAAAnw8E
AAAAAAAAAAAAqA8KAAAASGlnaGxpZ2h0cwAAoQ8UAAAACwAAAAAAAAgAAAAACwAAAAAAAAAAAKoP
DAAAAAsAAAAGAAAACRAAABAAnw8EAAAAAQAAAAAAqA+AAQAAVGhlIHByb2R1Y3Rpb24gYW5kIGRl
bGl2ZXJ5IG1vZGUgYXJlIHVzZWZ1bCB0byBwcmV2ZW50IHVzZXJzIGZyb20gd2FpdGluZyB0b28g
bG9uZyBmb3IgdG9waWMgZGlzcGxheS4gUHJlLXByb2Nlc3NlZCBlbGVtZW50cyBpbmNsdWRlOiAN
VGhlIHRhYmxlIG9mIGNvbnRlbnQNVGhlIGluZGV4DVRoZSByZWxhdGVkIGxpbmtzIA1UaGVyZSBp
cyBhbHNvIGEgbmVlZCB0byBzYXZlIG9ubHkgdGhlIHJlbGV2YW50IGZpbGVzIGluIHRoZSBkb2N1
bWVudCBiYXNlLCBzbyB0aGF0IG90aGVyIGZpbGVzIGFyZSBub3QgcmV0dXJuZWQgYnkgdGhlIHNl
YXJjaCBlbmdpbmUuIEl0cyBmYXN0ZXIgdGhhbiBjaGVja2luZyB0aGUgbWFwIGV2ZXJ5IHRpbWUg
Zm9yIHByb2plY3QgcmVsZXZhbmNlAAChD0IAAACHAAAAAAAAEAAAWgAyAAAAAQAAEAAAWgDIAAAA
AAAAEAAAWgCHAAAAAAACABwAMgAAAAAAAgAYAMgAAAAAAAIAHAAAAKoPJgAAAEoBAAAGAAAACRAA
AAQAAAAHAAAAAAAJEAAAMwAAAAYAAAAJEAAAAADzAxQAAAARAAAABAAAAAIAAAAGAQAAAAAAAAAA
nw8EAAAAAAAAAAAAqA8fAAAAUHJlLXByb2Nlc3NlZCBUYWJsZSBvZiBDb250ZW50IAAAoQ8UAAAA
IAAAAAAAAAgAAAAAIAAAAAAAAAAAAKoPDAAAACAAAAAGAAAACRAAABAAnw8EAAAAAQAAAAAAqg8O
AAAAAQAAAAcAAAAAAAkQAAAAAPMDFAAAABIAAAAEAAAAAgAAAAcBAAAAAAAAAACfDwQAAAAAAAAA
AACoDxMAAABQcmUtcHJvY2Vzc2VkIEluZGV4AAChDxQAAAAUAAAAAAAACAAAAAAUAAAAAAAAAAAA
qg8MAAAAFAAAAAYAAAAJEAAAEACfDwQAAAABAAAAAACqDwwAAAABAAAABgAAAAkQAAAAAPMDFAAA
ABMAAAAAAAAAAQAAAAgBAAAAAAAAAACfDwQAAAAAAAAAAACoD1gAAABQcmUtcHJvY2Vzc2VkIFJl
bGF0ZWQgTGlua3MLKkluY2x1ZGVkIGluIHRvcGljcywgdG8gYmUgbW92ZWQgaW4gbWFwcyB0byBh
ZGFwdCB0byBjb250ZXh0AAChDx4AAABZAAAAAAAACAAAAAAcAAAAAAAAAD0AAAAAAAIAEAAAAKoP
DAAAAFkAAAAGAAAACRAAAAAA8wMUAAAAFAAAAAAAAAABAAAACgEAAAAAAAAAAJ8PBAAAAAAAAAAA
AKgPRQAAAFNlYXJjaCB3aXRoIE9wdGlvbnMgYW5kIFJlc3VsdHMgYmFzZWQgb24gVG9waWMgVHlw
ZXMgKCp0YXNrIG9yIG90aGVyKQAAoQ8gAAAARgAAAAAAAAgAAAAANQAAAAAAAgAoABEAAAAAAAIA
EAAAAKoPDAAAAEYAAAAGAAAACRAAAAAA8wMUAAAAFwAAAAAAAAACAAAADAEAAAAAAAAAAJ8PBAAA
AAAAAAAAAKgPCgAAAEhpZ2hsaWdodHMAAKEPFAAAAAsAAAAAAAAIAAAAAAsAAAAAAAAAAACqDwwA
AAALAAAABgAAAAkQAAAQAJ8PBAAAAAEAAAAAAKgPYgEAAFRpdGxlcyBhbmQgdGhlIGNvbnRlbnQg
YXJlIGluZGV4ZWQgc2VwYXJhdGVseSBpbiBURVhUTUwgU2VydmVyIHRvIG9mZmVyIG1vcmUgcHJl
Y2lzZSBzZWFyY2ggY2FwYWJpbGl0aWVzIHRvIHVzZXJzLg1TeW5vbnltb3VzIGFyZSBpbmNsdWRl
ZCBpbiB0aGUgcHJvbG9nL2tleXdvcmQgZWxlbWVudC4gU28gd2hlbiBhIHVzZXJzIGRvIG5vdCBr
bm93IHRoZSBleGFjdCBleHByZXNzaW9uIHVzZWQgaW4gdGhlIHRleHQsIHRoZXkgY2FuIGZpbmQg
cmVsYXRlZCBpbmZvcm1hdGlvbi4gDVJlc3VsdHMgYXJlIHNlcGFyYXRlZCBpbnRvIGRlc2NyaXB0
aW9ucyAoY29uY2VwdHMsIHRvcGljcywgcmVmZXJlbmNlcykgYW5kIHRhc2tzLgAAoQ8UAAAAYwEA
AAAAABAAAFoAYwEAAAAAAAAAAKoPJgAAAJIAAAAGAAAACRAAAAYAAAAHAAAAAwAJEAAAywAAAAYA
AAAJEAAAAADzAxQAAAAIAAAABAAAAAIAAAAEAQAAAAAAAAAAnw8EAAAAAAAAAAAAqA8lAAAAQ3Jl
YXRpbmcgdGhlIFdlYiBTZXJ2aWNlcyBPbmxpbmUgSGVscAAAoQ8WAAAAJgAAAAAAAAgAAAAAJgAA
AAAAAgAoAAAAqg8MAAAAJgAAAAYAAAAJEAAAEACfDwQAAAABAAAAAACqDwwAAAABAAAABgAAAAkQ
AAAAAPMDFAAAABUAAAAAAAAAAgAAAAkBAAAAAAAAAACfDwQAAAAAAAAAAACoDwoAAABIaWdobGln
aHRzAAChDxQAAAALAAAAAAAACAAAAAALAAAAAAAAAAAAqg8MAAAACwAAAAYAAAAJEAAAEACfDwQA
AAABAAAAAACgDyYCAABEAG8AYwB1AG0AZQBuAHQAYQB0AGkAbwBuACAAZgBvAHIAIABXAGUAYgAg
AHMAZQByAHYAaQBjAGUAcwAgAG8AcABlAHIAYQB0AGkAbwBuAHMAIABpAHMAIABhACAAbQBpAHgA
ZQBkACAAbwBmACAAVwBTAEQATAAgAGkAbgBmAG8AcgBtAGEAdABpAG8AbgAgAGEAbgBkACAAYwBv
AGQAZQAgAGMAbwBtAG0AZQBuAHQAcwAuACAAVABoAGUAIABpAG4AZgBvAHIAbQBhAHQAaQBvAG4A
IABpAHMAIABtAGUAcgBnAGUAZAAgAHQAbwBnAGUAdABoAGUAcgAuACAARQBhAGMAaAAgAHMAZQBy
AHYAaQBjAGUAIABhAG4AZAAgAGUAYQBjAGgAIABtAGUAdABoAG8AZABzACAAYgBlAGMAbwBtAGUA
cwAgAGEAIABEAEkAVABBACAAcgBlAGYAZQByAGUAbgBjAGUAIAB0AG8AcABpAGMALgANACAAQQAg
ABwgcwB1AGIAbQBhAHAAHSAgAGYAbwByACAAYQBsAGwAIABXAGUAYgAgAFMAZQByAHYAaQBjAGUA
cwAgAGkAcwAgAGMAcgBlAGEAdABlAGQAIABhAG4AZAAgAHIAZQBmAGUAcgBlAG4AYwBlAGQAIABi
AHkAIAB0AGgAZQAgAGcAbABvAGIAYQBsACAAcAByAG8AagBlAGMAdAAgAG0AYQBwAC4AAAChDxQA
AAAUAQAAAAAAAAAAFAEAAAAAAgAcAAAAqg8mAAAAwgAAAAYAAAAJEAAABgAAAAcAAAADAAkQAABM
AAAABgAAAAkQAAAAAPMDFAAAABYAAAAAAAAAAQAAAAsBAAAAAAAAAACfDwQAAAAAAAAAAACoDxQA
AABXZWIgU2VydmljZXMgTWV0aG9kcwAAoQ8WAAAAFQAAAAAAAAgAAAAAFQAAAAAAAgAoAAAAqg8M
AAAAFQAAAAYAAAAJEAAAAADzAxQAAAAYAAAAAAAAAAEAAAANAQAAAAAAAAAAnw8EAAAAAAAAAAAA
qA8eAAAAQ3JlYXRpbmcgYSBQREYgVHJhaW5pbmcgTWFudWFsAAChDxQAAAAfAAAAAAAACAAAAAAf
AAAAAAAAAAAAqg8MAAAAHwAAAAYAAAAJEAAAAADzAxQAAAAZAAAAAAAAAAIAAAAOAQAAAAAAAAAA
nw8EAAAAAAAAAAAAqA8KAAAASGlnaGxpZ2h0cwAAoQ8UAAAACwAAAAAAAAgAAAAACwAAAAAAAAAA
AKoPDAAAAAsAAAAGAAAACRAAABAAnw8EAAAAAQAAAAAAoA/6AwAAVAByAGEAaQBuAGkAbgBnACAA
cwBlAHMAcwBpAG8AbgBzACAAYQByAGUAIABhAGwAbQBvAHMAdAAgAGEAbAB3AGEAeQBzACAAZABp
AGYAZgBlAHIAZQBuAHQAIABiAGUAYwBhAHUAcwBlACAAdABoAGUAIABuAGUAZQBkAHMAIAB2AGEA
cgB5ADoADQBOAGUAdwAgAHUAcwBlAHIAcwAgAHcAaABvACAAdwBhAG4AdAAgAHQAaABlACAAcABy
AG8AZAB1AGMAdAAgAGYAbwByACAAbQBlAGQAaQBhACAAbQBvAG4AaQB0AG8AcgBpAG4AZwANAE4A
ZQB3ACAAdQBzAGUAcgBzACAAdwBoAG8AIAB3AGEAbgB0ACAAdABvACAAcwBoAGEAcgBlACAAbgBl
AHcAcwAgAG8AbgAgAHQAaABlAGkAcgAgAGkAbgB0AHIAYQBuAGUAdAANAE4AZQB3ACAAHCBrAG4A
bwB3AGwAZQBkAGcAZQAgAG0AYQBuAGEAZwBlAG0AZQBuAHQAHSAgAHUAcwBlAHIAIAB3AGgAbwAg
AG4AZQBlAGQAcwAgAHQAbwAgAGwAZQBhAHIAbgAgAGgAbwB3ACAAdABvACAAYwByAGUAYQB0AGUA
IABhAGQAdgBhAG4AYwBlAGQAIABxAHUAZQByAGkAZQBzAA0AUgBlAGcAdQBsAGEAcgAgAHUAcwBl
AHIAcwAgAHcAaABvACAAdwBhAG4AdAAgAHQAbwAgAGwAZQBhAHIAbgAgAG4AZQB3ACAAZgB1AG4A
YwB0AGkAbwBuAGEAbABpAHQAaQBlAHMADQBSAGUAZwB1AGwAYQByACAAdQBzAGUAcgAgAHcAaABv
ACAAYQByAGUAIABnAG8AaQBuAGcAIAB0AG8AIAB1AHMAZQAgAHQAaABlACAAdABvAG8AbAAgAGYA
bwByACAAbgBlAHcAIABwAHUAcgBwAG8AcwBlAHMADQBDAG8AbQBwAHUAdABlAHIAIABsAGkAdABl
AHIAYQB0AGUAIAB1AHMAZQByAHMAIAB2AHMAIABuAG8AdAAtAHMAbwAtAGMAbwBtAHAAdQB0AGUA
cgAgAGwAaQB0AGUAcgBhAHQAZQAgAHUAcwBlAHIAcwAmIA0ARABvAGMAdQBtAGUAbgB0AHMAIABp
AG4AYwBsAHUAZABlACAAdABoAGUAIABzAGEAbQBlACAAawBpAG4AZAAgAG8AZgAgAHQAYQBiAGwA
ZQAgAG8AZgAgAGMAbwBuAHQAZQBuAHQAIABhAG4AZAAgAGkAbgBkAGUAeAAgAGEAcwAgAHQAaABl
ACAAbwBuAGwAaQBuAGUAIABoAGUAbABwAC4ADQAgAAAAoQ9QAAAARgAAAAAAABAAAFoAZAEAAAEA
ABAAAFoAUgAAAAAAABAAAFoAAgAAAAAAARAAAAAAWgBGAAAAAAACABgAZAEAAAAAAgAUAFQAAAAA
AAIAGAAAAKoPJgAAAIcBAAAGAAAACRAAAAIAAAAHAAAAAwAJEAAAdQAAAAYAAAAJEAAAAADzAxQA
AAAaAAAABAAAAAEAAAAPAQAAAAAAAAAAnw8EAAAAAAAAAAAAqA8sAAAARWxlbWVudHMgb2YgUERG
IERvY3VtZW50cyBiYXNlZCBvbiBESVRBIG1hcHMAAKEPFgAAAC0AAAAAAAAIAAAAAC0AAAAAAAIA
KAAAAKoPDAAAAC0AAAAGAAAACRAAAC8A8A+oAAAAAADzAxQAAAALAAAAAAAAAAAAAAAAAQAAAAAA
AAAA8wMUAAAADAAAAAAAAAAAAAAAAQEAAAAAAAAAAPMDFAAAAA0AAAAAAAAAAAAAAAIBAAAAAAAA
AADzAxQAAAAOAAAAAAAAAAAAAAADAQAAAAAAAAAA8wMUAAAADwAAAAAAAAAAAAAABAEAAAAAAAAA
APMDFAAAABAAAAAAAAAAAAAAAAUBAAAAAAAAAADqAwAAAAAPAO4DUw4AAAIA7wMYAAAAAQAAAA0O
AAAAAAAAAAAAgAQBAAAHABMADwAMBMABAAAPAALwuAEAAKAACPAIAAAAAwAAAAMoAAAPAAPwUAEA
AA8ABPAoAAAAAQAJ8BAAAAAAAAAAAAAAAAAAAAAAAAAAAgAK8AgAAAAAKAAABQAAAA8ABPByAAAA
EgAK8AgAAAACKAAAIAIAAFMAC/AeAAAAfwAAAAQAgADsCi0DvwEAAAEA/wEAAAEAAQMCBAAAAAAQ
8AgAAACtACABYBV9Aw8AEfAQAAAAAADDCwgAAAAAAAAADQAtAw8ADfAMAAAAAACeDwQAAAAAAAAA
DwAE8J4AAAASAArwCAAAAAMoAAAgAgAAUwAL8B4AAAB/AAAABACAAOgLLQO/AQAAAQD/AQAAAQAB
AwMEAAAAABDwCAAAAPADIAFgFRMPDwAR8DwAAAAPABQQJAAAAAEA8Q8cAAAAAAAABwAAAAAAAAAA
AAAAAAIAAQACAAAAAAAKMAAAwwsIAAAAAQAAAA4ALQMPAA3wDAAAAAAAng8EAAAAAQAAAA8ABPBI
AAAAEgAK8AgAAAABKAAAAAwAAIMAC/AwAAAAgQEAAAAIgwEFAAAIkwGOn4sAlAHevWgAvwESABIA
/wEAAAgABAMJAAAAPwMBAAEAEADwByAAAAD///8AAAAAAICAgAAAAAAAu+DjADMzmQAAmZkAmcwA
AA8AiBM7DAAADwCKEzMMAAAAALoPEAAAAF8AXwBfAFAAUABUADEAMAAAAIsTEwwAAAAA6i4EAAAA
AgAAAAAA6y4IAAAA9VrEAaArGg4AAAArBAAAAM9GlfEfAETxowsAAAAAJ/EgAAAAAAAAAAMAAAAA
AAAAAAAAAAAAAAAAphMA/////xIAAAAPAD3xDQAAAEABQvEFAAAAAQkAAAAfAETxXgsAAAAAJ/Eg
AAAAAAAAAAAAAAABAAAAAAAAAAAAAAAAAAAA/////xgAAAAPAD3xDQAAAEABQvEFAAAAAQQAAAAA
AEHxFAAAAAEAAAABAAAAAAAAAAAAAAADAAAAPwAl8SwAAAAAACjxEAAAAAEAAAAJAAAAAAAAAAAA
AAAPADzxDAAAAAAAASsEAAAAAQAAAE8AJfEsAAAAAAAo8RAAAAABAAAACgAAAAAAAAAAAAAADwA8
8QwAAAAAAAErBAAAAAEAAAAfAETxDAgAAAAAJ/EgAAAAAAAAAAAAAAAAAAAAAwAAAAAAAAAApBMA
AAAAAAEAAAAPAD3xAAAAAB8AJfEYAAAAAAAo8RAAAAAAAAAAAAAAAAAAAAD/////HwBE8bQHAAAA
ACfxIAAAAAAAAAAAAAAAAAAAAAMAAAAAAAAAAAAAAAAAAAABAAAADwA98QAAAAAfACXxGAAAAAAA
KPEQAAAAAAAAAAAAAAAAAAAAAAAAAB8ARPHRAQAAAAAn8SAAAAAAAAAAAAAAAAAAAAADAAAAAAAA
AAAAAAAAAAAAAQAAAA8APfFBAAAAkABC8QUAAAABAQAAAKAAQvEFAAAAAQAAAACwAELxBQAAAAEB
AAAAQAFC8QUAAAABAQAAADABQvEFAAAAAQAAAAAfACXxGAAAAAAAKPEQAAAAAAAAAAAAAAAAAAAA
AAAAAAAAKfEIAAAAAwAAAAAAAAAAACnxCAAAAAQAAAAAAAAAAAAp8QgAAAAFAAAAAAAAAAAAKfEI
AAAAAAAAAAAAgD8fAETx+AAAAAAAJ/EgAAAAAAAAAAAAAAADAAAAAwAAAAAAAAAAohMAAQAAABkA
AAAPAD3xAAAAAA8AMfGgAAAAAAA68QgAAAABAAAAAQAAABAAQvERAAAAA3YAaQBzAGkAYgBsAGUA
AAAPACrxbwAAAAAAM/EQAAAABAAAAAAAAAAAAAAAAAAAAB8APvErAAAAAABC8SMAAAADcwB0AHkA
bABlAC4AdgBpAHMAaQBiAGkAbABpAHQAeQAAAA8APPEcAAAAAAD7KhQAAAACAAAAAQAAAAMoAAAA
AAAAhwAAAB8AJfEYAAAAAAAo8RAAAAAAAAAAAAAAAAAAAAAAAAAAHwBE8dEBAAAAACfxIAAAAAAA
AAAAAAAAAAAAAAMAAAAAAAAAAAAAAAAAAAABAAAADwA98UEAAACQAELxBQAAAAEBAAAAoABC8QUA
AAABAAAAALAAQvEFAAAAAQEAAABAAULxBQAAAAECAAAAMAFC8QUAAAABAAAAAB8AJfEYAAAAAAAo
8RAAAAAAAAAAAAAAAAAAAAAAAAAAAAAp8QgAAAADAAAAAAAAAAAAKfEIAAAABAAAAAAAAAAAACnx
CAAAAAUAAAAAAAAAAAAp8QgAAAAAAAAAAACAPx8ARPH4AAAAAAAn8SAAAAAAAAAAAAAAAAMAAAAD
AAAAAAAAAACiEwABAAAAGQAAAA8APfEAAAAADwAx8aAAAAAAADrxCAAAAAEAAAABAAAAEABC8REA
AAADdgBpAHMAaQBiAGwAZQAAAA8AKvFvAAAAAAAz8RAAAAAEAAAAAAAAAAAAAAAAAAAAHwA+8SsA
AAAAAELxIwAAAANzAHQAeQBsAGUALgB2AGkAcwBpAGIAaQBsAGkAdAB5AAAADwA88RwAAAAAAPsq
FAAAAAIAAAABAAAAAygAAIcAAACcAAAAHwAl8RgAAAAAACjxEAAAAAAAAAAAAAAAAAAAAAAAAAAf
AETx0QEAAAAAJ/EgAAAAAAAAAAAAAAAAAAAAAwAAAAAAAAAAAAAAAAAAAAEAAAAPAD3xQQAAAJAA
QvEFAAAAAQEAAACgAELxBQAAAAEAAAAAsABC8QUAAAABAQAAAEABQvEFAAAAAQIAAAAwAULxBQAA
AAEAAAAAHwAl8RgAAAAAACjxEAAAAAAAAAAAAAAAAAAAAAAAAAAAACnxCAAAAAMAAAAAAAAAAAAp
8QgAAAAEAAAAAAAAAAAAKfEIAAAABQAAAAAAAAAAACnxCAAAAAAAAAAAAIA/HwBE8fgAAAAAACfx
IAAAAAAAAAAAAAAAAwAAAAMAAAAAAAAAAKITAAEAAAAZAAAADwA98QAAAAAPADHxoAAAAAAAOvEI
AAAAAQAAAAEAAAAQAELxEQAAAAN2AGkAcwBpAGIAbABlAAAADwAq8W8AAAAAADPxEAAAAAQAAAAA
AAAAAAAAAAAAAAAfAD7xKwAAAAAAQvEjAAAAA3MAdAB5AGwAZQAuAHYAaQBzAGkAYgBpAGwAaQB0
AHkAAAAPADzxHAAAAAAA+yoUAAAAAgAAAAEAAAADKAAAnAAAAKYAAAAfACXxGAAAAAAAKPEQAAAA
AAAAAAAAAAAAAAAAAAAAAB8ARPHRAQAAAAAn8SAAAAAAAAAAAAAAAAAAAAADAAAAAAAAAAAAAAAA
AAAAAQAAAA8APfFBAAAAkABC8QUAAAABAQAAAKAAQvEFAAAAAQAAAACwAELxBQAAAAEBAAAAQAFC
8QUAAAABAgAAADABQvEFAAAAAQAAAAAfACXxGAAAAAAAKPEQAAAAAAAAAAAAAAAAAAAAAAAAAAAA
KfEIAAAAAwAAAAAAAAAAACnxCAAAAAQAAAAAAAAAAAAp8QgAAAAFAAAAAAAAAAAAKfEIAAAAAAAA
AAAAgD8fAETx+AAAAAAAJ/EgAAAAAAAAAAAAAAADAAAAAwAAAAAAAAAAohMAAQAAABkAAAAPAD3x
AAAAAA8AMfGgAAAAAAA68QgAAAABAAAAAQAAABAAQvERAAAAA3YAaQBzAGkAYgBsAGUAAAAPACrx
bwAAAAAAM/EQAAAABAAAAAAAAAAAAAAAAAAAAB8APvErAAAAAABC8SMAAAADcwB0AHkAbABlAC4A
dgBpAHMAaQBiAGkAbABpAHQAeQAAAA8APPEcAAAAAAD7KhQAAAACAAAAAQAAAAMoAACmAAAAuQAA
AB8AJfEYAAAAAAAo8RAAAAAAAAAAAAAAAAAAAAAAAAAAHwBE8YECAAAAACfxIAAAAAAAAAAAAAAA
AAAAAAMAAAAAAAAAAKQTAAAAAAABAAAADwA98QAAAAAfACXxGAAAAAAAKPEQAAAAAAAAAAAAAAAA
AAAA/////x8ARPEpAgAAAAAn8SAAAAAAAAAAAAAAAAAAAAADAAAAAAAAAAAAAAAAAAAAAQAAAA8A
PfEAAAAAHwAl8RgAAAAAACjxEAAAAAAAAAAAAAAAAAAAAAAAAAAfAETx0QEAAAAAJ/EgAAAAAAAA
AAAAAAAAAAAAAwAAAAAAAAAAAAAAAAAAAAEAAAAPAD3xQQAAAJAAQvEFAAAAAQEAAACgAELxBQAA
AAEAAAAAsABC8QUAAAABAQAAAEABQvEFAAAAAQEAAAAwAULxBQAAAAEAAAAAHwAl8RgAAAAAACjx
EAAAAAAAAAAAAAAAAAAAAAAAAAAAACnxCAAAAAMAAAAAAAAAAAAp8QgAAAAEAAAAAAAAAAAAKfEI
AAAABQAAAAAAAAAAACnxCAAAAAAAAAAAAIA/HwBE8fgAAAAAACfxIAAAAAAAAAAAAAAAAwAAAAMA
AAAAAAAAAKITAAEAAAAZAAAADwA98QAAAAAPADHxoAAAAAAAOvEIAAAAAQAAAAEAAAAQAELxEQAA
AAN2AGkAcwBpAGIAbABlAAAADwAq8W8AAAAAADPxEAAAAAQAAAAAAAAAAAAAAAAAAAAfAD7xKwAA
AAAAQvEjAAAAA3MAdAB5AGwAZQAuAHYAaQBzAGkAYgBpAGwAaQB0AHkAAAAPADzxHAAAAAAA+yoU
AAAAAgAAAAEAAAADKAAAuQAAAIEBAAAfACXxGAAAAAAAKPEQAAAAAAAAAAAAAAAAAAAAAAAAAA8A
Ais4AAAADwAIKzAAAAAAAAMrEAAAAAEAAAAAAAAAAygAAAEADQMBAAkrEAAAAAEAAAABAAAAAAAA
AAAAAAAAAHIXEAAAAAEAEAB9wgAABwAQAJDiAAAAAPUPHAAAAAUBAABtEAADWcIAAOvwAAABAAAA
GgAAAAEA2gAPAOgDhB0AAAEA6QMoAAAAgBYAAOAQAADgEAAAgBYAAAUAAAAKAAAACQAAAAoAAAAB
AAAAAAAAAQ8A8gMWAQAALwDIDwwAAAAwANIPBAAAAAEAAAAPANUHTAAAAAAAtw9EAAAAQQByAGkA
YQBsAAAACAAAAAAAAAC8phMAvKYTAIB+lwA8pRMAJKUTAKHQBzAIAAAAAAAAADylEwA6QQkwNKUT
AAAABAAAAKQPCgAAAIAAQgAAAP//FAAAAKUPDAAAAAAAAAguAAAABwAAAAAAqQ8KAAAABwAAAQAA
AP7/////////////////////////////////////////////////////////////////////////
//////////////////////////////////////////////////////////////////////////8e
AAAAHwAAACAAAAAhAAAAIgAAACMAAAAkAAAAJQAAACYAAAAnAAAAKAAAACkAAAAqAAAAKwAAACwA
AAAtAAAA/v//////////////////////////////////////////////////////////////////
////////////////////////////////////////////////////////////////////////////
////////////////////////////////////////////////////////////////////////////
////////////////////////////////////////////////////////////////////////////
////////////////////////////////////////////////////////////////////////////
//////////////////////////////////////////////////////////////////////8AAPYP
JAAAABQAAABfwJHjmTICAAwA9AMDAJcARnJhbmNlIEJhcmlsCAAAAEYAcgBhAG4AYwBlACAAQgBh
AHIAaQBsAHAAAAAEAAAApAAAAAcAAAC8AAAACAAAANgAAAAJAAAA8AAAABIAAAD8AAAACgAAABwB
AAAMAAAAKAEAAA0AAAA0AQAADwAAAEABAAARAAAASAEAAAIAAADkBAAAHgAAACkAAABDRURST00t
U05pknMgRElUQS1iYXNlZCBwcm9qZWN0IGNyZWF0aW9uAGZ0IB4AAAANAAAARnJhbmNlIEJhcmls
AERJVB4AAAAUAAAASVhJQVNPRlRfTW9kZWxlMjAwNAAeAAAADQAAAEZyYW5jZSBCYXJpbABsZTIe
AAAAAwAAADIzAG4eAAAAFQAAAE1pY3Jvc29mdCBQb3dlclBvaW50AGVkIEAAAAAQYoecKAAAAEAA
AABw4kiH81rEAUAAAAAw2Cj8GF3EAQMAAABvAQAARwAAAKhTAAD/////AwAAAMAFAAD/////AwAA
AAgAiRBnDAAAAQAJAAAD2AIAAAUAMwAAAAAABAAAAAMBCAAFAAAACwIAAAAABQAAAAwC7wLpAwMA
AAAeAAcAAAD8AgAA////AAAABAAAAC0BAAAIAAAA+gIFAAAAAAD///8ABAAAAC0BAQAMAAAAQAkh
APAAAAAAAAAA7wLpA/////8IAAAA+gIAAAAAAAAAAAAABAAAAC0BAgAEAAAALQEAAAQAAAAnAf//
HAAAAPsCw/8AAAAAAACQAQAAAAAAQAAAQXJpYWwAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAE
AAAALQEDAAQAAAAuARgABAAAAAIBAQAFAAAACQIAAAACEAAAADIKKwFvAAYAAABDRURST00sACkA
LAAsAC8AMwAEAAAALgEAABwAAAD7AhAABwAAAAAAvAIAAAAAAQICIlN5c3RlbQAAAAAAABgAAAAs
ghMAAQAAAOQEAAAAAAAABAAAAC0BBAAEAAAA8AEDABwAAAD7AsP/AAAAAAAAkAEAAAAAAEAAAEFy
aWFsAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAABAAAAC0BAwAEAAAALgEYAAQAAAACAQEABQAA
AAkCAAAAAgkAAAAyCisBfgEBAAAALQAUAAQAAAAuAQAABAAAAC0BBAAEAAAA8AEDABwAAAD7AsP/
AAAAAAAAkAEAAAAAAEAAAEFyaWFsAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAABAAAAC0BAwAE
AAAALgEYAAQAAAACAQEABQAAAAkCAAAAAg8AAAAyCisBkgEFAAAAU05pknNNKQAsAA4ADgAfAAQA
AAAuAQAABAAAAC0BBAAEAAAA8AEDABwAAAD7AsP/AAAAAAAAkAEAAAAAAEAAAEFyaWFsAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAABAAAAC0BAwAEAAAALgEYAAQAAAACAQEABQAAAAkCAAAAAg0A
AAAyCisBMwIEAAAARElUQSwAEAAmACkABAAAAC4BAAAEAAAALQEEAAQAAADwAQMAHAAAAPsCw/8A
AAAAAACQAQAAAAAAQAAAQXJpYWwAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAEAAAALQEDAAQA
AAAuARgABAAAAAIBAQAFAAAACQIAAAACCQAAADIKKwG+AgEAAAAtABQABAAAAC4BAAAEAAAALQEE
AAQAAADwAQMAHAAAAPsCw/8AAAAAAACQAQAAAAAAQAAAQXJpYWwAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAEAAAALQEDAAQAAAAuARgABAAAAAIBAQAFAAAACQIAAAACEAAAADIKKwHSAgYAAABi
YXNlZCAiACIAHwAiACIAEQAEAAAALgEAAAQAAAAtAQQABAAAAPABAwAcAAAA+wLD/wAAAAAAAJAB
AAAAAABAAABBcmlhbAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAQAAAAtAQMABAAAAC4BGAAE
AAAAAgEBAAUAAAAJAgAAAAIfAAAAMgp1ASMBEAAAAHByb2plY3QgY3JlYXRpb24iABQAIgANACIA
HwARABEAHwAUACIAIgARAA4AIgAiAAQAAAAuAQAABAAAAC0BBAAEAAAA8AEDABwAAAD7AtT/AAAA
AAAAkAEAAAAAAEAAAEFyaWFsAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAABAAAAC0BAwAEAAAA
LgEYAAQAAAACAQEABQAAAAkCAAAAAjMAAAAyCtkB1QAdAAAARnJvbSBhbmFseXNpcyB0byBkZWxp
dmVyYWJsZXMAGwAPABgAJgAMABgAGQAYAAsAFQAWAAoAFwAMAA0AGAANABgAGAAKAAoAFwAYAA8A
GAAZAAoAGQAWAAQAAAAuAQAABAAAAC0BBAAEAP7/AAAFAQIAAAAAAAAAAAAAAAAAAAAAAAEAAAAC
1c3VnC4bEJOXCAArLPmuMAAAANwDAAAQAAAAAQAAAIgAAAADAAAAkAAAAA8AAACoAAAABAAAALwA
AAAGAAAAxAAAAAcAAADMAAAACAAAANQAAAAJAAAA3AAAAAoAAADkAAAAFwAAAOwAAAALAAAA9AAA
ABAAAAD8AAAAEwAAAAQBAAAWAAAADAEAAA0AAAAUAQAADAAAAHkDAAACAAAA5AQAAAAAAB8AJfEY
AAAAAAAo8RAAAAAAAAAAAAAAAAAAAAAAAAAAAAAp8QgAAAADAAAAAAAAAAAAKfEIAAAABAAAAAAA
AAAAACnxCAAAAAUAAAAAAAAAAAAp8QgAAAAAAAAAAACAPx8ARPH4AAAAAAAn8SAAAAAAAAAAAAAA
AAMAAAADAAAAAAAAAACiEwABAAAAGQAAAA8APfEAAAAADwAx8aAAAAAAADrxCAAAAAEAAAABAAAA
EABC8REAAAADdgBpAHMAaQBiAGwAZQAAAA8AKvFvAAAAAAAz8RAAAAAEAAAAAAAAAAAAAAAAAAAA
HwA+8SsAAAAAAELxIwAAAANzAHQAeQBsAGUALgB2AGkAcwBpAGIAaQBsAGkAdAB5AAAADwA88RwA
AAAAAPsqFAAAAAIAAAABAAAAA3wAAAAAAAC+AAAAHwAl8RgAAAAAACjxEAAAAAAAAAAAAAAAAAAA
AAAAAAAfAETxgQIAAAAAJ/EgAAAAAAAAAAAAAAAAAAAAAwAAAAAAAAAApBMAAAAAAAEAAAAPAD3x
AAAAAB8AJfEYAAAAAAAo8RAAAAAAAAAAAAAAAAAAAAD/////HwBE8SkCAAAAACfxIAAAAAAAAAAA
AAAAAAAAAAMAAAAAAAAAAAAAAAAAAAABAAAADwA98QAAAAAfACXxGAAAAAAAKPEQAAAAAAAAAAAA
AAAAAAAAAAAAAB8ARPHRAQAAAAAn8SAAAAAAAAAAAAAAAAAAAAADAAAAAAAAAAAAAAAAAAAAAQAA
AA8APfFBAAAAkABC8QUAAAABAQAAAKAAQvEFAAAAAQAAAACwAELxBQAAAAEBAAAAQAFC8QUAAAAB
AQAAADABQvEFAAAAAQAAAAAfACXxGAAAAAAAKPEQAAAAAAAAAAAAAAAAAAAAAAAAAAAAKfEIAAAA
AwAAAAAAAAAAACnxCAAAAAQAAAAAAAAAAAAp8QgAAAAFAAAAAAAAAAAAKfEIAAAAAAAAAAAAgD8f
AETx+AAAAAAAJ/EgAAAAAAAAAAAAAAADAAAAAwAAAAAAAAAAohMAAQAAABkAAAAPAD3xAAAAAA8A
MfGgAAAAAAA68QgAAAABAAAAAQAAABAAQvERAAAAA3YAaQBzAGkAYgBsAGUAAAAPACrxbwAAAAAA
M/EQAAAABAAAAAAAAAAAAAAAAAAAAB8APvErAAAAAABC8SMAAAADcwB0AHkAbABlAC4AdgBpAHMA
aQBiAGkAbABpAHQAeQAAAA8APPEcAAAAAAD7KhQAAAACAAAAAQAAAAN8AAC+AAAAFAEAAB8AJfEY
AAAAAAAo8RAAAAAAAAAAAAAAAAAAAAAAAAAADwACKzgAAAAPAAgrMAAAAAAAAysQAAAAAQAAAAAA
AAADfAAAAQAtAwEACSsQAAAAAQAAAAEAAAAAAAAAAAAAAAAAchcYAAAAAQAQACfxAAAFABAAsw4B
ABUAEABcGQEAAAD1DxwAAAAJAQAAbRAAAwPxAAAsIgEAAQAAABoAAAABAAEDDwDoA5wdAAABAOkD
KAAAAIAWAADgEAAA4BAAAIAWAAAFAAAACgAAAAkAAAAKAAAAAQAAAAAAAAEPAPIDFgEAAC8AyA8M
AAAAMADSDwQAAAABAAAADwDVB0wAAAAAALcPRAAAAEEAcgBpAGEAbAAAAAgAAAAAAAAAvKYTALym
EwCsdpcAPKUTACSlEwCh0AcwCAAAAAAAAAA8pRMAOkEJMDSlEwAAAAQAAACkDwoAAACAAEIAAAD/
/xQAAAClDwwAAAAAAAAILgAAAAcAAAAAAKkPCgAAAAcAAAACAAkEAABAAKMPbgAAAAUA//0/AAAA
IiAAAGQAAAAA/wAAZAAAAAAAAAAAAEACAAAAAAcAAAD//+8AAAAAAP///////xIAAAAAAQAAAAUA
ACABIAEAAAAAAAUAAEACQAIAAAAAAAUAAGADYAMAAAAAAAUAAIAEgAQAAAAADwALBAQEAAAPAADw
/AMAAAAABvCAAQAABLgAAC8AAABbAAAAGQAAAAEAAAAHAAAAAgAAAAQAAAADAAAAOgAAAAAAAAAG
AAAABQAAAAgAAAAAAAAABgAAAAcAAAAGAAAACAAAAAkAAAAAAAAABgAAAAoAAAAEAAAACwAAAAYA
AAAMAAAACAAAAA0AAAAEAAAADgAAAAQAAAAPAAAABAAAABAAAAAEAAAAEQAAAAQAAAASAAAABAAA
ABMAAAAHAAAAAAAAAAYAAAAVAAAABwAAAAAAAAAGAAAAFwAAAAkAAAAAAAAABgAAAAAAAAAGAAAA
AAAAAAYAAAAAAAAABgAAAAAAAAAGAAAAAAAAAAYAAAAAAAAABgAAAB8AAAAEAAAAIAAAAAcAAAAA
AAAABgAAACIAAAAHAAAAAAAAAAYAAAAkAAAABAAAACUAAAAGAAAAAAAAAAYAAAAnAAAABAAAACgA
AAAIAAAAAAAAAAYAAAAAAAAACAAAAAAAAAAEAAAAAAAAAAQAAAAAAAAABwAAAAAAAAAEAAAAzwAB
8BACAABiAAfwJAAAAAYGHpbxkT13cz09/q5G3VtWGv8AQTUAAAEAAAAAAAAAAAAAAFIAB/AkAAAA
BQWW5qDgLXeZlz8oD5Ia7+mb/wCrNAEAAQAAAEE1AAAAAAAAUgAH8CQAAAAFBbw6Ao1pc+wKIQHA
zQNCOzT/AH2uAAABAAAA7GkBAAAAAABSAAfwJAAAAAUFIDcoDQvAOrZ8j2cw4QgWD/8AY4QBAAEA
AABpGAIAAAAAAFIAB/AkAAAABQUKW3IjojZRGVyuIYCBDDL1/wCg6wAAAQAAAMycAwAAAAAAUgAH
8CQAAAAFBe0XTJzrGmL/MAFqqN4ZhJ7/ABIaAQABAAAAbIgEAAAAAABSAAfwJAAAAAUF7DAIU0bz
6YUlJ/zypFCM+v8AKE8AAAEAAAB+ogUAAAAAAFIAB/AkAAAABQW+SW3B2RPXp5tbBslNZGh3/wAu
awEAAQAAAKbxBQAAAAAAUgAH8CQAAAAFBXjg3HjKtv6cRml1dFBD9cv/AFkKAQABAAAA1FwHAAAA
AABiAAfwJAAAAAYGGGScbxztKTN+ontCLkqfQv8ASiIAAAEAAAAtZwgAAAAAAGIAB/AkAAAABgY2
pjAGJ5ZUtpNZ9sU9fT8I/wArKgAAAQAAAHeJCAAAAAAAYgAH8CQAAAAGBnKLnssYQL3X2qBUxXCo
KpX/ABNRAAABAAAAorMIAAAAAACDAAvwMAAAAIEBBAAACIMBAAAACIZBAAAAAL8BEAAQAMABAQAA
CMVBAAAAAP8BCAAIAAECAgAACBAAGvEEAAAA/wAAAEAAHvEQAAAA//////8AAAACAAAI9wAAEB8A
8A8cAAAAAADzAxQAAAACAAAAAAAAAAAAAAAAAACAAAAAAA8A0AdxAQAAHwAUBBwAAAAAABUEFAAA
AJso3QoAypo7rQeUxwDKmjsBAQAADwD6A2cAAAAAAP4DAwAAAAABAAAA/QM0AAAAQQAAAGQAAABB
AAAAZAAAAAgAAAAAAAAAVKUTADpBCTAAAAAAAAAAAKD////4/v//AQATAHAA+wMIAAAAAAAAAHAI
AABwAPsDCAAAAAEAAABACwAAHwATBDwAAAAAAP0DNAAAAGQAAABkAAAAZAAAAGQAAACApRMA6iQJ
MLymEwCEdpcAAAAAAAAAAAAAAAAAAAAAAAABEwAfAP8DFAAAAAIAAAQMAAAAAAAAAAAAAAACAAAA
DwCIE3YAAAAPAIoTMAAAAAAAug8QAAAAXwBfAF8AUABQAFQAMQAwAAAAixMQAAAAAAANBAgAAABw
tQAAcLUAAA8AihM2AAAAAAC6Dw4AAABfAF8AXwBQAFAAVAA5AAAAixMYAAAAAAB7FxAAAAAcpRMA
5AQAAAMAAwACD0EwPwDZDwwAAAAAANoPBAAAAA0AJQAPAPAP0RUAAAAA8wMUAAAAAwAAAAAAAAAC
AAAAAAEAAAAAAAAAAJ8PBAAAAAYAAAAAAKAPUAAAAEMARQBEAFIATwBNAC0AUwBOAGkAGSBzACAA
RABJAFQAQQAtAGIAYQBzAGUAZAAgAHAAcgBvAGoAZQBjAHQAIABjAHIAZQBhAHQAaQBvAG4AAACq
DyYAAAAHAAAABgAAAAkQAAAFAAAABwAAAAMACRAAAB0AAAAGAAAACRAAABAAnw8EAAAABQAAAAAA
qA8dAAAARnJvbSBhbmFseXNpcyB0byBkZWxpdmVyYWJsZXMAAKoPDAAAAB4AAAAGAAAACRAAAAAA
8wMUAAAABAAAAAAAAAACAAAAAQEAAAAAAAAAAJ8PBAAAAAAAAAAAAKgPMAAAAE92ZXJ2aWV3IG9m
IHRoZSBwcm9qZWN0IGRlbGl2ZXJhYmxlcyBhbmQgY29udGVudAAAoQ8WAAAAMQAAAAAAAAgAAAAA
MQAAAAAAAgAoAAAAqg8MAAAAMQAAAAYAAAAJEAAAEACfDwQAAAABAAAAAACqDw4AAAABAAAABwAA
AAAACRAAAAAA8wMUAAAABQAAAAAAAAACAAAAAwEAAAAAAAAAAJ8PBAAAAAAAAAAAAKgPCgAAAEhp
Z2hsaWdodHMAAKEPFAAAAAsAAAAAAAAIAAAAAAsAAAAAAAAAAACqDwwAAAALAAAABgAAAAkQAAAQ
AJ8PBAAAAAEAAAAAAKgPVwEAAFRoZXJlIGlzIGEgZ3JlYXQgb3Bwb3J0dW5pdHkgZm9yIHJldXNl
IGF0IHRoZSBmdW5jdGlvbmFsaXR5IGFuZCB0YXNrIGxldmVscy4NKiBGdW5jdGlvbmFsaXRpZXMg
YXJlIHByZXNlbnRlZCBhcyBjb25jZXB0cyBUcmFpbmluZyBndWlkZXMgdmFyeSBmcm9tIG9uZSB0
cmFpbmluZyBjbGFzcyB0byB0aGUgbmV4dDogdGhlcmUgaXMgYSBncmVhdCBuZWVkIGZvciBhIGZs
ZXhpYmxlIHRvcGljIG9yZ2FuaXNhdGlvbi4NTXVsdGlwbGUgdXNlciB0eXBlcyB3aXRoIGRpZmZl
cmVudCBhY2Nlc3MgdG8gZnVuY3Rpb25hbGl0aWVzLCBuZWVkIGZvciBjb25kaXRpb25hbCB0ZXh0
IGJhc2VkIG9uIGF1ZGllbmNlcy4AAKEPNgAAAE0AAAAAAAAAAACfAAAAAQAAAAAAbAAAAAAAAAAA
AE0AAAAAAAAAnwAAAAAAAABsAAAAAAAAAAAAqg8MAAAAWAEAAAYAAAAJEAAAAADzAxQAAAAGAAAA
BAAAAAIAAAACAQAAAAAAAAAAnw8EAAAAAAAAAAAAqA8cAAAAT25saW5lIEhlbHAgRGVsaXZlcnkg
UHJvY2VzcwAAoQ8UAAAAHQAAAAAAAAgAAAAAHQAAAAAAAAAAAKoPDAAAAB0AAAAGAAAACRAAABAA
nw8EAAAAAQAAAAAAqA8BAAAAIAAAoQ8UAAAAAgAAAAAAAQAAAAAAAgAAAAAAAAAAAKoPDAAAAAIA
AAAGAAAACRAAAAAA8wMUAAAABwAAAAAAAAACAAAABQEAAAAAAAAAAJ8PBAAAAAAAAAAAAKgPCgAA
AEhpZ2hsaWdodHMAAKEPFAAAAAsAAAAAAAAIAAAAAAsAAAAAAAAAAACqDwwAAAALAAAABgAAAAkQ
AAAQAJ8PBAAAAAEAAAAAAKgPgAEAAFRoZSBwcm9kdWN0aW9uIGFuZCBkZWxpdmVyeSBtb2RlIGFy
ZSB1c2VmdWwgdG8gcHJldmVudCB1c2VycyBmcm9tIHdhaXRpbmcgdG9vIGxvbmcgZm9yIHRvcGlj
IGRpc3BsYXkuIFByZS1wcm9jZXNzZWQgZWxlbWVudHMgaW5jbHVkZTogDVRoZSB0YWJsZSBvZiBj
b250ZW50DVRoZSBpbmRleA1UaGUgcmVsYXRlZCBsaW5rcyANVGhlcmUgaXMgYWxzbyBhIG5lZWQg
dG8gc2F2ZSBvbmx5IHRoZSByZWxldmFudCBmaWxlcyBpbiB0aGUgZG9jdW1lbnQgYmFzZSwgc28g
dGhhdCBvdGhlciBmaWxlcyBhcmUgbm90IHJldHVybmVkIGJ5IHRoZSBzZWFyY2ggZW5naW5lLiBJ
dHMgZmFzdGVyIHRoYW4gY2hlY2tpbmcgdGhlIG1hcCBldmVyeSB0aW1lIGZvciBwcm9qZWN0IHJl
bGV2YW5jZQAAoQ9CAAAAhwAAAAAAABAAAFoAMgAAAAEAABAAAFoAyAAAAAAAABAAAFoAhwAAAAAA
AgAcADIAAAAAAAIAGADIAAAAAAACABwAAACqDwwAAACBAQAABgAAAAkQAAAAAPMDFAAAABEAAAAE
AAAAAgAAAAYBAAAAAAAAAACfDwQAAAAAAAAAAACoDx8AAABQcmUtcHJvY2Vzc2VkIFRhYmxlIG9m
IENvbnRlbnQgAAChDxQAAAAgAAAAAAAACAAAAAAgAAAAAAAAAAAAqg8MAAAAIAAAAAYAAAAJEAAA
EACfDwQAAAABAAAAAACqDw4AAAABAAAABwAAAAAACRAAAAAA8wMUAAAAEgAAAAQAAAACAAAABwEA
AAAAAAAAAJ8PBAAAAAAAAAAAAKgPEwAAAFByZS1wcm9jZXNzZWQgSW5kZXgAAKEPFAAAABQAAAAA
AAAIAAAAABQAAAAAAAAAAACqDwwAAAAUAAAABgAAAAkQAAAQAJ8PBAAAAAEAAAAAAKoPDAAAAAEA
AAAGAAAACRAAAAAA8wMUAAAAEwAAAAAAAAABAAAACAEAAAAAAAAAAJ8PBAAAAAAAAAAAAKgPWAAA
AFByZS1wcm9jZXNzZWQgUmVsYXRlZCBMaW5rcwsqSW5jbHVkZWQgaW4gdG9waWNzLCB0byBiZSBt
b3ZlZCBpbiBtYXBzIHRvIGFkYXB0IHRvIGNvbnRleHQAAKEPHgAAAFkAAAAAAAAIAAAAABwAAAAA
AAAAPQAAAAAAAgAQAAAAqg8MAAAAWQAAAAYAAAAJEAAAAADzAxQAAAAUAAAAAAAAAAEAAAAKAQAA
AAAAAAAAnw8EAAAAAAAAAAAAqA9FAAAAU2VhcmNoIHdpdGggT3B0aW9ucyBhbmQgUmVzdWx0cyBi
YXNlZCBvbiBUb3BpYyBUeXBlcyAoKnRhc2sgb3Igb3RoZXIpAAChDyAAAABGAAAAAAAACAAAAAA1
AAAAAAACACgAEQAAAAAAAgAQAAAAqg8MAAAARgAAAAYAAAAJEAAAAADzAxQAAAAXAAAAAAAAAAIA
AAAMAQAAAAAAAAAAnw8EAAAAAAAAAAAAqA8KAAAASGlnaGxpZ2h0cwAAoQ8UAAAACwAAAAAAAAgA
AAAACwAAAAAAAAAAAKoPDAAAAAsAAAAGAAAACRAAABAAnw8EAAAAAQAAAAAAqA9iAQAAVGl0bGVz
IGFuZCB0aGUgY29udGVudCBhcmUgaW5kZXhlZCBzZXBhcmF0ZWx5IGluIFRFWFRNTCBTZXJ2ZXIg
dG8gb2ZmZXIgbW9yZSBwcmVjaXNlIHNlYXJjaCBjYXBhYmlsaXRpZXMgdG8gdXNlcnMuDVN5bm9u
eW1vdXMgYXJlIGluY2x1ZGVkIGluIHRoZSBwcm9sb2cva2V5d29yZCBlbGVtZW50LiBTbyB3aGVu
IGEgdXNlcnMgZG8gbm90IGtub3cgdGhlIGV4YWN0IGV4cHJlc3Npb24gdXNlZCBpbiB0aGUgdGV4
dCwgdGhleSBjYW4gZmluZCByZWxhdGVkIGluZm9ybWF0aW9uLiANUmVzdWx0cyBhcmUgc2VwYXJh
dGVkIGludG8gZGVzY3JpcHRpb25zIChjb25jZXB0cywgdG9waWNzLCByZWZlcmVuY2VzKSBhbmQg
dGFza3MuAAChDxQAAABjAQAAAAAAEAAAWgBjAQAAAAAAAAAAqg8mAAAAkgAAAAYAAAAJEAAABgAA
AAcAAAADAAkQAADLAAAABgAAAAkQAAAAAPMDFAAAAAgAAAAEAAAAAgAAAAQBAAAAAAAAAACfDwQA
AAAAAAAAAACoDyUAAABDcmVhdGluZyB0aGUgV2ViIFNlcnZpY2VzIE9ubGluZSBIZWxwAAChDxYA
AAAmAAAAAAAACAAAAAAmAAAAAAACACgAAACqDwwAAAAmAAAABgAAAAkQAAAQAJ8PBAAAAAEAAAAA
AKoPDAAAAAEAAAAGAAAACRAAAAAA8wMUAAAAFQAAAAAAAAACAAAACQEAAAAAAAAAAJ8PBAAAAAAA
AAAAAKgPCgAAAEhpZ2hsaWdodHMAAKEPFAAAAAsAAAAAAAAIAAAAAAsAAAAAAAAAAACqDwwAAAAL
AAAABgAAAAkQAAAQAJ8PBAAAAAEAAAAAAKAPJgIAAEQAbwBjAHUAbQBlAG4AdABhAHQAaQBvAG4A
IABmAG8AcgAgAFcAZQBiACAAcwBlAHIAdgBpAGMAZQBzACAAbwBwAGUAcgBhAHQAaQBvAG4AcwAg
AGkAcwAgAGEAIABtAGkAeABlAGQAIABvAGYAIABXAFMARABMACAAaQBuAGYAbwByAG0AYQB0AGkA
bwBuACAAYQBuAGQAIABjAG8AZABlACAAYwBvAG0AbQBlAG4AdABzAC4AIABUAGgAZQAgAGkAbgBm
AG8AcgBtAGEAdABpAG8AbgAgAGkAcwAgAG0AZQByAGcAZQBkACAAdABvAGcAZQB0AGgAZQByAC4A
IABFAGEAYwBoACAAcwBlAHIAdgBpAGMAZQAgAGEAbgBkACAAZQBhAGMAaAAgAG0AZQB0AGgAbwBk
AHMAIABiAGUAYwBvAG0AZQBzACAAYQAgAEQASQBUAEEAIAByAGUAZgBlAHIAZQBuAGMAZQAgAHQA
bwBwAGkAYwAuAA0AIABBACAAHCBzAHUAYgBtAGEAcAAdICAAZgBvAHIAIABhAGwAbAAgAFcAZQBi
ACAAUwBlAHIAdgBpAGMAZQBzACAAaQBzACAAYwByAGUAYQB0AGUAZAAgAGEAbgBkACAAcgBlAGYA
ZQByAGUAbgBjAGUAZAAgAGIAeQAgAHQAaABlACAAZwBsAG8AYgBhAGwAIABwAHIAbwBqAGUAYwB0
ACAAbQBhAHAALgAAAKEPFAAAABQBAAAAAAAAAAAUAQAAAAACABwAAACqDyYAAADCAAAABgAAAAkQ
AAAGAAAABwAAAAMACRAAAEwAAAAGAAAACRAAAAAA8wMUAAAAFgAAAAAAAAABAAAACwEAAAAAAAAA
AJ8PBAAAAAAAAAAAAKgPFAAAAFdlYiBTZXJ2aWNlcyBNZXRob2RzAAChDxYAAAAVAAAAAAAACAAA
AAAVAAAAAAACACgAAACqDwwAAAAVAAAABgAAAAkQAAAAAPMDFAAAABgAAAAAAAAAAQAAAA0BAAAA
AAAAAACfDwQAAAAAAAAAAACoDx4AAABDcmVhdGluZyBhIFBERiBUcmFpbmluZyBNYW51YWwAAKEP
FAAAAB8AAAAAAAAIAAAAAB8AAAAAAAAAAACqDwwAAAAfAAAABgAAAAkQAAAAAPMDFAAAABkAAAAA
AAAAAgAAAA4BAAAAAAAAAACfDwQAAAAAAAAAAACoDwoAAABIaWdobGlnaHRzAAChDxQAAAALAAAA
AAAACAAAAAALAAAAAAAAAAAAqg8MAAAACwAAAAYAAAAJEAAAEACfDwQAAAABAAAAAACgD/oDAABU
AHIAYQBpAG4AaQBuAGcAIABzAGUAcwBzAGkAbwBuAHMAIABhAHIAZQAgAGEAbABtAG8AcwB0ACAA
YQBsAHcAYQB5AHMAIABkAGkAZgBmAGUAcgBlAG4AdAAgAGIAZQBjAGEAdQBzAGUAIAB0AGgAZQAg
AG4AZQBlAGQAcwAgAHYAYQByAHkAOgANAE4AZQB3ACAAdQBzAGUAcgBzACAAdwBoAG8AIAB3AGEA
bgB0ACAAdABoAGUAIABwAHIAbwBkAHUAYwB0ACAAZgBvAHIAIABtAGUAZABpAGEAIABtAG8AbgBp
AHQAbwByAGkAbgBnAA0ATgBlAHcAIAB1AHMAZQByAHMAIAB3AGgAbwAgAHcAYQBuAHQAIAB0AG8A
IABzAGgAYQByAGUAIABuAGUAdwBzACAAbwBuACAAdABoAGUAaQByACAAaQBuAHQAcgBhAG4AZQB0
AA0ATgBlAHcAIAAcIGsAbgBvAHcAbABlAGQAZwBlACAAbQBhAG4AYQBnAGUAbQBlAG4AdAAdICAA
dQBzAGUAcgAgAHcAaABvACAAbgBlAGUAZABzACAAdABvACAAbABlAGEAcgBuACAAaABvAHcAIAB0
AG8AIABjAHIAZQBhAHQAZQAgAGEAZAB2AGEAbgBjAGUAZAAgAHEAdQBlAHIAaQBlAHMADQBSAGUA
ZwB1AGwAYQByACAAdQBzAGUAcgBzACAAdwBoAG8AIAB3AGEAbgB0ACAAdABvACAAbABlAGEAcgBu
ACAAbgBlAHcAIABmAHUAbgBjAHQAaQBvAG4AYQBsAGkAdABpAGUAcwANAFIAZQBnAHUAbABhAHIA
IAB1AHMAZQByACAAdwBoAG8AIABhAHIAZQAgAGcAbwBpAG4AZwAgAHQAbwAgAHUAcwBlACAAdABo
AGUAIAB0AG8AbwBsACAAZgBvAHIAIABuAGUAdwAgAHAAdQByAHAAbwBzAGUAcwANAEMAbwBtAHAA
dQB0AGUAcgAgAGwAaQB0AGUAcgBhAHQAZQAgAHUAcwBlAHIAcwAgAHYAcwAgAG4AbwB0AC0AcwBv
AC0AYwBvAG0AcAB1AHQAZQByACAAbABpAHQAZQByAGEAdABlACAAdQBzAGUAcgBzACYgDQBEAG8A
YwB1AG0AZQBuAHQAcwAgAGkAbgBjAGwAdQBkAGUAIAB0AGgAZQAgAHMAYQBtAGUAIABrAGkAbgBk
ACAAbwBmACAAdABhAGIAbABlACAAbwBmACAAYwBvAG4AdABlAG4AdAAgAGEAbgBkACAAaQBuAGQA
ZQB4ACAAYQBzACAAdABoAGUAIABvAG4AbABpAG4AZQAgAGgAZQBsAHAALgANACAAAAChD1AAAABG
AAAAAAAAEAAAWgBkAQAAAQAAEAAAWgBSAAAAAAAAEAAAWgACAAAAAAABEAAAAABaAEYAAAAAAAIA
GABkAQAAAAACABQAVAAAAAAAAgAYAAAAqg8mAAAAhwEAAAYAAAAJEAAAAgAAAAcAAAADAAkQAAB1
AAAABgAAAAkQAAAAAPMDFAAAABoAAAAEAAAAAQAAAA8BAAAAAAAAAACfDwQAAAAAAAAAAACoDywA
AABFbGVtZW50cyBvZiBQREYgRG9jdW1lbnRzIGJhc2VkIG9uIERJVEEgbWFwcwAAoQ8WAAAALQAA
AAAAAAgAAAAALQAAAAAAAgAoAAAAqg8MAAAALQAAAAYAAAAJEAAALwDwD6gAAAAAAPMDFAAAAAsA
AAAAAAAAAAAAAAABAAAAAAAAAADzAxQAAAAMAAAAAAAAAAAAAAABAQAAAAAAAAAA8wMUAAAADQAA
AAAAAAAAAAAAAgEAAAAAAAAAAPMDFAAAAA4AAAAAAAAAAAAAAAMBAAAAAAAAAADzAxQAAAAPAAAA
AAAAAAAAAAAEAQAAAAAAAAAA8wMUAAAAEAAAAAAAAAAAAAAABQEAAAAAAAAAAOoDAAAAAAAAchcI
AAAAAQAQAHAiAQAAAPUPHAAAAAcBAABtEAADTCIBABRAAQABAAAAGgAAAAEAHQMPAOgDhB0AAAEA
6QMoAAAAgBYAAOAQAADgEAAAgBYAAAUAAAAKAAAACQAAAAoAAAABAAAAAAAAAQ8A8gMWAQAALwDI
DwwAAAAwANIPBAAAAAEAAAAPANUHTAAAAAAAtw9EAAAAQQByAGkAYQBsAAAACAAAAAAAAAC8phMA
vKYTAKx2lwA8pRMAJKUTAKHQBzAIAAAAAAAAADylEwA6QQkwNKUTAAAABAAAAKQPCgAAAIAAQgAA
AP//FAAAAKUPDAAAAAAAAAguAAAABwAAAAAAqQ8KAAAABwAAAAIACQQAAEAAow9uAAAABQD//T8A
AAAiIAAAZAAAAAD/AABkAAAAAAAAAAAAQAIAAAAABwAAAP//7wAAAAAA////////EgAAAAABAAAA
BQAAIAEgAQAAAAAABQAAQAJAAgAAAAAABQAAYANgAwAAAAAABQAAgASABAAAAAAPAAsEDAQAAA8A
APAEBAAAAAAG8IgBAAAGvAAAMAAAAFoAAAAZAAAAAQAAAAcAAAACAAAABAAAAAMAAAA6AAAAAAAA
AAYAAAAFAAAACAAAAAAAAAAGAAAABwAAAAYAAAAIALcPRAAAAFcAaQBuAGcAZABpAG4AZwBzAAAA
UgBvAG0AYQBuAAAAPKUTACSlEwCh0AcwCAAAAAAAAAA8pRMAOkEJMDSlEwACAAYCAACkDw4AAACA
AEYAAAD//xgAgICA/gAApQ8SAAAAAAAwCC4AAQAAAAAAAgAHAAAAAACpDwoAAAAHAAAAAgAJBAAA
QACjD24AAAAFAP/9PwAAACIgAABkAAAAAP8AAGQAAAAAAAAAAABAAgAAAAAHAAAA///vAAAAAAD/
//////8SAAAAAAEAAAAFAAAgASABAAAAAAAFAABAAkACAAAAAAAFAABgA2ADAAAAAAAFAACABIAE
AAAAAA8ACwS6DAAADwAA8LIMAAAAAAbw0AEAAATgAAA5AAAAXAAAABoAAAAAAAAABwAAAAIAAAAF
AAAAAwAAADoAAAAAAAAABgAAAAUAAAAIAAAAAAAAAAYAAAAHAAAABgAAAAgAAAAJAAAAAAAAAAYA
AAAKAAAABAAAAAsAAAAGAAAADAAAAAgAAAANAAAABAAAAA4AAAAEAAAADwAAAAQAAAAQAAAABAAA
ABEAAAAEAAAAEgAAAAQAAAATAAAABwAAAAAAAAAGAAAAFQAAAAkAAAAAAAAABgAAABcAAAAJAAAA
AAAAAAYAAAAAAAAABgAAAAAAAAAGAAAAAAAAAAYAAAAJAAAAAAAAAAYAAAAKAAAABAAAAAsAAAAG
AAAADAAAAAgAAAANAAAABAAAAA4AAAAEAAAADwAAAAQAAAAQAAAABAAAABEAAAAEAAAAEgAAAAQA
AAATAAAABwAAAAAAAAAGAAAAFQAAAAkAAAAAAAAABgAAABcAAAAJAAAAAAAAAAYAAAAAAAAABgAA
AAAAAAAGAAAAAAAAAAYAAAAAAAAABgAAAAAAAAAGAAAAAAAAAAYAAAAfAAAABAAAACAAAAAHAAAA
AAAAAAYAAAAiAAAABwAAAAAAAAAGAAAAJAAAAAQAAAAlAAAABgAAAAAAAAAGAAAAJwAAAAQAAAAo
AAAACAAAAAAAAAAGAAAAAAAAAAgAAAAAAAAABAAAAAAAAAAEAAAAAAAAAAcAAAAAAAAABAAAAAAA
AAAGAAAAzwAB8BACAABiAAfwJAAAAAYGHpbxkT13cz09/q5G3VtWGv8AQTUAAAEAAAAAAAAAAAAA
AFIAB/AkAAAABQWW5qDgLXeZlz8oD5Ia7+mb/wCrNAEAAQAAAEE1AAAAAAAAUgAH8CQAAAAFBbw6
Ao1pc+wKIQHAzQNCOzT/AH2uAAABAAAA7GkBAAAAAABSAAfwJAAAAAUFIDcoDQvAOrZ8j2cw4QgW
D/8AY4QBAAEAAABpGAIAAAAAAFIAB/AkAAAABQUKW3IjojZRGVyuIYCBDDL1/wCg6wAAAQAAAMyc
AwAAAAAAUgAH8CQAAAAFBe0XTJzrGmL/MAFqqN4ZhJ7/ABIaAQABAAAAbIgEAAAAAABSAAfwJAAA
AAUF7DAIU0bz6YUlJ/zypFCM+v8AKE8AAAEAAAB+ogUAAAAAAFIAB/AkAAAABQW+SW3B2RPXp5tb
BslNZGh3/wAuawEAAQAAAKbxBQAAAAAAUgAH8CQAAAAFBXjg3HjKtv6cRml1dFBD9cv/AFkKAQAB
AAAA1FwHAAAAAABiAAfwJAAAAAYGGGScbxztKTN+ontCLkqfQv8ASiIAAAEAAAAtZwgAAAAAAGIA
B/AkAAAABgY2pjAGJ5ZUtpNZ9sU9fT8I/wArKgAAAQAAAHeJCAAAAAAAYgAH8CQAAAAGBnKLnssY
QL3X2qBUxXCoKpX/ABNRAAABAAAAorMIAAAAAACDAAvwMAAAAIEBBAAACIMBAAAACIZBAAAAAL8B
EAAQAMABAQAACMVBAAAAAP8BCAAIAAECAgAACBAAGvEEAAAA/wAAAEAAHvEQAAAA//////8AAAAC
AAAI9wAAEB8A8A8cAAAAAADzAxQAAAACAAAAAAAAAAAAAAAAAACAAAAAAA8A0AdxAQAAHwAUBBwA
AAAAABUEFAAAAJso3QoAypo7rQeUxwDKmjsBAQAADwD6A2cAAAAAAP4DAwAAAAABAAAA/QM0AAAA
QQAAAGQAAABBAAAAZAAAAAgAAAAAAAAAVKUTADpBCTAAAAAAAAAAAKD////4/v//AQATAHAA+wMI
AAAAAAAAAHAIAABwAPsDCAAAAAEAAABACwAAHwATBDwAAAAAAP0DNAAAAGQAAABkAAAAZAAAAGQA
AACApRMA6iQJMLymEwCEdpcAAAAAAAAAAAAAAAAAAAAAAAABEwAfAP8DFAAAAAIAAAQMAAAAAAAA
AAAAAAACAAAADwCIE3YAAAAPAIoTMAAAAAAAug8QAAAAXwBfAF8AUABQAFQAMQAwAAAAixMQAAAA
AAANBAgAAABwtQAAcLUAAA8AihM2AAAAAAC6Dw4AAABfAF8AXwBQAFAAVAA5AAAAixMYAAAAAAB7
FxAAAAAcpRMA5AQAAAMAAwACD0EwPwDZDwwAAAAAANoPBAAAAA0AJQAPAPAPsRUAAAAA8wMUAAAA
AwAAAAAAAAACAAAAAAEAAAAAAAAAAJ8PBAAAAAYAAAAAAKAPUAAAAEMARQBEAFIATwBNAC0AUwBO
AGkAGSBzACAARABJAFQAQQAtAGIAYQBzAGUAZAAgAHAAcgBvAGoAZQBjAHQAIABjAHIAZQBhAHQA
aQBvAG4AAACqDyYAAAAHAAAABgAAAAkQAAAFAAAABwAAAAMACRAAAB0AAAAGAAAACRAAABAAnw8E
AAAABQAAAAAAqA8dAAAARnJvbSBhbmFseXNpcyB0byBkZWxpdmVyYWJsZXMAAKoPDAAAAB4AAAAG
AAAACRAAAAAA8wMUAAAABAAAAAAAAAACAAAAAQEAAAAAAAAAAJ8PBAAAAAAAAAAAAKgPMAAAAE92
ZXJ2aWV3IG9mIHRoZSBwcm9qZWN0IGRlbGl2ZXJhYmxlcyBhbmQgY29udGVudAAAoQ8WAAAAMQAA
AAAAAAgAAAAAMQAAAAAAAgAoAAAAqg8MAAAAMQAAAAYAAAAJEAAAEACfDwQAAAABAAAAAACqDw4A
AAABAAAABwAAAAAACRAAAAAA8wMUAAAABQAAAAAAAAACAAAAAwEAAAAAAAAAAJ8PBAAAAAAAAAAA
AKgPCgAAAEhpZ2hsaWdodHMAAKEPFAAAAAsAAAAAAAAIAAAAAAsAAAAAAAAAAACqDwwAAAALAAAA
BgAAAAkQAAAQAJ8PBAAAAAEAAAAAAKgPVwEAAFRoZXJlIGlzIGEgZ3JlYXQgb3Bwb3J0dW5pdHkg
Zm9yIHJldXNlIGF0IHRoZSBmdW5jdGlvbmFsaXR5IGFuZCB0YXNrIGxldmVscy4NKiBGdW5jdGlv
bmFsaXRpZXMgYXJlIHByZXNlbnRlZCBhcyBjb25jZXB0cyBUcmFpbmluZyBndWlkZXMgdmFyeSBm
cm9tIG9uZSB0cmFpbmluZyBjbGFzcyB0byB0aGUgbmV4dDogdGhlcmUgaXMgYSBncmVhdCBuZWVk
IGZvciBhIGZsZXhpYmxlIHRvcGljIG9yZ2FuaXNhdGlvbi4NTXVsdGlwbGUgdXNlciB0eXBlcyB3
aXRoIGRpZmZlcmVudCBhY2Nlc3MgdG8gZnVuY3Rpb25hbGl0aWVzLCBuZWVkIGZvciBjb25kaXRp
b25hbCB0ZXh0IGJhc2VkIG9uIGF1ZGllbmNlcy4AAKEPNgAAAE0AAAAAAAAAAACfAAAAAQAAAAAA
bAAAAAAAAAAAAE0AAAAAAAAAnwAAAAAAAABsAAAAAAAAAAAAqg8MAAAAWAEAAAYAAAAJEAAAAADz
AxQAAAAGAAAABAAAAAIAAAACAQAAAAAAAAAAnw8EAAAAAAAAAAAAqA8cAAAAT25saW5lIEhlbHAg
RGVsaXZlcnkgUHJvY2VzcwAAoQ8UAAAAHQAAAAAAAAgAAAAAHQAAAAAAAAAAAKoPDAAAAB0AAAAG
AAAACRAAABAAnw8EAAAAAQAAAAAAqA8BAAAAIAAAoQ8UAAAAAgAAAAAAAQAAAAAAAgAAAAAAAAAA
AKoPDAAAAAIAAAAGAAAACRAAAAAA8wMUAAAABwAAAAAAAAACAAAABQEAAAAAAAAAAJ8PBAAAAAAA
AAAAAKgPCgAAAEhpZ2hsaWdodHMAAKEPFAAAAAsAAAAAAAAIAAAAAAsAAAAAAAAAAACqDwwAAAAL
AAAABgAAAAkQAAAQAJ8PBAAAAAEAAAAAAKgPgAEAAFRoZSBwcm9kdWN0aW9uIGFuZCBkZWxpdmVy
eSBtb2RlIGFyZSB1c2VmdWwgdG8gcHJldmVudCB1c2VycyBmcm9tIHdhaXRpbmcgdG9vIGxvbmcg
Zm9yIHRvcGljIGRpc3BsYXkuIFByZS1wcm9jZXNzZWQgZWxlbWVudHMgaW5jbHVkZTogDVRoZSB0
YWJsZSBvZiBjb250ZW50DVRoZSBpbmRleA1UaGUgcmVsYXRlZCBsaW5rcyANVGhlcmUgaXMgYWxz
byBhIG5lZWQgdG8gc2F2ZSBvbmx5IHRoZSByZWxldmFudCBmaWxlcyBpbiB0aGUgZG9jdW1lbnQg
YmFzZSwgc28gdGhhdCBvdGhlciBmaWxlcyBhcmUgbm90IHJldHVybmVkIGJ5IHRoZSBzZWFyY2gg
ZW5naW5lLiBJdHMgZmFzdGVyIHRoYW4gY2hlY2tpbmcgdGhlIG1hcCBldmVyeSB0aW1lIGZvciBw
cm9qZWN0IHJlbGV2YW5jZQAAoQ9CAAAAhwAAAAAAABAAAFoAMgAAAAEAABAAAFoAyAAAAAAAABAA
AFoAhwAAAAAAAgAcADIAAAAAAAIAGADIAAAAAAACABwAAACqDwwAAACBAQAABgAAAAkQAAAAAPMD
FAAAABEAAAAEAAAAAgAAAAYBAAAAAAAAAACfDwQAAAAAAAAAAACoDx8AAABQcmUtcHJvY2Vzc2Vk
IFRhYmxlIG9mIENvbnRlbnQgAAChDxQAAAAgAAAAAAAACAAAAAAgAAAAAAAAAAAAqg8MAAAAIAAA
AAYAAAAJEAAAEACfDwQAAAABAAAAAACqDw4AAAABAAAABwAAAAAACRAAAAAA8wMUAAAAEgAAAAAA
AAABAAAABwEAAAAAAAAAAJ8PBAAAAAAAAAAAAKgPEwAAAFByZS1wcm9jZXNzZWQgSW5kZXgAAKEP
FAAAABQAAAAAAAAIAAAAABQAAAAAAAAAAACqDwwAAAAUAAAABgAAAAkQAAAAAPMDFAAAABMAAAAA
AAAAAQAAAAgBAAAAAAAAAACfDwQAAAAAAAAAAACoD1gAAABQcmUtcHJvY2Vzc2VkIFJlbGF0ZWQg
TGlua3MLKkluY2x1ZGVkIGluIHRvcGljcywgdG8gYmUgbW92ZWQgaW4gbWFwcyB0byBhZGFwdCB0
byBjb250ZXh0AAChDx4AAABZAAAAAAAACAAAAAAcAAAAAAAAAD0AAAAAAAIAEAAAAKoPDAAAAFkA
AAAGAAAACRAAAAAA8wMUAAAAFAAAAAAAAAABAAAACgEAAAAAAAAAAJ8PBAAAAAAAAAAAAKgPRQAA
AFNlYXJjaCB3aXRoIE9wdGlvbnMgYW5kIFJlc3VsdHMgYmFzZWQgb24gVG9waWMgVHlwZXMgKCp0
YXNrIG9yIG90aGVyKQAAoQ8gAAAARgAAAAAAAAgAAAAANQAAAAAAAgAoABEAAAAAAAIAEAAAAKoP
DAAAAEYAAAAGAAAACRAAAAAA8wMUAAAAFwAAAAAAAAACAAAADAEAAAAAAAAAAJ8PBAAAAAAAAAAA
AKgPCgAAAEhpZ2hsaWdodHMAAKEPFAAAAAsAAAAAAAAIAAAAAAsAAAAAAAAAAACqDwwAAAALAAAA
BgAAAAkQAAAQAJ8PBAAAAAEAAAAAAKgPYgEAAFRpdGxlcyBhbmQgdGhlIGNvbnRlbnQgYXJlIGlu
ZGV4ZWQgc2VwYXJhdGVseSBpbiBURVhUTUwgU2VydmVyIHRvIG9mZmVyIG1vcmUgcHJlY2lzZSBz
ZWFyY2ggY2FwYWJpbGl0aWVzIHRvIHVzZXJzLg1TeW5vbnltb3VzIGFyZSBpbmNsdWRlZCBpbiB0
aGUgcHJvbG9nL2tleXdvcmQgZWxlbWVudC4gU28gd2hlbiBhIHVzZXJzIGRvIG5vdCBrbm93IHRo
ZSBleGFjdCBleHByZXNzaW9uIHVzZWQgaW4gdGhlIHRleHQsIHRoZXkgY2FuIGZpbmQgcmVsYXRl
ZCBpbmZvcm1hdGlvbi4gDVJlc3VsdHMgYXJlIHNlcGFyYXRlZCBpbnRvIGRlc2NyaXB0aW9ucyAo
Y29uY2VwdHMsIHRvcGljcywgcmVmZXJlbmNlcykgYW5kIHRhc2tzLgAAoQ8UAAAAYwEAAAAAABAA
AFoAYwEAAAAAAAAAAKoPJgAAAJIAAAAGAAAACRAAAAYAAAAHAAAAAwAJEAAAywAAAAYAAAAJEAAA
AADzAxQAAAAIAAAABAAAAAIAAAAEAQAAAAAAAAAAnw8EAAAAAAAAAAAAqA8lAAAAQ3JlYXRpbmcg
dGhlIFdlYiBTZXJ2aWNlcyBPbmxpbmUgSGVscAAAoQ8WAAAAJgAAAAAAAAgAAAAAJgAAAAAAAgAo
AAAAqg8MAAAAJgAAAAYAAAAJEAAAEACfDwQAAAABAAAAAACqDwwAAAABAAAABgAAAAkQAAAAAPMD
FAAAABUAAAAAAAAAAgAAAAkBAAAAAAAAAACfDwQAAAAAAAAAAACoDwoAAABIaWdobGlnaHRzAACh
DxQAAAALAAAAAAAACAAAAAALAAAAAAAAAAAAqg8MAAAACwAAAAYAAAAJEAAAEACfDwQAAAABAAAA
AACgDyYCAABEAG8AYwB1AG0AZQBuAHQAYQB0AGkAbwBuACAAZgBvAHIAIABXAGUAYgAgAHMAZQBy
AHYAaQBjAGUAcwAgAG8AcABlAHIAYQB0AGkAbwBuAHMAIABpAHMAIABhACAAbQBpAHgAZQBkACAA
bwBmACAAVwBTAEQATAAgAGkAbgBmAG8AcgBtAGEAdABpAG8AbgAgAGEAbgBkACAAYwBvAGQAZQAg
AGMAbwBtAG0AZQBuAHQAcwAuACAAVABoAGUAIABpAG4AZgBvAHIAbQBhAHQAaQBvAG4AIABpAHMA
IABtAGUAcgBnAGUAZAAgAHQAbwBnAGUAdABoAGUAcgAuACAARQBhAGMAaAAgAHMAZQByAHYAaQBj
AGUAIABhAG4AZAAgAGUAYQBjAGgAIABtAGUAdABoAG8AZABzACAAYgBlAGMAbwBtAGUAcwAgAGEA
IABEAEkAVABBACAAcgBlAGYAZQByAGUAbgBjAGUAIAB0AG8AcABpAGMALgANACAAQQAgABwgcwB1
AGIAbQBhAHAAHSAgAGYAbwByACAAYQBsAGwAIABXAGUAYgAgAFMAZQByAHYAaQBjAGUAcwAgAGkA
cwAgAGMAcgBlAGEAdABlAGQAIABhAG4AZAAgAHIAZQBmAGUAcgBlAG4AYwBlAGQAIABiAHkAIAB0
AGgAZQAgAGcAbABvAGIAYQBsACAAcAByAG8AagBlAGMAdAAgAG0AYQBwAC4AAAChDxQAAAAUAQAA
AAAAAAAAFAEAAAAAAgAcAAAAqg8mAAAAwgAAAAYAAAAJEAAABgAAAAcAAAADAAkQAABMAAAABgAA
AAkQAAAAAPMDFAAAABYAAAAAAAAAAQAAAAsBAAAAAAAAAACfDwQAAAAAAAAAAACoDxQAAABXZWIg
U2VydmljZXMgTWV0aG9kcwAAoQ8WAAAAFQAAAAAAAAgAAAAAFQAAAAAAAgAoAAAAqg8MAAAAFQAA
AAYAAAAJEAAAAADzAxQAAAAYAAAAAAAAAAEAAAANAQAAAAAAAAAAnw8EAAAAAAAAAAAAqA8eAAAA
Q3JlYXRpbmcgYSBQREYgVHJhaW5pbmcgTWFudWFsAAChDxQAAAAfAAAAAAAACAAAAAAfAAAAAAAA
AAAAqg8MAAAAHwAAAAYAAAAJEAAAAADzAxQAAAAZAAAAAAAAAAIAAAAOAQAAAAAAAAAAnw8EAAAA
AAAAAAAAqA8KAAAASGlnaGxpZ2h0cwAAoQ8UAAAACwAAAAAAAAgAAAAACwAAAAAAAAAAAKoPDAAA
AAsAAAAGAAAACRAAABAAnw8EAAAAAQAAAAAAoA/6AwAAVAByAGEAaQBuAGkAbgBnACAAcwBlAHMA
cwBpAG8AbgBzACAAYQByAGUAIABhAGwAbQBvAHMAdAAgAGEAbAB3AGEAeQBzACAAZABpAGYAZgBl
AHIAZQBuAHQAIABiAGUAYwBhAHUAcwBlACAAdABoAGUAIABuAGUAZQBkAHMAIAB2AGEAcgB5ADoA
DQBOAGUAdwAgAHUAcwBlAHIAcwAgAHcAaABvACAAdwBhAG4AdAAgAHQAaABlACAAcAByAG8AZAB1
AGMAdAAgAGYAbwByACAAbQBlAGQAaQBhACAAbQBvAG4AaQB0AG8AcgBpAG4AZwANAE4AZQB3ACAA
dQBzAGUAcgBzACAAdwBoAG8AIAB3AGEAbgB0ACAAdABvACAAcwBoAGEAcgBlACAAbgBlAHcAcwAg
AG8AbgAgAHQAaABlAGkAcgAgAGkAbgB0AHIAYQBuAGUAdAANAE4AZQB3ACAAHCBrAG4AbwB3AGwA
ZQBkAGcAZQAgAG0AYQBuAGEAZwBlAG0AZQBuAHQAHSAgAHUAcwBlAHIAIAB3AGgAbwAgAG4AZQBl
AGQAcwAgAHQAbwAgAGwAZQBhAHIAbgAgAGgAbwB3ACAAdABvACAAYwByAGUAYQB0AGUAIABhAGQA
dgBhAG4AYwBlAGQAIABxAHUAZQByAGkAZQBzAA0AUgBlAGcAdQBsAGEAcgAgAHUAcwBlAHIAcwAg
AHcAaABvACAAdwBhAG4AdAAgAHQAbwAgAGwAZQBhAHIAbgAgAG4AZQB3ACAAZgB1AG4AYwB0AGkA
bwBuAGEAbABpAHQAaQBlAHMADQBSAGUAZwB1AGwAYQByACAAdQBzAGUAcgAgAHcAaABvACAAYQBy
AGUAIABnAG8AaQBuAGcAIAB0AG8AIAB1AHMAZQAgAHQAaABlACAAdABvAG8AbAAgAGYAbwByACAA
bgBlAHcAIABwAHUAcgBwAG8AcwBlAHMADQBDAG8AbQBwAHUAdABlAHIAIABsAGkAdABlAHIAYQB0
AGUAIAB1AHMAZQByAHMAIAB2AHMAIABuAG8AdAAtAHMAbwAtAGMAbwBtAHAAdQB0AGUAcgAgAGwA
aQB0AGUAcgBhAHQAZQAgAHUAcwBlAHIAcwAmIA0ARABvAGMAdQBtAGUAbgB0AHMAIABpAG4AYwBs
AHUAZABlACAAdABoAGUAIABzAGEAbQBlACAAawBpAG4AZAAgAG8AZgAgAHQAYQBiAGwAZQAgAG8A
ZgAgAGMAbwBuAHQAZQBuAHQAIABhAG4AZAAgAGkAbgBkAGUAeAAgAGEAcwAgAHQAaABlACAAbwBu
AGwAaQBuAGUAIABoAGUAbABwAC4ADQAgAAAAoQ9QAAAARgAAAAAAABAAAFoAZAEAAAEAABAAAFoA
UgAAAAAAABAAAFoAAgAAAAAAARAAAAAAWgBGAAAAAAACABgAZAEAAAAAAgAUAFQAAAAAAAIAGAAA
AKoPJgAAAIcBAAAGAAAACRAAAAIAAAAHAAAAAwAJEAAAdQAAAAYAAAAJEAAAAADzAxQAAAAaAAAA
BAAAAAEAAAAPAQAAAAAAAAAAnw8EAAAAAAAAAAAAqA8sAAAARWxlbWVudHMgb2YgUERGIERvY3Vt
ZW50cyBiYXNlZCBvbiBESVRBIG1hcHMAAKEPFgAAAC0AAAAAAAAIAAAAAC0AAAAAAAIAKAAAAKoP
DAAAAC0AAAAGAAAACRAAAC8A8A+oAAAAAADzAxQAAAALAAAAAAAAAAAAAAAAAQAAAAAAAAAA8wMU
AAAADAAAAAAAAAAAAAAAAQEAAAAAAAAAAPMDFAAAAA0AAAAAAAAAAAAAAAIBAAAAAAAAAADzAxQA
AAAOAAAAAAAAAAAAAAADAQAAAAAAAAAA8wMUAAAADwAAAAAAAAAAAAAABAEAAAAAAAAAAPMDFAAA
ABAAAAAAAAAAAAAAAAUBAAAAAAAAAADqAwAAAAAPAO4D9QIAAAIA7wMYAAAAAQAAAA0TAAAAAAAA
AAAAgAAAAAAHABMADwAMBAACAAAPAALw+AEAAFABCPAIAAAAAwAAAAhUAAAPAAPwkAEAAA8ABPAo
AAAAAQAJ8BAAAAAAAAAAAAAAAAAAAAAAAAAAAgAK8AgAAAAAVAAABQAAAA8ABPByAAAAEgAK8AgA
AAACVAAAIAIAAFMAC/AeAAAAfwAAAAQAgABkDXoCvwEAAAEA/wEAAAEAAQMCBAAAAAAQ8AgAAACt
ACABYBV9Aw8AEfAQAAAAAADDCwgAAAAAAAAADQB6Ag8ADfAMAAAAAACeDwQAAAAAAAAADwAE8N4A
AACyBArwCAAAAAdUAAAgCgAAAwEL8JAAAAAEAAAAAAB/AAQABQAEQQUAAAAFwS4AAAAGAQEAAACB
Af///wCCAQAAAQCDAf///wCEAQAAAQC/AQAAEQDAAQAAAAD/AQAACQABAoCAgAABAwMEAACBwwIA
AACIAwAAAABFAE0ATAAyADAAMAA0AG8AbgBsAGkAbgBlAGgAZQBsAHAAaQBuAGQAZQB4AAAAAAAT
ACLxBgAAAL8BAABgAAAAEPAIAAAATQPcAfoUEBAPABHwEAAAAAAAwwsIAAAAAQAAABMA1wMPAATw
SAAAABIACvAIAAAAAVQAAAAMAACDAAvwMAAAAIEBAAAACIMBBQAACJMBjp+LAJQB3r1oAL8BEgAS
AP8BAAAIAAQDCQAAAD8DAQABABAA8AcgAAAA////AAAAAACAgIAAAAAAALvg4wAzM5kAAJmZAJnM
AAAPAIgTnQAAAA8AihOVAAAAAAC6DxAAAABfAF8AXwBQAFAAVAAxADAAAACLE3UAAAAAAOouBAAA
AAIAAAAAAOsuCAAAAAFbxAGwfrjcAAAAKwQAAAAAAAAAHwBE8T0AAAAAACfxIAAAAAAAAAADAAAA
AAAAAAAAAAAAAAAAAKYTAP////8SAAAADwA98Q0AAABAAULxBQAAAAEJAAAADwACKwAAAAAAAHIX
EAAAAAEAEABIQAEAEgAQANRdAQAAAPUPHAAAAAcBAABtEAADJEABANFgAQABAAAAGgAAAAEAHQMP
AOgDwycAAAEA6QMoAAAAgBYAAOAQAADgEAAAgBYAAAUAAAAKAAAACQAAAAoAAAABAAAAAAAAAQ8A
8gMEAgAALwDIDwwAAAAwANIPBAAAAAEAAAAPANUHMAEAAAAAtw9EAAAAQQByAGkAYQBsAAAAbgBn
AHMAAAC8phMAvKYTAKx2lwA8pRMAJKUTAKHQBzAIAAAAAAAAADylEwA6QQkwNKUTAAAABiIQALcP
RAAAAFQAaQBtAGUAcwAgAE4AZQB3ACAAUgBvAG0AYQBuAAAAPKUTACSlEwCh0AcwCAAAAAAAAAA8
pRMAOkEJMDSlEwAAAAaBBQAAggUAAIMFAACEBQAAhQUAAIYFAACHBQAAiAUAAIkFAACKBQAAiwUA
AIwFAACNBQAAjgUAAI8FAACQBQAAkQUAAJIFAACTBQAAlAUAAJUFAACWBQAAlwUAAJgFAACZBQAA
mgUAAJsFAACcBQAAnQUAAJ4FAACfBQAAoAUAAKEFAACiBQAAowUAAKQFAAClBQAApgUAAKcFAACo
BQAAqQUAAKoFAACrBQAArAUAAK0FAACuBQAArwUAALAFAACxBQAAsgUAALMFAAC0BQAAtQUAALYF
AAC3BQAAuAUAALoFAAD9////uwUAALwFAAC9BQAAvgUAAL8FAADABQAAwQUAAMIFAADDBQAAxAUA
AMUFAADGBQAAxwUAAMgFAADJBQAAygUAAMsFAADMBQAAzQUAAM4FAADPBQAA0AUAANEFAADSBQAA
0wUAANQFAADVBQAA1gUAANcFAADYBQAA2QUAANoFAADbBQAA3AUAAN0FAADeBQAA3wUAAOAFAADh
BQAA4gUAAOMFAADkBQAA5QUAAOYFAADnBQAA6AUAAOkFAADqBQAA6wUAAOwFAADtBQAA7gUAAO8F
AADwBQAA8QUAAPIFAADzBQAA9AUAAPUFAAD2BQAA9wUAAPgFAAD5BQAA+gUAAPsFAAD8BQAA/QUA
AP4FAAD/BQAAAAYAAAAAAAAASAAAAAEAAABIAAAAAf/Y/+AAEEpGSUYAAQIBAEgASAAA/+0ADEFk
b2JlX0NNAAL/7gAOQWRvYmUAZIAAAAAB/9sAhAAMCAgICQgMCQkMEQsKCxEVDwwMDxUYExMVExMY
EQwMDAwMDBEMDAwMDAwMDAwMDAwMDAwMDAwMDAwMDAwMDAwMAQ0LCw0ODRAODhAUDg4OFBQODg4O
FBEMDAwMDBERDAwMDAwMEQwMDAwMDAwMDAwMDAwMDAwMDAwMDAwMDAwMDAz/wAARCABgAIADASIA
AhEBAxEB/90ABAAI/8QBPwAAAQUBAQEBAQEAAAAAAAAAAwABAgQFBgcICQoLAQABBQEBAQEBAQAA
AAAAAAABAAIDBAUGBwgJCgsQAAEEAQMCBAIFBwYIBQMMMwEAAhEDBCESMQVBUWETInGBMgYUkaGx
QiMkFVLBYjM0coLRQwclklPw4fFjczUWorKDJkSTVGRFwqN0NhfSVeJl8rOEw9N14/NGJ5SkhbSV
xNTk9KW1xdXl9VZmdoaWprbG1ub2N0dXZ3eHl6e3x9fn9xEAAgIBAgQEAwQFBgcHBgU1AQACEQMh
MRIEQVFhcSITBTKBkRShsUIjwVLR8DMkYuFygpJDUxVjczTxJQYWorKDByY1wtJEk1SjF2RFVTZ0
ZeLys4TD03Xj80aUpIW0lcTU5PSltcXV5fVWZnaGlqa2xtbm9ic3R1dnd4eXp7fH/9oADAMBAAIR
AxEAPwD1GwWmBWQ3xcdY/soL3Zxd+j2NGy0DcCf0ns+zvOwt/RfzvqM/nP5tWdrfAJbW+ATeH1cV
n+7fp+xN6VQaR/a8S11EkU8tfyCftntn/CN2sx/d+h/nbPV/mrKv1k6Lb1iijHqtbS6qw2FzmlwI
DXV7fa5v+kWvtb4BINaDIGqMoiQMTsUwkYSEo7h4r/mBm/8Ac2r/ALbd/wClEv8AmBm/9zav+23f
+lF2ySh+64f3fxkzffM37w/xYvE/8wM3/ubV/wBtu/8ASinR9RM2q1thzKiGzp6bu4j/AEi7NJI8
phIrhP2yV98zfvD/ABYvLf8AM/K/7lV/5jv/ACaX/M/K/wC5Vf8AmO/8mupSTPuPL/un/Gkr75m/
eH+LF5b/AJn5X/cqv/Md/wCTUq/qjlMsY85NZDXB0bD2M/vrp0kjyHLkVwn/ABpK++Zv3h/ixcf9
h3f6Vv3H+9L9h3f6Vv3H+9bCSr/6F5D/ADR/x5/98r73m/e/CLj/ALDu/wBK37j/AHpfsO7/AErf
uP8AethJL/QvIf5o/wCPP/vlfe83734Rf//Q9VSSSSUpJJJJSkkkklKSSSSUpJJJJSkkkklKSSSS
UpJJJJT/AP/R9VSSSSUpJJJJSkkkklKSSSSUpJJJJSkkkklKSSSSUpJJJJT/AP/S9VSSSSUpJJJJ
SkkkklKSSSSUpJJJJSkkkklKSSSSUpJJJJT/AP/T9VSSSSUpJJJJSkkkklKSSSSUpJJJJSkkkklK
SSSSUpJJJJT/AP/U9VSVc5DwY2z5gJ/tD5+ikpOkq/2h/wC6g5XUH47GO9MO3kiCYiP85My5YYoS
yZDwwiLkd/8AopjEyIjHUlvJLJ/bj/8AQj/O/wDMUv24/wD0I/zv/MVS/wBMch/nv+Zl/wC8Zvuu
b938Yusksn9uP/0I/wA7/wAxS/bj/wDQj/O/8xS/0xyH+e/5mX/vFfdc37v4xdZJZP7cf/oR/nf+
Ypftx/8AoR/nf+Ypf6Y5D/Pf8zL/AN4r7rm/d/GLrJLJ/bj/APQj/O/8xS/bj/8AQj/O/wDMUv8A
THIf57/mZf8AvFfdc37v4xdZJZP7cf8A6Ef53/mKX7cf/oR/nf8AmKX+mOQ/z3/My/8AeK+65v3f
xi6ySyf24/8A0I/zv/MUv24//Qj/ADv/ADFL/THIf57/AJmX/vFfdc37v4xf/9n/7QwWUGhvdG9z
aG9wIDMuMAA4QklNBAQAAAAAAAccAgAAAgACADhCSU0EJQAAAAAAEEYM8okmuFbasJwBobCnkHc4
QklNA+0AAAAAABAASAAAAAEAAgBIAAAAAQACOEJJTQQmAAAAAAAOAAAAAAAAAAAAAD+AAAA4QklN
BA0AAAAAAAQAAAB4OEJJTQQZAAAAAAAEAAAAHjhCSU0D8wAAAAAACQAAAAAAAAAAAQA4QklNBAoA
AAAAAAEAADhCSU0nEAAAAAAACgABAAAAAAAAAAI4QklNA/UAAAAAAEgAL2ZmAAEAbGZmAAYAAAAA
AAEAL2ZmAAEAoZmaAAYAAAAAAAEAMgAAAAEAWgAAAAYAAAAAAAEANQAAAAEALQAAAAYAAAAAAAE4
QklNA/gAAAAAAHAAAP////////////////////////////8D6AAAAAD/////////////////////
////////A+gAAAAA/////////////////////////////wPoAAAAAP//////////////////////
//////8D6AAAOEJJTQQAAAAAAAACABs4QklNBAIAAAAAAFoAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAA4QklNBAgAAAAAACQAAAABAAACQAAAAkAAAAAEAAAPYAAAAAdeAQAAEjwBAABg
GAA4QklNBB4AAAAAAAQAAAAAOEJJTQQaAAAAAANXAAAABgAAAAAAAAAAAAACWAAAAyAAAAARAFAA
TwBXAEUAUgBQAE8ASQBOAFQAXwBtAGEAcwB0AGUAcgAAAAEAAAAAAAAAAAAAAAAAAAAAAAAAAQAA
AAAAAAAAAAADIAAAAlgAAAAAAAAAAAAAAAAAAAAAAQAAAAAAAAAAAAAAAAAAAAAAAAAQAAAAAQAA
AAAAAG51bGwAAAACAAAABmJvdW5kc09iamMAAAABAAAAAAAAUmN0MQAAAAQAAAAAVG9wIGxvbmcA
AAAAAAAAAExlZnRsb25nAAAAAAAAAABCdG9tbG9uZwAAAlgAAAAAUmdodGxvbmcAAAMgAAAABnNs
aWNlc1ZsTHMAAAABT2JqYwAAAAEAAAAAAAVzbGljZQAAABIAAAAHc2xpY2VJRGxvbmcAAAAAAAAA
B2dyb3VwSURsb25nAAAAAAAAAAZvcmlnaW5lbnVtAAAADEVTbGljZU9yaWdpbgAAAA1hdXRvR2Vu
ZXJhdGVkAAAAAFR5cGVlbnVtAAAACkVTbGljZVR5cGUAAAAASW1nIAAAAAZib3VuZHNPYmpjAAAA
AQAAAAAAAFJjdDEAAAAEAAAAAFRvcCBsb25nAAAAAAAAAABMZWZ0bG9uZwAAAAAAAAAAQnRvbWxv
bmcAAAJYAAAAAFJnaHRsb25nAAADIAAAAAN1cmxURVhUAAAAAQAAAAAAAG51bGxURVhUAAAAAQAA
AAAAAE1zZ2VURVhUAAAAAQAAAAAABmFsdFRhZ1RFWFQAAAABAAAAAAAOY2VsbFRleHRJc0hUTUxi
b29sAQAAAAhjZWxsVGV4dFRFWFQAAAABAAAAAAAJaG9yekFsaWduZW51bQAAAA9FU2xpY2VIb3J6
QWxpZ24AAAAHZGVmYXVsdAAAAAl2ZXJ0QWxpZ25lbnVtAAAAD0VTbGljZVZlcnRBbGlnbgAAAAdk
ZWZhdWx0AAAAC2JnQ29sb3JUeXBlZW51bQAAABFFU2xpY2VCR0NvbG9yVHlwZQAAAABOb25lAAAA
CXRvcE91dHNldGxvbmcAAAAAAAAACmxlZnRPdXRzZXRsb25nAAAAAAAAAAxib3R0b21PdXRzZXRs
b25nAAAAAAAAAAtyaWdodE91dHNldGxvbmcAAAAAADhCSU0EEQAAAAAAAQEAOEJJTQQUAAAAAAAE
AAAAdjhCSU0EDAAAAAAFvQAAAAEAAACAAAAAYAAAAYAAAJAAAAAFoQAYAAH/2P/gABBKRklGAAEC
AQBIAEgAAP/tAAxBZG9iZV9DTQAC/+4ADkFkb2JlAGSAAAAAAf/bAIQADAgICAkIDAkJDBELCgsR
FQ8MDA8VGBMTFRMTGBEMDAwMDAwRDAwMDAwMDAwMDAwMDAwMDAwMDAwMDAwMDAwMDAENCwsNDg0Q
Dg4QFA4ODhQUDg4ODhQRDAwMDAwREQwMDAwMDBEMDAwMDAwMDAwMDAwMDAwMDAwMDAwMDAwMDAwM
/8AAEQgAYACAAwEiAAIRAQMRAf/dAAQACP/EAT8AAAEFAQEBAQEBAAAAAAAAAAMAAQIEBQYHCAkK
CwEAAQUBAQEBAQEAAAAAAAAAAQACAwQFBgcICQoLEAABBAEDAgQCBQcGCAUDDDMBAAIRAwQhEjEF
QVFhEyJxgTIGFJGhsUIjJBVSwWIzNHKC0UMHJZJT8OHxY3M1FqKygyZEk1RkRcKjdDYX0lXiZfKz
hMPTdePzRieUpIW0lcTU5PSltcXV5fVWZnaGlqa2xtbm9jdHV2d3h5ent8fX5/cRAAICAQIEBAME
BQYHBwYFNQEAAhEDITESBEFRYXEiEwUygZEUobFCI8FS0fAzJGLhcoKSQ1MVY3M08SUGFqKygwcm
NcLSRJNUoxdkRVU2dGXi8rOEw9N14/NGlKSFtJXE1OT0pbXF1eX1VmZ2hpamtsbW5vYnN0dXZ3eH
l6e3x//aAAwDAQACEQMRAD8A9RsFpgVkN8XHWP7KC92cXfo9jRstA3An9J7Ps7zsLf0X876jP5z+
bVna3wCW1vgE3h9XFZ/u36fsTelUGkf2vEtdRJFPLX8gn7Z7Z/wjdrMf3fof52z1f5qyr9ZOi29Y
oox6rW0uqsNhc5pcCA11e32ub/pFr7W+ASDWgyBqjKIkDE7FMJGEhKO4eK/5gZv/AHNq/wC23f8A
pRL/AJgZv/c2r/tt3/pRdskofuuH938ZM33zN+8P8WLxP/MDN/7m1f8Abbv/AEop0fUTNqtbYcyo
hs6em7uI/wBIuzSSPKYSK4T9slffM37w/wAWLy3/ADPyv+5Vf+Y7/wAml/zPyv8AuVX/AJjv/Jrq
Ukz7jy/7p/xpK++Zv3h/ixeW/wCZ+V/3Kr/zHf8Ak1Kv6o5TLGPOTWQ1wdGw9jP766dJI8hy5FcJ
/wAaSvvmb94f4sXH/Yd3+lb9x/vS/Yd3+lb9x/vWwkq/+heQ/wA0f8ef/fK+95v3vwi4/wCw7v8A
St+4/wB6X7Du/wBK37j/AHrYSS/0LyH+aP8Ajz/75X3vN+9+EX//0PVUkkklKSSSSUpJJJJSkkkk
lKSSSSUpJJJJSkkkklKSSSSU/wD/0fVUkkklKSSSSUpJJJJSkkkklKSSSSUpJJJJSkkkklKSSSSU
/wD/0vVUkkklKSSSSUpJJJJSkkkklKSSSSUpJJJJSkkkklKSSSSU/wD/0/VUkkklKSSSSUpJJJJS
kkkklKSSSSUpJJJJSkkkklKSSSSU/wD/1PVUlXOQ8GNs+YCf7Q+fopKTpKv9of8AuoOV1B+OxjvT
Dt5IgmIj/OTMuWGKEsmQ8MIi5Hf/AKKYxMiIx1JbySyf24//AEI/zv8AzFL9uP8A9CP87/zFUv8A
THIf57/mZf8AvGb7rm/d/GLrJLJ/bj/9CP8AO/8AMUv24/8A0I/zv/MUv9Mch/nv+Zl/7xX3XN+7
+MXWSWT+3H/6Ef53/mKX7cf/AKEf53/mKX+mOQ/z3/My/wDeK+65v3fxi6ySyf24/wD0I/zv/MUv
24//AEI/zv8AzFL/AExyH+e/5mX/ALxX3XN+7+MXWSWT+3H/AOhH+d/5il+3H/6Ef53/AJil/pjk
P89/zMv/AHivuub938Yusksn9uP/ANCP87/zFL9uP/0I/wA7/wAxS/0xyH+e/wCZl/7xX3XN+7+M
X//ZADhCSU0EIQAAAAAAVQAAAAEBAAAADwBBAGQAbwBiAGUAIABQAGgAbwB0AG8AcwBoAG8AcAAA
ABMAQQBkAG8AYgBlACAAUABoAG8AdABvAHMAaABvAHAAIAA3AC4AMAAAAAEAOEJJTQQGAAAAAAAH
AAgAAAABAQD/4RJIaHR0cDovL25zLmFkb2JlLmNvbS94YXAvMS4wLwA8P3hwYWNrZXQgYmVnaW49
J++7vycgaWQ9J1c1TTBNcENlaGlIenJlU3pOVGN6a2M5ZCc/Pgo8P2Fkb2JlLXhhcC1maWx0ZXJz
IGVzYz0iQ1IiPz4KPHg6eGFwbWV0YSB4bWxuczp4PSdhZG9iZTpuczptZXRhLycgeDp4YXB0az0n
WE1QIHRvb2xraXQgMi44LjItMzMsIGZyYW1ld29yayAxLjUnPgo8cmRmOlJERiB4bWxuczpyZGY9
J2h0dHA6Ly93d3cudzMub3JnLzE5OTkvMDIvMjItcmRmLXN5bnRheC1ucyMnIHhtbG5zOmlYPSdo
dHRwOi8vbnMuYWRvYmUuY29tL2lYLzEuMC8nPgoKIDxyZGY6RGVzY3JpcHRpb24gYWJvdXQ9J3V1
aWQ6OTFjOTJhMDItMTkxOC0xMWQ4LTk2ZGYtY2E2Zjk3ZjYxYzJmJwogIHhtbG5zOnhhcE1NPSdo
dHRwOi8vbnMuYWRvYmUuY29tL3hhcC8xLjAvbW0vJz4KICA8eGFwTU06RG9jdW1lbnRJRD5hZG9i
ZTpkb2NpZDpwaG90b3Nob3A6NTcyM2VlNGEtY2RjNC0xMWQ3LTliNGMtYWE0NGNiNDNhNTE5PC94
YXBNTTpEb2N1bWVudElEPgogPC9yZGY6RGVzY3JpcHRpb24+Cgo8L3JkZjpSREY+CjwveDp4YXBt
ZXRhPgogICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAg
ICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgCiAgICAgICAg
ICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAg
ICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAKICAgICAgICAgICAgICAgICAgICAg
ICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAg
ICAgICAgICAgICAgICAgICAgICAgIAogICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAg
ICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAg
ICAgICAgICAgCiAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAg
ICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAKICAg
ICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAg
ICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgIAogICAgICAgICAgICAgICAg
ICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAg
ICAgICAgICAgICAgICAgICAgICAgICAgICAgCiAgICAgICAgICAgICAgICAgICAgICAgICAgICAg
ICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAg
ICAgICAgICAgICAgICAKICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAg
ICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAg
IAogICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAg
ICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgCiAgICAgICAgICAg
ICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAg
ICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAKICAgICAgICAgICAgICAgICAgICAgICAg
ICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAg
ICAgICAgICAgICAgICAgICAgIAogICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAg
ICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAg
ICAgICAgCiAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAg
ICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAKICAgICAg
ICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAg
ICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgIAogICAgICAgICAgICAgICAgICAg
ICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAg
ICAgICAgICAgICAgICAgICAgICAgICAgCiAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAg
ICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAg
ICAgICAgICAgICAKICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAg
ICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgIAog
ICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAg
ICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgCiAgICAgICAgICAgICAg
ICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAg
ICAgICAgICAgICAgICAgICAgICAgICAgICAgICAKICAgICAgICAgICAgICAgICAgICAgICAgICAg
ICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAg
ICAgICAgICAgICAgICAgIAogICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAg
ICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAg
ICAgCiAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAg
ICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAKICAgICAgICAg
ICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAg
ICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgIAogICAgICAgICAgICAgICAgICAgICAg
ICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAg
ICAgICAgICAgICAgICAgICAgICAgCiAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAg
ICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAg
ICAgICAgICAKICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAg
ICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgIAogICAg
ICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAg
ICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgCiAgICAgICAgICAgICAgICAg
ICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAg
ICAgICAgICAgICAgICAgICAgICAgICAgICAKICAgICAgICAgICAgICAgICAgICAgICAgICAgICAg
ICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAg
ICAgICAgICAgICAgIAogICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAg
ICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAg
CiAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAg
ICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAKICAgICAgICAgICAg
ICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAg
ICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgIAogICAgICAgICAgICAgICAgICAgICAgICAg
ICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAg
ICAgICAgICAgICAgICAgICAgCiAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAg
ICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAg
ICAgICAKICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAg
ICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgIAogICAgICAg
ICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAg
ICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgCiAgICAgICAgICAgICAgICAgICAg
ICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAg
ICAgICAgICAgICAgICAgICAgICAgICAKICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAg
ICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAg
ICAgICAgICAgIAogICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAg
ICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgCiAg
ICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAKPD94
cGFja2V0IGVuZD0ndyc/Pv/uAA5BZG9iZQBkQAAAAAH/2wCEAAEBAQEBAQEBAQEBAQEBAQEBAQEB
AQEBAQEBAQEBAQEBAQEBAQEBAQEBAQECAgICAgICAgICAgMDAwMDAwMDAwMBAQEBAQEBAQEBAQIC
AQICAwMDAwMDAwMDAwMDAwMDAwMDAwMDAwMDAwMDAwMDAwMDAwMDAwMDAwMDAwMDAwMDA//AABEI
AlgDIAMBEQACEQEDEQH/3QAEAGT/xAGiAAAABgIDAQAAAAAAAAAAAAAHCAYFBAkDCgIBAAsBAAAG
AwEBAQAAAAAAAAAAAAYFBAMHAggBCQAKCxAAAgEDBAEDAwIDAwMCBgl1AQIDBBEFEgYhBxMiAAgx
FEEyIxUJUUIWYSQzF1JxgRhikSVDobHwJjRyChnB0TUn4VM2gvGSokRUc0VGN0djKFVWVxqywtLi
8mSDdJOEZaOzw9PjKThm83UqOTpISUpYWVpnaGlqdnd4eXqFhoeIiYqUlZaXmJmapKWmp6ipqrS1
tre4ubrExcbHyMnK1NXW19jZ2uTl5ufo6er09fb3+Pn6EQACAQMCBAQDBQQEBAYGBW0BAgMRBCES
BTEGACITQVEHMmEUcQhCgSORFVKhYhYzCbEkwdFDcvAX4YI0JZJTGGNE8aKyJjUZVDZFZCcKc4OT
RnTC0uLyVWV1VjeEhaOzw9Pj8ykalKS0xNTk9JWltcXV5fUoR1dmOHaGlqa2xtbm9md3h5ent8fX
5/dIWGh4iJiouMjY6Pg5SVlpeYmZqbnJ2en5KjpKWmp6ipqqusra6vr/2gAMAwEAAhEDEQA/AN/j
37r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfu
vde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Wnl/Ob/7Li3N/4j/rz/3Tv7w2+8P/
AMrptf8A0q4/+r9z1nP92T/lQ93/AOlvL/2j2vVUvuB+si+ve/de697917r3v3Xuve/de697917r
3v3Xuve/de697917r3v3Xuve/de697917r3v3Xuve/de697917r3v3Xuve/de697917r3v3Xuve/
de697917r3v3Xuve/de697917r3v3Xujm9Uf8eBgP/Ir/wC7rI+4Z5s/5L9//tP+rada6ET2Hevd
e9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+69173
7r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3XvfuvdWZbD/wCPG2Z/4ae3
f/dPR++TPuP/ANPD58/6XV7/ANpMvSduJ+3pV+wZ1rr3v3Xuve/de697917r3v3Xuve/de697917
r3v3Xuve/de697917r3v3Xuve/de697917r3v3Xuve/de697917r3v3Xuve/de697917r3v3Xuve
/de697917r3v3Xuve/de697917r/0N/j37r3Xvfuvde9+691737r3QG9h/IDY3X8cyNJVbirqfJw
YWriwixy4zE5ep8phodwZ+RlxOGqNFPI7xPI9SkcbMYrD3iL72/fQ9o/ZmK6t/Eud93mG9WylSwC
ta2l5J4hS33DcXIs7OUiKZmgaSS6RIpJGttCk9Sjyf7Sc083PGypHZ2rwNMhmqJJYlpqe3gAMsy1
ZQHCiMswAkqehKirsnHTR5XNZTbuLxmlKiQU7yVFP9vJGGT/AHOVtRRU7ISQRIKZQy/S17+51tt4
5hgsLfmXmzmTYdu5eosjeEzSReEygr/uwnlt4ipJBEgtVDLwAqCAVJa2LzPYbbY3k99UqNQCtqBo
f0EV2r/R8QkHj0wSdxdTQzNTy9mbDSVGZHVt2YOyOjBWR2++0IysbEEg8H+h9hOb7zf3c4LlrSX3
35QWcEgj97WNAQQCC3j6QQTwJ8j6Ghuntzz/ACRiZOSd1MZAIP0s+QcggaKkf7HqOl1j8ljstSx1
2Kr6LJ0Ut/FWY+qgraWTSbN46imkkiex+tibe5b2Tf8AYuZtuh3jlverTcNpkrontpo54Wpx0yRM
6NTzoxp0FbuyvNvne1v7SWC5XikisjD7VYAj9nU32bdJusH3NP5ZIPuIPNDGs0sPlj8sUT6gkske
rWkblDZiADY/09+691zhmhqIo54JY54ZVDxTQuskUiNyrxyIWR1I+hBt7917rJ7917r3v3Xuve/d
e6xGeFZPC00Qm8fl8RkQSeK5XyaCdXj1C17Wv7917ruKWKdFlhkjmia+mSJ1kRtJKnS6EqbMCD/i
PfuvdZPfuvde9+691737r3Xvfuvde9+691737r3Wnl/Ob/7Li3N/4j/rz/3Tv7w2+8P/AMrptf8A
0q4/+r9z1nP92T/lQ93/AOlvL/2j2vVUvuB+si+ve/de697917r3v3Xuve/de697917r3v3Xuve/
de697917r3v3Xuve/de697917r3v3Xuve/de697917r3v3Xuve/de697917r3v3Xuve/de697917
r3v3Xuve/de697917r3v3Xujm9Uf8eBgP/Ir/wC7rI+4Z5s/5L9//tP+rada6ET2Hevde9+69173
7r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuv
de9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3XvfuvdWZbD/wCPG2Z/4ae3f/dPR++T
PuP/ANPD58/6XV7/ANpMvSduJ+3pV+wZ1rr3v3Xuve/de697917r3v3Xuve/de697917r3v3Xuve
/de697917r3v3Xuve/de697917r3v3Xuve/de697917r3v3Xuve/de697917r3v3Xuve/de69791
7r3v3Xuve/de697917r/0d/j37r3Xvfuvde9+690B29srnd67v8A9FG08jUYWiosfS5fsvdFBKIc
piMTkjIMPtzAy3L02c3GlPKz1Gn/ACSlXWt3ZQMRvdjmLm/3X9y/+Bz9t99m2rarSziu+ad2t2CX
dnZ3Wr6PbNvfJjv9yWOR3uCtLW0HioXlYR9SjyzYbXyzy9/X7f7JLm5lmaLbbWQVimljp41xOODQ
W5ZQI6/qynS1EUkh73TuTr7rzaWO6d29sTE7sz25kjp8BsCClaSnR55WSLPZVqcrW/cNVozpKJEq
6iZWfyppeVYY+9Nzr7L+yftrsv3YeR/aLbuYebd8jSLbuX0iZo0aRikd/dGIi4MxlUtHIsqXtzMr
yfUxaZJ1F3tpsvN3OHMF57jbxzVcbftVkS09+zUYhQCYItXZp0EAqVMUaFV8NqrGQfofhzvKDbeE
yUu7cTX7pxrrXf3L3BT1mS2Sh9RTFGqWpea8cTBXZYGjZ7qDp/cOM20/3Yfuha8jcr77ce4u2XXu
DZMJzsl/FNcbMuai1adZGaoTEpS2aJ5Kxq/hgTtIt1943lyXedzso+X7iLYpho+st2SO9PCsukqB
k5UFwwFCRq7AI+2N+dfYPKQdc9ydRbP6zz1RoioahdvYao2Ln1LLCKmiyH2kkVHFNKot5mkjTgST
K/p9zZyD7t+ynKe/2/sj96L7s3K3InOE2lYZRtljJsO4AkL4sU5hdYEdxgzSTwpSk92ko8PoG75y
pzdulhLzl7ce4W473tKVLr9RMt9AaV0vHrBcgfwBWOSkZXu6FHOdQUeB1bv6aSm2duqjT71MPjHe
l2bvCCNAzYXN4SnkTHIlbEumGqgWOSCQq9zb3kHzh92XbOUGk90PuuJDyz7jWyCcWdqzR7LvUaLq
+hvrCN1tgs6VWG5gWJ4ZGWXUSqsoF2v3Eud208u+5DPuOwyHQZpAGvLRiaeNDOwMhKHLxOWV1BWg
r0K2zt0Y/em18FurF6hRZzHQV0cUlvLTSONNTRz24FRRVKPDIPw6Ee8jfa33C2X3X9vOUPcbl+o2
rd7GOdUYgtExGmWByMeJBMskMlCRrjamOgDzHsd3y1vu6bDfUNzazMhI4MBlXX+i6kOv9Fh1rJ/8
KWdibKyeU/lFZzIbT29V5rc/8174w9cbky82IoWym4Ov82+45ctsnNZDwfd5TauQkhVpaCd3pnYX
KXJuPeiXraFx+Ox+IoaXGYmgo8ZjaGFKeix+PpYKKho6eMWSClpKZIoKeFB9FRQo/p7917omP8wD
4a0/zi+O2d6jx3bHZXQvZOKyVDvrpfu7qjdu4Nqbr6x7W20s821dxTpgcnjF3Rtlp5mp8riKstDW
UUzmJqesjpaun917rW96D+dPy4/nLdi4f+VDvLe+3/jpu/4o5jPw/wA1rvPoztnCU+d+R+J6k3y2
yMZsP4gZTY+Ux+58FtnuvN4xKre+Whp8W+2qeoagTQJFoMh7r3W3/tfbWE2Ztrb+0NtUIxm3drYT
F7dwOOFRVVYocPhaGDHY2k+6rp6quqjT0dMiGWaWSaQjU7MxJPuvda0n/CrXaeFy38vnqPMDB4Ob
djfNb44bVx24Kqk+3y9Nh9wVe8IMlhE3DQLDuDH4XKMQKqKlnj1qL/qAI917rZhwO38DtXEUO39s
YTEbcwOMiaDG4TA42jxGIx8LSPM0VFjcfDT0dJE00jOVjRQWYn6k+/de6SnbXaexejuruxO5uz89
SbX666r2VuXsHfG4a51Smw+1tpYirzmbr31MvkeCgonKRg65XsigswHv3XutL34x/Kf5AfHDvH4c
/wA4b5E9+5TM9R/zZu8N79Q/IP43Zvs7EZnaPxL6j7wyGIrfgDuvaW1KTLwU2HXaO1NhU7bmzElH
rjw+UkScLWzu7+691vCe/de697917r3v3Xuve/de608v5zf/AGXFub/xH/Xn/unf3ht94f8A5XTa
/wDpVx/9X7nrOf7sn/Kh7v8A9LeX/tHteqpfcD9ZF9e9+691737r3Xvfuvde9+691737r3Xvfuvd
e9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+69173
7r3Xvfuvde9+691737r3XvfuvdHN6o/48DAf+RX/AN3WR9wzzZ/yX7//AGn/AFbTrXQiew717r3v
3Xuve/de697917r3v3Xuve/de697917r3v3Xuve/de697917r3v3Xuve/de697917r3v3Xuve/de
697917r3v3Xuve/de697917r3v3Xuve/de697917r3v3Xuve/de697917qzLYf8Ax42zP/DT27/7
p6P3yZ9x/wDp4fPn/S6vf+0mXpO3E/b0q/YM611737r3Xvfuvde9+691737r3Xvfuvde9+691737
r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvd
e9+691737r3Xvfuvde9+691//9Lf49+691737r3XvfuvdEMzfdlf1Hv3t7a0Wy8xuDsHeG7qXKbS
qEQyY7IY2rwGKxuAglijK19XHjWpnCpTq3mYvEZI2Qt748c2fep3r7tfu595fkO39rtx3j3o5m5l
iutoloXt7i1msba226No0pcTra6GEcVsrG4dpLYzW7xFzldtntla+4XKft5vsnMttaco7dtzRXak
0kjkSeWSdgTWNDJqFWkI0ALIEcMB0L/RvUmWwU9d2d2VL/Fu1d2g1FZNORINt4+ojjEeHpEUCCGr
ECKkxjGiJFEER8as0mTH3SPu18w8oXu7+/vvrcfvL7wnMYMsryUP7st5UUC0jUUjSfQFjmMahIIl
WytqQpI88de6XuDYbrFa8j8lJ9PyFt50oFx9TIpNZnJ7imolk1GrkmVxrICGU9539Qt0it/bA2z2
Ttyr21uihSro5wZKaceirxtaqMsGQoJ1IeGpgLf10ut1cMpIMU+8vsxyH77ckbhyLz/tK3G3SVeG
Uds9pcBSI7m3kFGSRKnFdEiFopVeJ3QiblPm3e+S95t962K6MdymGXikiVGqOReDK37VNGUhgCCf
dTdmZTpPM9hdQdk5GTIYvr/D1ue2rlH8SPJiKWOKsp8VT+RhJN/FqXIQtSQl3+3l1wBtIULzL+7n
7+cw/dT5n95/u2e+m9te8v8AJ22T3203J0KzW0SrPHaR621P9dFcwPZwtI5tpddoHKaBHkV7gck2
PubtvKHuJyXZiG/3e5SC6iFSBKxKNK1BQeE0biV6L4i6ZSKlixmuh8NkcF1Hsmhy0LU2RlxtRlaq
mdSj00meyVdnBTtGxZ4nhTIhSrHUpFjyD7zw+5vypvPJn3Z/afZuYLZoN4eylvJI2BVozuN3cbgs
bKe5GRbpVZG71IKvRgR1CPutuVnuvuDzPdbfKHs1mWJWBqGEEaQageBBMZIIwQajHVUX84D4IfKj
55Z/4QUnRUXReE238Tvl91R8uc/m+1uyN8beyu8KvrGavVOu8Ft/aXUW+KekGWp8jI7ZSpr0WJ1V
RTuCzLk11HvV0mCqMzV4bGVO4cZRYXOz0VPLlsTjsrJnaDHV7xg1NJR5mXGYaXJ08Et1SdqSmMgF
zGt7D3XuiCfzJui/mf8AJzpPG/H74hd07I+NmP7R3HTbd+QnfORrtyydubM6QqQsG7sT8f8AAYba
9fiZeyN2UE8tKmVr8xhjiKdWNK4qp4quh917olfyM/kgdZ4Xoj4wwfy1K/bHw4+XHwKd674ld2VF
DVZOgylLmJ6mXsnrn5Bz0lDkcv2JsbuNcpkJM1NU01fUQV9fPPFBJBUVtFV+691dn17Nv+o2LtCb
tbH7OxPZkm3MO2/sd17mM1uDYtHu40MP8fh2hmtyYLbO4MjtwZLyfZyVtBS1RgK+RA4N/de6qL/n
ffBD5L/zGvjVsX49fHibpnbddt7vTrDu7Ib27f3/AL62xQQP1q+5JV23RYbYXW28sxWT5abJ02mq
WtofAnlIIdE1+691cTtuq3DW4Sgqt14bG7e3BKkv8Tw+Hzs25cZRSpPLHGtHnKjC7dnyEM0CpIHe
ipmBfSUuLn3Xuq3f5rnwx7n/AJgfQGyfifsLeuzNgdK9j939W1/zCzGZzW68Vv3P/GvZW6KDd+7O
veoBtzb+VoY9771yuHoojV5OqpKGCjhlidJxUnxe690CHfv/AAn7/lW9s9C9r9TbI+F/x56i3hvb
rfdG0tldrbP65xOO3j11uvIYSppNrb3xOZpkXJS5DbWbNPWMryOKsRNFNrSR1b3Xuj9/BbYPyT6p
+I/Q/V/y73dsTsH5C9cbDx2xuwN/dcZXcWZ2xvd9qyT4Tb27Pv8Ade2Nn5ybcGe2rRUNRmPLQRL/
ABZ6kxs8ZRz7r3Rsvfuvde9+691737r3VPXyV/ll7L+Z3ffZnaG4+0d0bJrsDX7V2DFisJg8Tk6W
opcX15s7cKZCSeuqIZkqJZt0vGUA0hYlN7k+405y9q+XueN0g3bdry9juY7dYQIXiVdKu7gkPDId
VZDU1AoBjiTK/IvvDzN7fbRcbNs1jYy2sty0xMySs+tkjQgFJoxppGpAKk1JzSgAI/8ADCXVn/eQ
PYH/AKCW3P8A6t9hH/geOS/+jpun/OSD/tm6Gn/BN8+f9GjaP+cVx/21de/4YS6s/wC8gewP/QS2
5/8AVvv3/A8cl/8AR03T/nJB/wBs3Xv+Cb58/wCjRtH/ADiuP+2rr3/DCXVn/eQPYH/oJbc/+rff
v+B45L/6Om6f85IP+2br3/BN8+f9GjaP+cVx/wBtXXv+GEurP+8gewP/AEEtuf8A1b79/wADxyX/
ANHTdP8AnJB/2zde/wCCb58/6NG0f84rj/tq69/wwl1Z/wB5A9gf+gltz/6t9+/4Hjkv/o6bp/zk
g/7Zuvf8E3z5/wBGjaP+cVx/21de/wCGEurP+8gewP8A0Etuf/Vvv3/A8cl/9HTdP+ckH/bN17/g
m+fP+jRtH/OK4/7auvf8MJdWf95A9gf+gltz/wCrffv+B45L/wCjpun/ADkg/wC2br3/AATfPn/R
o2j/AJxXH/bV17/hhLqz/vIHsD/0Etuf/Vvv3/A8cl/9HTdP+ckH/bN17/gm+fP+jRtH/OK4/wC2
rr3/AAwl1Z/3kD2B/wCgltz/AOrffv8AgeOS/wDo6bp/zkg/7Zuvf8E3z5/0aNo/5xXH/bV17/hh
Lqz/ALyB7A/9BLbn/wBW+/f8DxyX/wBHTdP+ckH/AGzde/4Jvnz/AKNG0f8AOK4/7auvf8MJdWf9
5A9gf+gltz/6t9+/4Hjkv/o6bp/zkg/7Zuvf8E3z5/0aNo/5xXH/AG1de/4YS6s/7yB7A/8AQS25
/wDVvv3/AAPHJf8A0dN0/wCckH/bN17/AIJvnz/o0bR/ziuP+2rr3/DCXVn/AHkD2B/6CW3P/q33
7/geOS/+jpun/OSD/tm69/wTfPn/AEaNo/5xXH/bV17/AIYS6s/7yB7A/wDQS25/9W+/f8DxyX/0
dN0/5yQf9s3Xv+Cb58/6NG0f84rj/tq69/wwl1Z/3kD2B/6CW3P/AKt9+/4Hjkv/AKOm6f8AOSD/
ALZuvf8ABN8+f9GjaP8AnFcf9tXXv+GEurP+8gewP/QS25/9W+/f8DxyX/0dN0/5yQf9s3Xv+Cb5
8/6NG0f84rj/ALauvf8ADCXVn/eQPYH/AKCW3P8A6t9+/wCB45L/AOjpun/OSD/tm69/wTfPn/Ro
2j/nFcf9tXXv+GEurP8AvIHsD/0Etuf/AFb79/wPHJf/AEdN0/5yQf8AbN17/gm+fP8Ao0bR/wA4
rj/tq69/wwl1Z/3kD2B/6CW3P/q337/geOS/+jpun/OSD/tm69/wTfPn/Ro2j/nFcf8AbV17/hhL
qz/vIHsD/wBBLbn/ANW+/f8AA8cl/wDR03T/AJyQf9s3Xv8Agm+fP+jRtH/OK4/7auvf8MJdWf8A
eQPYH/oJbc/+rffv+B45L/6Om6f85IP+2br3/BN8+f8ARo2j/nFcf9tXXv8AhhLqz/vIHsD/ANBL
bn/1b79/wPHJf/R03T/nJB/2zde/4Jvnz/o0bR/ziuP+2rr3/DCXVn/eQPYH/oJbc/8Aq337/geO
S/8Ao6bp/wA5IP8Atm69/wAE3z5/0aNo/wCcVx/21de/4YS6s/7yB7A/9BLbn/1b79/wPHJf/R03
T/nJB/2zde/4Jvnz/o0bR/ziuP8Atq69/wAMJdWf95A9gf8AoJbc/wDq337/AIHjkv8A6Om6f85I
P+2br3/BN8+f9GjaP+cVx/21dCZt7+TRs3bWHo8LQ967mlpaL7jxSVeysVJUN9zVT1b+R4c9BGbS
TkCyD0gfU8+wzuH3Tvbrcrya9n3rehK9KhZrUDChRStmTwHrx69/wTfPn/Rp2j/nFcf9tXT1/wAN
CbY/5/hnv/QHx/8A9kntH/wIHtp/0fN9/wCc1r/2xda/4Jvnz/o07R/ziuP+2rr3/DQm2P8An+Ge
/wDQHx//ANknv3/Age2n/R833/nNa/8AbF17/gm+fP8Ao07R/wA4rj/tq69/w0Jtj/n+Ge/9AfH/
AP2Se/f8CB7af9Hzff8AnNa/9sXXv+Cb58/6NO0f84rj/tq69/w0Jtj/AJ/hnv8A0B8f/wDZJ79/
wIHtp/0fN9/5zWv/AGxde/4Jvnz/AKNO0f8AOK4/7auvf8NCbY/5/hnv/QHx/wD9knv3/Age2n/R
833/AJzWv/bF17/gm+fP+jTtH/OK4/7auvf8NCbY/wCf4Z7/ANAfH/8A2Se/f8CB7af9Hzff+c1r
/wBsXXv+Cb58/wCjTtH/ADiuP+2rr3/DQm2P+f4Z7/0B8f8A/ZJ79/wIHtp/0fN9/wCc1r/2xde/
4Jvnz/o07R/ziuP+2rr3/DQm2P8An+Ge/wDQHx//ANknv3/Age2n/R833/nNa/8AbF17/gm+fP8A
o07R/wA4rj/tq69/w0Jtj/n+Ge/9AfH/AP2Se/f8CB7af9Hzff8AnNa/9sXXv+Cb58/6NO0f84rj
/tq69/w0Jtj/AJ/hnv8A0B8f/wDZJ79/wIHtp/0fN9/5zWv/AGxde/4Jvnz/AKNO0f8AOK4/7auv
f8NCbY/5/hnv/QHx/wD9knv3/Age2n/R833/AJzWv/bF17/gm+fP+jTtH/OK4/7auvf8NCbY/wCf
4Z7/ANAfH/8A2Se/f8CB7af9Hzff+c1r/wBsXXv+Cb58/wCjTtH/ADiuP+2rr3/DQm2P+f4Z7/0B
8f8A/ZJ79/wIHtp/0fN9/wCc1r/2xde/4Jvnz/o07R/ziuP+2rr3/DQm2P8An+Ge/wDQHx//ANkn
v3/Age2n/R833/nNa/8AbF17/gm+fP8Ao07R/wA4rj/tq69/w0Jtj/n+Ge/9AfH/AP2Se/f8CB7a
f9Hzff8AnNa/9sXXv+Cb58/6NO0f84rj/tq69/w0Jtj/AJ/hnv8A0B8f/wDZJ79/wIHtp/0fN9/5
zWv/AGxde/4Jvnz/AKNO0f8AOK4/7auvf8NCbY/5/hnv/QHx/wD9knv3/Age2n/R833/AJzWv/bF
17/gm+fP+jTtH/OK4/7auvf8NCbY/wCf4Z7/ANAfH/8A2Se/f8CB7af9Hzff+c1r/wBsXXv+Cb58
/wCjTtH/ADiuP+2rr3/DQm2P+f4Z7/0B8f8A/ZJ79/wIHtp/0fN9/wCc1r/2xde/4Jvnz/o07R/z
iuP+2rr3/DQm2P8An+Ge/wDQHx//ANknv3/Age2n/R833/nNa/8AbF17/gm+fP8Ao07R/wA4rj/t
q69/w0Jtj/n+Ge/9AfH/AP2Se/f8CB7af9Hzff8AnNa/9sXXv+Cb58/6NO0f84rj/tq69/w0Jtj/
AJ/hnv8A0B8f/wDZJ79/wIHtp/0fN9/5zWv/AGxde/4Jvnz/AKNO0f8AOK4/7auvf8NCbY/5/hnv
/QHx/wD9knv3/Age2n/R833/AJzWv/bF17/gm+fP+jTtH/OK4/7auvf8NCbY/wCf4Z7/ANAfH/8A
2Se/f8CB7af9Hzff+c1r/wBsXXv+Cb58/wCjTtH/ADiuP+2rr3/DQm2P+f4Z7/0B8f8A/ZJ79/wI
Htp/0fN9/wCc1r/2xde/4Jvnz/o07R/ziuP+2rocsR8BKvDYrGYel7ep5KbFY+ixtO9R13K07wUN
NFSwvM0e/Yo2laOIFiqqCb2AHHvHje/7qr7vW/bzu++XnOXOa3d7dSzuEu9tCB5naRggbaGYKGYh
QWYgUqSc9UP3l+eySf3TtH/OK4/7aunH/ZFsl/z9uh/9FzUf/bB9ln/JpT7uX/Ta87f9lm1/96fr
3/BL89/9GnaP+cVx/wBtXXv9kWyX/P26H/0XNR/9sH37/k0p93L/AKbXnb/ss2v/AL0/Xv8Agl+e
/wDo07R/ziuP+2rr3+yLZL/n7dD/AOi5qP8A7YPv3/JpT7uX/Ta87f8AZZtf/en69/wS/Pf/AEad
o/5xXH/bV17/AGRbJf8AP26H/wBFzUf/AGwffv8Ak0p93L/ptedv+yza/wDvT9e/4Jfnv/o07R/z
iuP+2rr3+yLZL/n7dD/6Lmo/+2D79/yaU+7l/wBNrzt/2WbX/wB6fr3/AAS/Pf8A0ado/wCcVx/2
1de/2RbJf8/bof8A0XNR/wDbB9+/5NKfdy/6bXnb/ss2v/vT9e/4Jfnv/o07R/ziuP8Atq69/si2
S/5+3Q/+i5qP/tg+/f8AJpT7uX/Ta87f9lm1/wDen69/wS/Pf/Rp2j/nFcf9tXXv9kWyX/P26H/0
XNR/9sH37/k0p93L/ptedv8Ass2v/vT9e/4Jfnv/AKNO0f8AOK4/7auvf7Itkv8An7dD/wCi5qP/
ALYPv3/JpT7uX/Ta87f9lm1/96fr3/BL89/9GnaP+cVx/wBtXXv9kWyX/P26H/0XNR/9sH37/k0p
93L/AKbXnb/ss2v/AL0/Xv8Agl+e/wDo07R/ziuP+2rr3+yLZL/n7dD/AOi5qP8A7YPv3/JpT7uX
/Ta87f8AZZtf/en69/wS/Pf/AEado/5xXH/bV17/AGRbJf8AP26H/wBFzUf/AGwffv8Ak0p93L/p
tedv+yza/wDvT9e/4Jfnv/o07R/ziuP+2rr3+yLZL/n7dD/6Lmo/+2D79/yaU+7l/wBNrzt/2WbX
/wB6fr3/AAS/Pf8A0ado/wCcVx/21de/2RbJf8/bof8A0XNR/wDbB9+/5NKfdy/6bXnb/ss2v/vT
9e/4Jfnv/o07R/ziuP8Atq69/si2S/5+3Q/+i5qP/tg+/f8AJpT7uX/Ta87f9lm1/wDen69/wS/P
f/Rp2j/nFcf9tXXv9kWyX/P26H/0XNR/9sH37/k0p93L/ptedv8Ass2v/vT9e/4Jfnv/AKNO0f8A
OK4/7auvf7Itkv8An7dD/wCi5qP/ALYPv3/JpT7uX/Ta87f9lm1/96fr3/BL89/9GnaP+cVx/wBt
XXv9kWyX/P26H/0XNR/9sH37/k0p93L/AKbXnb/ss2v/AL0/Xv8Agl+e/wDo07R/ziuP+2rr3+yL
ZL/n7dD/AOi5qP8A7YPv3/JpT7uX/Ta87f8AZZtf/en69/wS/Pf/AEado/5xXH/bV17/AGRbJf8A
P26H/wBFzUf/AGwffv8Ak0p93L/ptedv+yza/wDvT9e/4Jfnv/o07R/ziuP+2rr3+yLZL/n7dD/6
Lmo/+2D79/yaU+7l/wBNrzt/2WbX/wB6fr3/AAS/Pf8A0ado/wCcVx/21de/2RbJf8/bof8A0XNR
/wDbB9+/5NKfdy/6bXnb/ss2v/vT9e/4Jfnv/o07R/ziuP8Atq69/si2S/5+3Q/+i5qP/tg+/f8A
JpT7uX/Ta87f9lm1/wDen69/wS/Pf/Rp2j/nFcf9tXXv9kWyX/P26H/0XNR/9sH37/k0p93L/pte
dv8Ass2v/vT9e/4Jfnv/AKNO0f8AOK4/7auvf7Itkv8An7dD/wCi5qP/ALYPv3/JpT7uX/Ta87f9
lm1/96fr3/BL89/9GnaP+cVx/wBtXX//09/j37r3Xvfuvde9+691gampmnSqangapiRo4qloozPH
G/640mK+REb8gGx9pH2+wkvYdxksoW3CNCqSlFMiq3xKrkalU+YBAPn06J5liaBZmEDGpWp0kjgS
OBI9es/tX011737r3THnty4DbFI1dnsrR4ynVSy/cSfvzlbDx0dJGHq62diQFjhR5GJsAT7B/Ofu
ByX7e7ZJu/OnMtrt9kqkjxH/AFJKfhghXVNcSEkBYoI5JGJCqpJA6NNq2Tdt8uFtdpsJJ5ic6R2r
83c0RF9WdlUDJIHRSaLpiq7i7cre3N64ifC7KgfHw7b2tlIZYcvuamxMCR0eRz1BKY3xeNqamMTi
lmXzSpaORFW7Pzd2j7re4fed+8hvP3kPdfliXavaqOW3XbNqvI2W83SGziSOG4v7dyGtLWWRfH+m
nQTSpSCWFY6yzZBXPuTB7c+3tt7e8s7glzzMwkNzdREGG2aViXjgcVEsiqSniodCmroxagU6IAAA
AAAFgBwAB9AB/T31RACgKooB1jSTXJ49Fj7NyvYuP3dkI8XuzKUWHkpcXLh8ZhKeuoFpYmp5Y8ic
lWr0D29FkKyWviLxtHWUwWFwjU6tH5Z99e6i9bbm3vJvfDY/OZDe+4KPKUuZiqGmeWpwWFFHRpW0
uQyz1Xx76m8QqpkamiMddJJ5pIx4ZEZ3h917oUO6twbs2x19kcvsyKvOUjy22KWtrcTter3tl8Ht
vI7lxWP3VuPFbRoG+83DkNv7eqamrjp40qGvDr+3qdH28vuvdAyvYWyxEWq/lJvuDKx3RqKfbGyM
XXGUFAxG06zqVcu6xMpEg8Z0FJAxGmS3uvdCd0hubdm5cfvNtw1mazmGxO8ZcXsrdm49j1nXma3R
gBgMFXVlZU7erKTFvPT43cdbXUEFfHQ0ENbFShkidVFTUe691l7Fq+1ju/bOL2JSTHb8229zZDP1
8FZh8Y8WZpcntenwNH99ntp7qoWSooqyvcxKsMpMQYFlVgvuvdPm08Lv9vtchujdeYpZYql/Pt5k
2VlKSpp0Fk8uWxmzsFVATXuRGI2S1tR9+690J3v3Xuip9YZXd/YuOK1vdG+MHvahhaXd20F672jg
I9sZB6ypp58XSwbs69myNXQ0M8JihqPuapaqJUnWR45Udvde6Mht7GZTE4yOiy+46/dVak07tmMn
RYbH1csUkrPDDJT4HHYvGgU0ZCBlhUta7XPv3Xunz37r3Xvfuvde9+690GWw/wDj6u6//Em4r/3z
XUnv3XuhN9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvd
e9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+69173
7r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuv
de9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+6917
37r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfu
vde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3X//U3+Pfuvde
9+691737r3Xvfuvde9+6910yhlKm9mBBsSpseDYqQR/sPdXRZEZGrpIoaEj+YoR+XWwSCCOI6aqT
A4SgqZaykxWPgrZyGnrUpYfvZ2AtqmrGQ1MrW/LMf959hra+S+Udlv7jddr5asod2mNZLhYU+okN
KVecgyufmzniTxJ6X3G7bndQpbXF/M9svwoWOhfsSukfkOnb2J+i/r3v3Xuve/de697917r3v3Xu
ve/de697917r3v3Xuve/de697917r3v3Xuve/de697917r3v3Xuve/de6DLYf/H1d1/+JNxX/vmu
pPfuvdCb7917r3v3Xuve/de697917r3v3Xuve/de697917r3v3Xuve/de697917r3v3Xuve/de69
7917r3v3Xuve/de697917r3v3Xuve/de697917r3v3Xuve/de697917r3v3Xuve/de697917r3v3
Xuve/de697917r3v3Xuve/de697917r3v3Xuve/de697917r3v3Xuve/de697917r3v3Xuve/de6
97917r3v3Xuve/de697917r3v3Xuve/de697917r3v3Xuve/de697917r3v3Xuve/de697917r3v
3Xuve/de697917r3v3Xuve/de697917r3v3Xuve/de697917r3v3Xuve/de697917r3v3Xuve/de
697917r3v3Xuve/de697917r3v3Xuve/de697917r3v3Xuve/de697917r3v3Xuv/9Xer/0t7V/5
1XZv/olO5f8A7Avfuvde/wBLe1f+dV2b/wCiU7l/+wL37r3Xv9Le1f8AnVdm/wDolO5f/sC9+691
7/S3tX/nVdm/+iU7l/8AsC9+6917/S3tX/nVdm/+iU7l/wDsC9+6917/AEt7V/51XZv/AKJTuX/7
Avfuvde/0t7V/wCdV2b/AOiU7l/+wL37r3Xv9Le1f+dV2b/6JTuX/wCwL37r3Xv9Le1f+dV2b/6J
TuX/AOwL37r3Xv8AS3tX/nVdm/8AolO5f/sC9+6917/S3tX/AJ1XZv8A6JTuX/7Avfuvde/0t7V/
51XZv/olO5f/ALAvfuvde/0t7V/51XZv/olO5f8A7Avfuvde/wBLe1f+dV2b/wCiU7l/+wL37r3X
v9Le1f8AnVdm/wDolO5f/sC9+6917/S3tX/nVdm/+iU7l/8AsC9+6917/S3tX/nVdm/+iU7l/wDs
C9+6917/AEt7V/51XZv/AKJTuX/7Avfuvde/0t7V/wCdV2b/AOiU7l/+wL37r3Xv9Le1f+dV2b/6
JTuX/wCwL37r3Xv9Le1f+dV2b/6JTuX/AOwL37r3Xv8AS3tX/nVdm/8AolO5f/sC9+691F6xqWye
T7VziY7O4/H53sOircSdwbdz2162toqXq7rXCz1cWK3JjcVlFpVymKqYVkaFUd4W0kgX9+690K/v
3Xuve/de697917r3v3Xuve/de697917r3v3Xuve/de697917r3v3Xuve/de697917r3v3Xuve/de
697917r3v3Xuve/de697917r3v3Xuve/de697917r3v3Xuve/de697917r3v3Xuve/de697917r3
v3Xuve/de697917r3v3Xuve/de697917r3v3Xuve/de697917r3v3Xuve/de697917r3v3Xuve/d
e697917r3v3Xuve/de697917r3v3Xuve/de697917r3v3Xuve/de697917r3v3Xuve/de697917r
3v3Xuve/de697917r3v3Xuve/de697917r3v3Xuve/de697917r3v3Xuve/de697917r3v3Xuve/
de697917r3v3Xuve/de697917r3v3Xuve/de697917r3v3Xuve/de6//1t/j37r3Xvfuvde9+691
737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvf
uvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+69
1737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xv
fuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+6
91737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3X
vfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+
691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3
Xvfuvde9+691737r3X//19/j37r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+69173
7r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuv
de9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+6917
37r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfu
vde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691
737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvf
uvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+69
1737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3X//0N/j37r3Xvfuvde9
+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r
3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde
9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737
r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvd
e9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+69173
7r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuv
de9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+6917
37r3Xvfuvde9+691737r3X//0d/j37r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+6
91737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3X
vfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+
691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3
Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9
+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r
3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde
9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3X//0t/j37r3Xvfu
vde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691
737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvf
uvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+69
1737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xv
fuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+6
91737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3X
vfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+
691737r3Xvfuvde9+691737r3X//09/j37r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvd
e9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+69173
7r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuv
de9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+6917
37r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfu
vde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691
737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvf
uvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3X//1N/j37r3
Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9
+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r
3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde
9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737
r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvd
e9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+69173
7r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuv
de9+691737r3Xvfuvde9+691737r3X//1d/j37r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xv
fuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+6
91737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3X
vfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+
691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3
Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9
+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r
3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3X//1t/j
37r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfu
vde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691
737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvf
uvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+69
1737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xv
fuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+6
91737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3X
vfuvde9+691737r3Xvfuvde9+691737r3X//19/j37r3Xvfuvde9+691737r3Xvfuvde9+691737
r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvd
e9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+69173
7r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuv
de9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+6917
37r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfu
vde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691
737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3X//
0N/j37r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3
Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9
+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r
3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde
9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737
r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvd
e9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+69173
7r3Xvfuvde9+691737r3Xvfuvde9+691737r3X//0d/j37r3Xvfuvde9+691737r3Xvfuvde9+69
1737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xv
fuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+6
91737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3X
vfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+
691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3
Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9
+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r
3X//0t/j37r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+6917
37r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfu
vde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691
737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvf
uvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+69
1737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xv
fuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+6
91737r3Xvfuvde9+691737r3Xvfuvde9+691737r3X//09/j37r3Xvfuvde9+691737r3Xvfuvde
9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737
r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvd
e9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+69173
7r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuv
de9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+6917
37r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfu
vde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691
737r3X//1N/j37r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+
691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3
Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9
+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r
3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde
9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737
r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvd
e9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3X//1d/j37r3Xvfuvde9+691737r3Xvf
uvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+69
1737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xv
fuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+6
91737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3X
vfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+
691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3
Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9
+691737r3X//1t/j37r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuv
de9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+6917
37r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfu
vde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691
737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvf
uvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+69
1737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xv
fuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3X//19/j37r3Xvfuvde9+691737r
3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde
9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737
r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvd
e9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+69173
7r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuv
de9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+6917
37r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfu
vde9+691737r3X//0N/j37r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3X
vfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+
691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3
Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9
+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r
3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde
9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737
r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3X//0d/j37r3Xvfuvde9+691
737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvf
uvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+69
1737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xv
fuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+6
91737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3X
vfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+
691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3
Xvfuvde9+691737r3X//0t/j37r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+69173
7r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuv
de9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+6917
37r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfu
vde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691
737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvf
uvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+69
1737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3X//09/j37r3Xvfuvde9
+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r
3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde
9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737
r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvd
e9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+69173
7r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuv
de9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+6917
37r3Xvfuvde9+691737r3X//1N/j37r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+6
91737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3X
vfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+
691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3
Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9
+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r
3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde
9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3X//1d/j37r3Xvfu
vde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691
737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvf
uvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+69
1737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xv
fuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+6
91737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3X
vfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+
691737r3Xvfuvde9+691737r3X//1t/j37r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvd
e9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+69173
7r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuv
de9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+6917
37r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfu
vde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691
737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvf
uvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3X//19/j37r3
Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9
+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r
3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde
9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737
r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvd
e9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+69173
7r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuv
de9+691737r3Xvfuvde9+691737r3X//0N/j37r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xv
fuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+6
91737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3X
vfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+
691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3
Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9
+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r
3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3X//0d/j
37r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfu
vde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691
737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvf
uvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+69
1737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xv
fuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+6
91737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3X
vfuvde9+691737r3Xvfuvde9+691737r3X//0t/j37r3Xvfuvde9+691737r3Xvfuvde9+691737
r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvd
e9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+69173
7r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuv
de9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+6917
37r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfu
vde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691
737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3X//
09/j37r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3
Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9
+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r
3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde
9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737
r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvd
e9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+69173
7r3Xvfuvde9+691737r3Xvfuvde9+691737r3X//1N/j37r3Xvfuvde9+691737r3Xvfuvde9+69
1737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xv
fuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+6
91737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3X
vfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+
691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3
Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9
+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r
3X//1d/j37r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+6917
37r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfu
vde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691
737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvf
uvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+69
1737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xv
fuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+6
91737r3Xvfuvde9+691737r3Xvfuvde9+691737r3X//1t/j37r3Xvfuvde9+691737r3Xvfuvde
9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737
r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvd
e9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+69173
7r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuv
de9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+6917
37r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfu
vde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691
737r3X//19/j37r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+
691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3
Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9
+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r
3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde
9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737
r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvd
e9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3X//0N/j37r3Xvfuvde9+691737r3Xvf
uvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+69
1737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xv
fuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+6
91737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3X
vfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+
691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3
Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9
+691737r3X//0d/j37r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuv
de9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+6917
37r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfu
vde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691
737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvf
uvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+69
1737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xv
fuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3X//0t/j37r3Xvfuvde9+691737r
3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde
9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737
r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvd
e9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+69173
7r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuv
de9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+6917
37r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfu
vde9+691737r3X//09/j37r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3X
vfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+
691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3
Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9
+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r
3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde
9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737
r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3X//1N/j37r3Xvfuvde9+691
737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvf
uvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+69
1737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xv
fuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+6
91737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3X
vfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+
691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3
Xvfuvde9+691737r3X//1d/j37r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+69173
7r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuv
de9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+6917
37r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfu
vde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691
737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvf
uvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+69
1737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3X//1t/j37r3Xvfuvde9
+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r
3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde
9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737
r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvd
e9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+69173
7r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuv
de9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+6917
37r3Xvfuvde9+691737r3X//19/j37r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+6
91737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3X
vfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+
691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3
Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9
+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r
3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde
9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3X//0N/j37r3Xvfu
vde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691
737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvf
uvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+69
1737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xv
fuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+6
91737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3X
vfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+
691737r3Xvfuvde9+691737r3X//0d/j37r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvd
e9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+69173
7r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuv
de9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+6917
37r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfu
vde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691
737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvf
uvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3X//0t/j37r3
Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9
+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r
3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde
9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737
r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvd
e9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+69173
7r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuv
de9+691737r3Xvfuvde9+691737r3X//09/j37r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xv
fuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+6
91737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3X
vfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+
691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3
Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9
+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r
3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3X//1N/j
37r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfu
vde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691
737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvf
uvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+69
1737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xv
fuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+6
91737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3X
vfuvde9+691737r3Xvfuvde9+691737r3X//1d/j37r3Xvfuvde9+691737r3Xvfuvde9+691737
r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvd
e9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+69173
7r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuv
de9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+6917
37r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfu
vde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691
737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3X//
1t/j37r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3
Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9
+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r
3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde
9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737
r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvd
e9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+69173
7r3Xvfuvde9+691737r3Xvfuvde9+691737r3X//19/j37r3Xvfuvde9+691737r3Xvfuvde9+69
1737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xv
fuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+6
91737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3X
vfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+
691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3
Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9
+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r
3X//0N/j37r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+6917
37r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfu
vde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691
737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvf
uvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+69
1737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xv
fuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+6
91737r3Xvfuvde9+691737r3Xvfuvde9+691737r3X//0d/j37r3Xvfuvde9+691737r3Xvfuvde
9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737
r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvd
e9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+69173
7r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuv
de9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+6917
37r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfu
vde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691
737r3X//0t/j37r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+
691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3
Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9
+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r
3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde
9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737
r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvd
e9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3X//09/j37r3Xvfuvde9+691737r3Xvf
uvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+69
1737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xv
fuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+6
91737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3X
vfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+
691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3
Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9
+691737r3X//1N/j37r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuv
de9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+6917
37r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfu
vde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691
737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvf
uvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+69
1737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xv
fuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3X//1d/j37r3Xvfuvde9+691737r
3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde
9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737
r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvd
e9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+69173
7r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuv
de9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+6917
37r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfu
vde9+691737r3X//1t/j37r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3X
vfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+
691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3
Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9
+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r
3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde
9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737
r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3X//19/j37r3Xvfuvde9+691
737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvf
uvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+69
1737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xv
fuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+6
91737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3X
vfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+
691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3
Xvfuvde9+691737r3X//0N/j37r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+69173
7r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuv
de9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+6917
37r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfu
vde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691
737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvf
uvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+69
1737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3X//0d/j37r3Xvfuvde9
+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r
3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde
9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737
r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvd
e9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+69173
7r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuv
de9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+6917
37r3Xvfuvde9+691737r3X//0t/j37r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+6
91737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3X
vfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+
691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3
Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9
+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r
3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde
9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3X//09/j37r3Xvfu
vde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691
737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvf
uvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+69
1737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xv
fuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+6
91737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3X
vfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+
691737r3Xvfuvde9+691737r3X//1N/j37r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvd
e9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+69173
7r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuv
de9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+6917
37r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfu
vde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691
737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvf
uvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3X//1d/j37r3
Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9
+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r
3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde
9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737
r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvd
e9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+69173
7r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuv
de9+691737r3Xvfuvde9+691737r3X//1t37/SP2j/z7vYP/AKNbcX/2nvfuvde/0j9o/wDPu9g/
+jW3F/8Aae9+6917/SP2j/z7vYP/AKNbcX/2nvfuvde/0j9o/wDPu9g/+jW3F/8Aae9+6917/SP2
j/z7vYP/AKNbcX/2nvfuvde/0j9o/wDPu9g/+jW3F/8Aae9+6917/SP2j/z7vYP/AKNbcX/2nvfu
vde/0j9o/wDPu9g/+jW3F/8Aae9+6917/SP2j/z7vYP/AKNbcX/2nvfuvde/0j9o/wDPu9g/+jW3
F/8Aae9+6917/SP2j/z7vYP/AKNbcX/2nvfuvde/0j9o/wDPu9g/+jW3F/8Aae9+6917/SP2j/z7
vYP/AKNbcX/2nvfuvde/0j9o/wDPu9g/+jW3F/8Aae9+6917/SP2j/z7vYP/AKNbcX/2nvfuvde/
0j9o/wDPu9g/+jW3F/8Aae9+6917/SP2j/z7vYP/AKNbcX/2nvfuvde/0j9o/wDPu9g/+jW3F/8A
ae9+6917/SP2j/z7vYP/AKNbcX/2nvfuvde/0j9o/wDPu9g/+jW3F/8Aae9+6917/SP2j/z7vYP/
AKNbcX/2nvfuvde/0j9o/wDPu9g/+jW3F/8Aae9+690CW5/mFuHae48xtjI9U4Wavwk1HBVTUXZV
dJRyPW4rH5iI08k/W1NM6rTZJFbVGhEgYC4AY4d/eD++37Vfdt5z2zkbnnl/mG73a72uO/R7CCzl
hEMs9zbqrNcX1q4kD2shIEZXSUIcksqyjyR7Scx8+7Vcbxs97Yx20dw0JEzyq2pUjckBIZBppItD
qBqDilCWL/Z4cr/z6XH/APox6n/7XvuCv+Tr33d/+mM50/7JNs/72/Qx/wCBu55/6Ou0/wDOW4/7
Zevf7PDlf+fS4/8A9GPU/wD2vffv+Tr33d/+mM50/wCyTbP+9v17/gbuef8Ao67T/wA5bj/tl69/
s8OV/wCfS4//ANGPU/8A2vffv+Tr33d/+mM50/7JNs/72/Xv+Bu55/6Ou0/85bj/ALZevf7PDlf+
fS4//wBGPU//AGvffv8Ak6993f8A6YznT/sk2z/vb9e/4G7nn/o67T/zluP+2Xr3+zw5X/n0uP8A
/Rj1P/2vffv+Tr33d/8ApjOdP+yTbP8Avb9e/wCBu55/6Ou0/wDOW4/7Zevf7PDlf+fS4/8A9GPU
/wD2vffv+Tr33d/+mM50/wCyTbP+9v17/gbuef8Ao67T/wA5bj/tl69/s8OV/wCfS4//ANGPU/8A
2vffv+Tr33d/+mM50/7JNs/72/Xv+Bu55/6Ou0/85bj/ALZevf7PDlf+fS4//wBGPU//AGvffv8A
k6993f8A6YznT/sk2z/vb9e/4G7nn/o67T/zluP+2Xr3+zw5X/n0uP8A/Rj1P/2vffv+Tr33d/8A
pjOdP+yTbP8Avb9e/wCBu55/6Ou0/wDOW4/7Zevf7PDlf+fS4/8A9GPU/wD2vffv+Tr33d/+mM50
/wCyTbP+9v17/gbuef8Ao67T/wA5bj/tl69/s8OV/wCfS4//ANGPU/8A2vffv+Tr33d/+mM50/7J
Ns/72/Xv+Bu55/6Ou0/85bj/ALZevf7PDlf+fS4//wBGPU//AGvffv8Ak6993f8A6YznT/sk2z/v
b9e/4G7nn/o67T/zluP+2Xr3+zw5X/n0uP8A/Rj1P/2vffv+Tr33d/8ApjOdP+yTbP8Avb9e/wCB
u55/6Ou0/wDOW4/7Zevf7PDlf+fS4/8A9GPU/wD2vffv+Tr33d/+mM50/wCyTbP+9v17/gbuef8A
o67T/wA5bj/tl69/s8OV/wCfS4//ANGPU/8A2vffv+Tr33d/+mM50/7JNs/72/Xv+Bu55/6Ou0/8
5bj/ALZevf7PDlf+fS4//wBGPU//AGvffv8Ak6993f8A6YznT/sk2z/vb9e/4G7nn/o67T/zluP+
2Xr3+zw5X/n0uP8A/Rj1P/2vffv+Tr33d/8ApjOdP+yTbP8Avb9e/wCBu55/6Ou0/wDOW4/7Zevf
7PDlf+fS4/8A9GPU/wD2vffv+Tr33d/+mM50/wCyTbP+9v17/gbuef8Ao67T/wA5bj/tl69/s8OV
/wCfS4//ANGPU/8A2vffv+Tr33d/+mM50/7JNs/72/Xv+Bu55/6Ou0/85bj/ALZevf7PDlf+fS4/
/wBGPU//AGvffv8Ak6993f8A6YznT/sk2z/vb9e/4G7nn/o67T/zluP+2Xr3+zw5X/n0uP8A/Rj1
P/2vffv+Tr33d/8ApjOdP+yTbP8Avb9e/wCBu55/6Ou0/wDOW4/7Zevf7PDlf+fS4/8A9GPU/wD2
vffv+Tr33d/+mM50/wCyTbP+9v17/gbuef8Ao67T/wA5bj/tl69/s8OV/wCfS4//ANGPU/8A2vff
v+Tr33d/+mM50/7JNs/72/Xv+Bu55/6Ou0/85bj/ALZevf7PDlf+fS4//wBGPU//AGvffv8Ak699
3f8A6YznT/sk2z/vb9e/4G7nn/o67T/zluP+2Xr3+zw5X/n0uP8A/Rj1P/2vffv+Tr33d/8ApjOd
P+yTbP8Avb9e/wCBu55/6Ou0/wDOW4/7Zevf7PDlf+fS4/8A9GPU/wD2vffv+Tr33d/+mM50/wCy
TbP+9v17/gbuef8Ao67T/wA5bj/tl69/s8OV/wCfS4//ANGPU/8A2vffv+Tr33d/+mM50/7JNs/7
2/Xv+Bu55/6Ou0/85bj/ALZevf7PDlf+fS4//wBGPU//AGvffv8Ak6993f8A6YznT/sk2z/vb9e/
4G7nn/o67T/zluP+2Xr3+zw5X/n0uP8A/Rj1P/2vffv+Tr33d/8ApjOdP+yTbP8Avb9e/wCBu55/
6Ou0/wDOW4/7Zevf7PDlf+fS4/8A9GPU/wD2vffv+Tr33d/+mM50/wCyTbP+9v17/gbuef8Ao67T
/wA5bj/tl69/s8OV/wCfS4//ANGPU/8A2vffv+Tr33d/+mM50/7JNs/72/Xv+Bu55/6Ou0/85bj/
ALZevf7PDlf+fS4//wBGPU//AGvffv8Ak6993f8A6YznT/sk2z/vb9e/4G7nn/o67T/zluP+2Xr3
+zw5X/n0uP8A/Rj1P/2vffv+Tr33d/8ApjOdP+yTbP8Avb9e/wCBu55/6Ou0/wDOW4/7Zevf7PDl
f+fS4/8A9GPU/wD2vffv+Tr33d/+mM50/wCyTbP+9v17/gbuef8Ao67T/wA5bj/tl69/s8OV/wCf
S4//ANGPU/8A2vffv+Tr33d/+mM50/7JNs/72/Xv+Bu55/6Ou0/85bj/ALZevf7PDlf+fS4//wBG
PU//AGvffv8Ak6993f8A6YznT/sk2z/vb9e/4G7nn/o67T/zluP+2Xr3+zw5X/n0uP8A/Rj1P/2v
ffv+Tr33d/8ApjOdP+yTbP8Avb9e/wCBu55/6Ou0/wDOW4/7Zevf7PDlf+fS4/8A9GPU/wD2vffv
+Tr33d/+mM50/wCyTbP+9v17/gbuef8Ao67T/wA5bj/tl69/s8OV/wCfS4//ANGPU/8A2vffv+Tr
33d/+mM50/7JNs/72/Xv+Bu55/6Ou0/85bj/ALZevf7PDlf+fS4//wBGPU//AGvffv8Ak6993f8A
6YznT/sk2z/vb9e/4G7nn/o67T/zluP+2Xr3+zw5X/n0uP8A/Rj1P/2vffv+Tr33d/8ApjOdP+yT
bP8Avb9e/wCBu55/6Ou0/wDOW4/7Zevf7PDlf+fS4/8A9GPU/wD2vffv+Tr33d/+mM50/wCyTbP+
9v17/gbuef8Ao67T/wA5bj/tl69/s8OV/wCfS4//ANGPU/8A2vffv+Tr33d/+mM50/7JNs/72/Xv
+Bu55/6Ou0/85bj/ALZevf7PDlf+fS4//wBGPU//AGvffv8Ak6993f8A6YznT/sk2z/vb9e/4G7n
n/o67T/zluP+2Xr3+zw5X/n0uP8A/Rj1P/2vffv+Tr33d/8ApjOdP+yTbP8Avb9e/wCBu55/6Ou0
/wDOW4/7Zevf7PDlf+fS4/8A9GPU/wD2vffv+Tr33d/+mM50/wCyTbP+9v17/gbuef8Ao67T/wA5
bj/tl69/s8OV/wCfS4//ANGPU/8A2vffv+Tr33d/+mM50/7JNs/72/Xv+Bu55/6Ou0/85bj/ALZe
vf7PDlf+fS4//wBGPU//AGvffv8Ak6993f8A6YznT/sk2z/vb9e/4G7nn/o67T/zluP+2Xr3+zw5
X/n0uP8A/Rj1P/2vffv+Tr33d/8ApjOdP+yTbP8Avb9e/wCBu55/6Ou0/wDOW4/7Zevf7PDlf+fS
4/8A9GPU/wD2vffv+Tr33d/+mM50/wCyTbP+9v17/gbuef8Ao67T/wA5bj/tl69/s8OV/wCfS4//
ANGPU/8A2vffv+Tr33d/+mM50/7JNs/72/Xv+Bu55/6Ou0/85bj/ALZevf7PDlf+fS4//wBGPU//
AGvffv8Ak6993f8A6YznT/sk2z/vb9e/4G7nn/o67T/zluP+2Xr3+zw5X/n0uP8A/Rj1P/2vffv+
Tr33d/8ApjOdP+yTbP8Avb9e/wCBu55/6Ou0/wDOW4/7Zevf7PDlf+fS4/8A9GPU/wD2vffv+Tr3
3d/+mM50/wCyTbP+9v17/gbuef8Ao67T/wA5bj/tl69/s8OV/wCfS4//ANGPU/8A2vffv+Tr33d/
+mM50/7JNs/72/Xv+Bu55/6Ou0/85bj/ALZevf7PDlf+fS4//wBGPU//AGvffv8Ak6993f8A6Yzn
T/sk2z/vb9e/4G7nn/o67T/zluP+2Xr3+zw5X/n0uP8A/Rj1P/2vffv+Tr33d/8ApjOdP+yTbP8A
vb9e/wCBu55/6Ou0/wDOW4/7Zevf7PDlf+fS4/8A9GPU/wD2vffv+Tr33d/+mM50/wCyTbP+9v17
/gbuef8Ao67T/wA5bj/tl69/s8OV/wCfS4//ANGPU/8A2vffv+Tr33d/+mM50/7JNs/72/Xv+Bu5
5/6Ou0/85bj/ALZevf7PDlf+fS4//wBGPU//AGvffv8Ak6993f8A6YznT/sk2z/vb9e/4G7nn/o6
7T/zluP+2Xr3+zw5X/n0uP8A/Rj1P/2vffv+Tr33d/8ApjOdP+yTbP8Avb9e/wCBu55/6Ou0/wDO
W4/7Zevf7PDlf+fS4/8A9GPU/wD2vffv+Tr33d/+mM50/wCyTbP+9v17/gbuef8Ao67T/wA5bj/t
l69/s8OV/wCfS4//ANGPU/8A2vffv+Tr33d/+mM50/7JNs/72/Xv+Bu55/6Ou0/85bj/ALZevf7P
Dlf+fS4//wBGPU//AGvffv8Ak6993f8A6YznT/sk2z/vb9e/4G7nn/o67T/zluP+2Xr3+zw5X/n0
uP8A/Rj1P/2vffv+Tr33d/8ApjOdP+yTbP8Avb9e/wCBu55/6Ou0/wDOW4/7Zevf7PDlf+fS4/8A
9GPU/wD2vffv+Tr33d/+mM50/wCyTbP+9v17/gbuef8Ao67T/wA5bj/tl69/s8OV/wCfS4//ANGP
U/8A2vffv+Tr33d/+mM50/7JNs/72/Xv+Bu55/6Ou0/85bj/ALZevf7PDlf+fS4//wBGPU//AGvf
fv8Ak6993f8A6YznT/sk2z/vb9e/4G7nn/o67T/zluP+2Xr3+zw5X/n0uP8A/Rj1P/2vffv+Tr33
d/8ApjOdP+yTbP8Avb9e/wCBu55/6Ou0/wDOW4/7Zevf7PDlf+fS4/8A9GPU/wD2vffv+Tr33d/+
mM50/wCyTbP+9v17/gbuef8Ao67T/wA5bj/tl69/s8OV/wCfS4//ANGPU/8A2vffv+Tr33d/+mM5
0/7JNs/72/Xv+Bu55/6Ou0/85bj/ALZevf7PDlf+fS4//wBGPU//AGvffv8Ak6993f8A6YznT/sk
2z/vb9e/4G7nn/o67T/zluP+2Xr3+zw5X/n0uP8A/Rj1P/2vffv+Tr33d/8ApjOdP+yTbP8Avb9e
/wCBu55/6Ou0/wDOW4/7Zevf7PDlf+fS4/8A9GPU/wD2vffv+Tr33d/+mM50/wCyTbP+9v17/gbu
ef8Ao67T/wA5bj/tl69/s8OV/wCfS4//ANGPU/8A2vffv+Tr33d/+mM50/7JNs/72/Xv+Bu55/6O
u0/85bj/ALZevf7PDlf+fS4//wBGPU//AGvffv8Ak6993f8A6YznT/sk2z/vb9e/4G7nn/o67T/z
luP+2Xr3+zw5X/n0uP8A/Rj1P/2vffv+Tr33d/8ApjOdP+yTbP8Avb9e/wCBu55/6Ou0/wDOW4/7
Zev/194D37r3Xvfuvde9+691737r3Xvfuvde9+691737r3UaOsppaupoUk1VVJDTT1EWiQeOKsNQ
tM2sqI38hpZOFJI082uL+691J9+691FFZTGsbHiT/K1pVrDDok4pnleBZPJp8XMsZFtWri9re/de
6le/de697917r3v3XusNRUQUkE9VVTRU9NTQyVFRUTOsUMEEKNJLNLI5CRxRRqWZiQABc+/de6g0
+bxNViY89FX0ww0lL96uSnkFLSCkALGpklqfCIYQouWfSAOfp7917p09+691737r3Xvfuvde9+69
1737r3Xvfuvde9+691W33T/zN7sD/tYbf/8AeH2r7+fX+9e/8SI5M/8AFLtP+7nu/WbP3bv+VG3X
/pbS/wDaPa9Bp75i9ZB9e9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+69
1737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xv
fuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+6
91737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3X
vfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+
691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691//9De
A9+691xdEkR45FDxyKyOjC6sjgqysD9QwNj7917ouW2end24jPYKryW648hg8dlxJWY37mud5cJt
KmlputKWm81PYVNFJUyVGR1vZ5SqozhQffuvdLjsvr3I73nwJxuZbCwoa3D7mkhnqIKuu2nk3oq2
vo6F4I5E+/avxFMqGTSqRSSkMGsG917p32HtTJ4Ta1Rjt2V1Pms9mq3LZHctbStP9lWVOTlaER0o
mjgnip4cXFDCBZSNBt7917oM9odQ7wwud29X5zdseXxmPqUqMpQCesbzna2Lqtv9f/a+SmjBKYyu
epyWpkEldHGw8oGoe690PxbJfxKNFgoThzQytLUmqqBklyQqIRBBHRCjNK9C9KZGeU1CyLIqqI2D
Fl917pgx2Dr6Tee6NwTTwPjczhNp46hp0lmaogqcHUbnlr5JoWhWCOOdMzAEKO7MUbUFsur3XukZ
jti7gpO0a/esrYQ4GsWvp4MPHkMu0+OmmocXB/eanikpRjWzWZNE1PVwhI1ip1RknkdpVf3Xulmu
Dr131PuUzwfwuTaVLg1pvLN9yK+DMVlfJOYfD9uIGp6hVDCTWWBBW1ifde6QOa2Hu7IdmY3dtJWY
amxFBkcTMJIq2ejyz4mnxlTSZPFVdLHt+pevarrKkyK/8SgpzEFR6dnQS+/de6ndmbI3Huyu23Wb
fqqCnkwxrWZsrkD/AA6KepnxskNZLgZNs5uPLS0sdHIFMdVjKhRIVWoVXcH3Xun7sPbOT3RjMTTY
1cfVDHZ+lytfhsvX12NxWfoIaHJUr4qvrMfR5GeKEVNZFUrenmQyU6hlsbj3XusEOzsn/otl2PX5
CLJZebaVdgpMhUT1hppKypoJ6eFnqJBNXNSU8kqqHYNIY0uVv6ffuvdY85sR8n1VXdfUr0tNU1G1
P4JTzSSVT0UWQSkRY5nl0mramFagYnSW0/2T+n37r3SvihyVFt6Cnx1BjIsrSYmnhpcbLk62TEQ1
kFKkaUTZg405CahikXQKg0gldBqMQYlR7r3TLvjAZTcu3kx1DJRrUrkMRXVePq6qrpcXmqWhrYKm
uwVdXUlNUVdPj8lFGY3kWCW44aJ1LKfde6x5nbmSyXX9ZtjHSUm3cpU4EY2nNBWV01Bj5xCiGngr
xDRZF6JtJj8vjSXxsTpvx7917rD15tnJ7XxmWpskuPpRkc/VZWgw2Ir67JYrAUE1DjaVMVQVmQo8
dPLCamjlqWtTwoJKhgq2Fz7r3QSHpDNrSyPDW4qLLHD5Lx1q5XNpo3M+82zeHzAZaS6vj8DI9Mso
XyRljGqmMlvfuvdGa9+691737r3VbfdP/M3uwP8AtYbf/wDeH2r7+fX+9e/8SI5M/wDFLtP+7nu/
WbP3bv8AlRt1/wCltL/2j2vQae+YvWQfXvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+6
91737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3X
vfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+
691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3
Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9
+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r
3Xvfuvdf/9HeA9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xv
fuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691W33T/zN7sD/ALWG
3/8A3h9q+/n1/vXv/EiOTP8AxS7T/u57v1mz927/AJUbdf8ApbS/9o9r0GnvmL1kH1737r3Xvfuv
de9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+6917
37r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfu
vde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691
737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvf
uvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+69
1737r3Xvfuvde9+691737r3Xvfuvde9+691737r3X//ZoEYd8IEGAQBboHHuPh1ogGcjSh1T+nqT
///Y/+AAEEpGSUYAAQIBAEgASAAA/+EHP0V4aWYAAE1NACoAAAAIAAcBEgADAAAAAQABAAABGgAF
AAAAAQAAAGIBGwAFAAAAAQAAAGoBKAADAAAAAQACAAABMQACAAAAFAAAAHIBMgACAAAAFAAAAIaH
aQAEAAAAAQAAAJwAAADIAAAASAAAAAEAAABIAAAAAUFkb2JlIFBob3Rvc2hvcCA3LjAAMjAwMzox
MToxNyAxNjoyNToyNgAAAAADoAEAAwAAAAH//wAAoAIABAAAAAEAAAMgoAMABAAAAAEAAAJYAAAA
AAAAAAYBAwADAAAAAQAGAAABGgAFAAAAAQAAARYBGwAFAAAAAQAAAR4BKAADAAAAAQACAAACAQAE
AAAAAQAAASYCAgAEAAAAAQAABhEAAAAAAAAASAAAAAEAAABIAAAAAf/Y/+AAEEpGSUYAAQIBAEgA
SAAA/+0ADEFkb2JlX0NNAAL/7gAOQWRvYmUAZIAAAAAB/9sAhAAMCAgICQgMCQkMEQsKCxEVDwwM
DxUYExMVExMYEQwMDAwMDBEMDAwMDAwMDAwMDAwMDAwMDAwMDAwMDAwMDAwMAQ0LCw0ODRAODhAU
Dg4OFBQODg4OFBEMDAwMDAEGAAACBgAAAwYAAAQGAAAFBgAABgYAAAcGAAAIBgAACQYAAAoGAAAL
BgAADAYAAA0GAAAOBgAADwYAABAGAAARBgAAEgYAABMGAAAUBgAAFQYAABYGAAAXBgAAGAYAABkG
AAAaBgAAGwYAABwGAAAdBgAAHgYAAB8GAAAgBgAAIQYAACIGAAAjBgAAJAYAACUGAAAmBgAAJwYA
ACgGAAApBgAAKgYAACsGAAAsBgAALQYAAC4GAAAvBgAAMAYAADEGAAAyBgAAMwYAADQGAAA1BgAA
NgYAADcGAAA4BgAAOQYAADoGAAA7BgAAPAYAAP7///8+BgAAPwYAAEAGAABBBgAAQgYAAEMGAABE
BgAARQYAAEYGAABHBgAASAYAAEkGAABKBgAASwYAAEwGAABNBgAATgYAAE8GAABQBgAAUQYAAFIG
AABTBgAAVAYAAFUGAABWBgAAVwYAAFgGAABZBgAAWgYAAFsGAABcBgAAXQYAAF4GAABfBgAAYAYA
AGEGAABiBgAAYwYAAGQGAABlBgAAZgYAAGcGAABoBgAAaQYAAGoGAABrBgAAbAYAAG0GAABuBgAA
bwYAAHAGAABxBgAAcgYAAHMGAAB0BgAAdQYAAHYGAAB3BgAAeAYAAHkGAAB6BgAAewYAAHwGAAB9
BgAAfgYAAIAGAAD9////EREMDAwMDAwRDAwMDAwMDAwMDAwMDAwMDAwMDAwMDAwMDAwMDP/AABEI
AGAAgAMBIgACEQEDEQH/3QAEAAj/xAE/AAABBQEBAQEBAQAAAAAAAAADAAECBAUGBwgJCgsBAAEF
AQEBAQEBAAAAAAAAAAEAAgMEBQYHCAkKCxAAAQQBAwIEAgUHBggFAwwzAQACEQMEIRIxBUFRYRMi
cYEyBhSRobFCIyQVUsFiMzRygtFDByWSU/Dh8WNzNRaisoMmRJNUZEXCo3Q2F9JV4mXys4TD03Xj
80YnlKSFtJXE1OT0pbXF1eX1VmZ2hpamtsbW5vY3R1dnd4eXp7fH1+f3EQACAgECBAQDBAUGBwcG
BTUBAAIRAyExEgRBUWFxIhMFMoGRFKGxQiPBUtHwMyRi4XKCkkNTFWNzNPElBhaisoMHJjXC0kST
VKMXZEVVNnRl4vKzhMPTdePzRpSkhbSVxNTk9KW1xdXl9VZmdoaWprbG1ub2JzdHV2d3h5ent8f/
2gAMAwEAAhEDEQA/APUrbBW2eZMDvqhtusD212tDXu4gyDHO3RG93gPvTQZ3QJ4mUyUZmVidbemt
P6y4EVRH1an2+/biO+zPIyYFsbv0Mx7rN1bXbdzvT/0m/wDwf2f7RkY7XdQvrp9RmJZc/wBY1Gtn
IY1x35B3tZ/gWepWxv8APP8ATpr/AJxWRTWAAGNAGoA/3KWwRGxsTPz5nhPWtbrFVl3Sc2mppfbb
RYytg5LnNcxjdf3nFef/APNr6wf9wLP86v8A9Kr0pwc4RoNQfuMqShy4I5CCSRXZmw8xLECIgG+7
5n/za+sH/cCz/Or/APSqX/Nr6wf9wLP86v8A9Kr0xJR/csf70v8Am/8Aesv37J+7H/nf98+d4X1e
67W95fhPaC0Ae6vx8rFa/YfWP+4j/vZ/5Nd0kmS+H4ibMp/83/vVffsn7sf+d/3zwv7D6x/3Ef8A
ez/yaX7D6x/3Ef8Aez/ya7pJD/RuL96f/N/71X37J+7H/nf988rg9L6jXjhtmO5rtzjBLe/wcrH7
Pzv9C78P710SSqz+ActORkZ5bkb3h/3ivv2T92P4/wDfPO/s/O/0Lvw/vS/Z+d/oXfh/euiSQ/5P
cr/nMv2w/wC8V9+yfux/H/vn/9D1VJJJJSkkkklMXuDWlx7JxMaxPkoXfzfzb+UIiSlJJJJKUkkk
kpSSSSSlJJJJKUotcSS1wgjWR4FSUR/OH4D8rklP/9H1QuA+PgohxcfAJw0AfFRII1SUzgfFOhby
nALuSkpV38382/lCIg21gVnXu38oU/THikpmkoQ8cGU7XA+R8ElMkkkklKSSSSUpJJJJSlEfzh+A
/K5SUR/OH4D8rklP/9L1QkASh6vKRlxRAAAkpYMACY1+CmkkpBa4isg9i3/qgjAg8KF4BrM+I/KE
zgWmfuKSkqi8fnDkJNdPxUklLAyJTqFf0VNJSkkkklKSSSSUpRH84fgPyuUlEfzh+A/KUlP/0/U2
iApJJJKUkkkkpYgEEHg8pg2GwSXfFSSSUiILT8FMu9s+KazsoiXQOwSUzYIb8VJJJJSkkkklKSSS
SUpRawNkySTySpJJKf/U9VSUNh/fd+H/AJFLYf33fh/5FJTNJQ2H9934f+RS2O/fd+H9ySmaZR2v
/eP4f+RTekTy9x8tP/IpKUZedOFMNAGijsP77vw/8ilsP77vw/8AIpKZpKGw/vu/D/yKWw/vu/D/
AMikpmkobD++78P/ACKWw/vu/D/yKSmaShsP77vw/wDIquL7nA7arpgxu2iSAXfw2IEgbpAJ2baS
qV332NJ9G1kEQH7RII+l7d30USt1jt3qB1YHEwZ/6KYMsDIR1s/1Z8P+Nw8KTAjetPEP/9n/7QyG
UGhvdG9zaG9wIDMuMAA4QklNBAQAAAAAAAccAgAAAgACADhCSU0EJQAAAAAAEEYM8okmuFbasJwB
obCnkHc4QklNA+0AAAAAABAASAAAAAEAAgBIAAAAAQACOEJJTQQmAAAAAAAOAAAAAAAAAAAAAD+A
AAA4QklNBA0AAAAAAAQAAAB4OEJJTQQZAAAAAAAEAAAAHjhCSU0D8wAAAAAACQAAAAAAAAAAAQA4
QklNBAoAAAAAAAEAADhCSU0nEAAAAAAACgABAAAAAAAAAAI4QklNA/UAAAAAAEgAL2ZmAAEAbGZm
AAYAAAAAAAEAL2ZmAAEAoZmaAAYAAAAAAAEAMgAAAAEAWgAAAAYAAAAAAAEANQAAAAEALQAAAAYA
AAAAAAE4QklNA/gAAAAAAHAAAP////////////////////////////8D6AAAAAD/////////////
////////////////A+gAAAAA/////////////////////////////wPoAAAAAP//////////////
//////////////8D6AAAOEJJTQQAAAAAAAACAAs4QklNBAIAAAAAAFoAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAA4QklNBAgAAAAAACQAAAABAAACQAAAAkAAAAAEAAAPYAAAAAdeAQAA
EjwBAABgGAA4QklNBB4AAAAAAAQAAAAAOEJJTQQaAAAAAANXAAAABgAAAAAAAAAAAAACWAAAAyAA
AAARAFAATwBXAEUAUgBQAE8ASQBOAFQAXwBtAGEAcwB0AGUAcgAAAAEAAAAAAAAAAAAAAAAAAAAA
AAAAAQAAAAAAAAAAAAADIAAAAlgAAAAAAAAAAAAAAAAAAAAAAQAAAAAAAAAAAAAAAAAAAAAAAAAQ
AAAAAQAAAAAAAG51bGwAAAACAAAABmJvdW5kc09iamMAAAABAAAAAAAAUmN0MQAAAAQAAAAAVG9w
IGxvbmcAAAAAAAAAAExlZnRsb25nAAAAAAAAAABCdG9tbG9uZwAAAlgAAAAAUmdodGxvbmcAAAMg
AAAABnNsaWNlc1ZsTHMAAAABT2JqYwAAAAEAAAAAAAVzbGljZQAAABIAAAAHc2xpY2VJRGxvbmcA
AAAAAAAAB2dyb3VwSURsb25nAAAAAAAAAAZvcmlnaW5lbnVtAAAADEVTbGljZU9yaWdpbgAAAA1h
dXRvR2VuZXJhdGVkAAAAAFR5cGVlbnVtAAAACkVTbGljZVR5cGUAAAAASW1nIAAAAAZib3VuZHNP
YmpjAAAAAQAAAAAAAFJjdDEAAAAEAAAAAFRvcCBsb25nAAAAAAAAAABMZWZ0bG9uZwAAAAAAAAAA
QnRvbWxvbmcAAAJYAAAAAFJnaHRsb25nAAADIAAAAAN1cmxURVhUAAAAAQAAAAAAAG51bGxURVhU
AAAAAQAAAAAAAE1zZ2VURVhUAAAAAQAAAAAABmFsdFRhZ1RFWFQAAAABAAAAAAAOY2VsbFRleHRJ
c0hUTUxib29sAQAAAAhjZWxsVGV4dFRFWFQAAAABAAAAAAAJaG9yekFsaWduZW51bQAAAA9FU2xp
Y2VIb3J6QWxpZ24AAAAHZGVmYXVsdAAAAAl2ZXJ0QWxpZ25lbnVtAAAAD0VTbGljZVZlcnRBbGln
bgAAAAdkZWZhdWx0AAAAC2JnQ29sb3JUeXBlZW51bQAAABFFU2xpY2VCR0NvbG9yVHlwZQAAAABO
b25lAAAACXRvcE91dHNldGxvbmcAAAAAAAAACmxlZnRPdXRzZXRsb25nAAAAAAAAAAxib3R0b21P
dXRzZXRsb25nAAAAAAAAAAtyaWdodE91dHNldGxvbmcAAAAAADhCSU0EEQAAAAAAAQEAOEJJTQQU
AAAAAAAEAAAAdjhCSU0EDAAAAAAGLQAAAAEAAACAAAAAYAAAAYAAAJAAAAAGEQAYAAH/2P/gABBK
RklGAAECAQBIAEgAAP/tAAxBZG9iZV9DTQAC/+4ADkFkb2JlAGSAAAAAAf/bAIQADAgICAkIDAkJ
DBELCgsRFQ8MDA8VGBMTFRMTGBEMDAwMDAwRDAwMDAwMDAwMDAwMDAwMDAwMDAwMDAwMDAwMDAEN
CwsNDg0QDg4QFA4ODhQUDg4ODhQRDAwMDAwREQwMDAwMDBEMDAwMDAwMDAwMDAwMDAwMDAwMDAwM
DAwMDAwM/8AAEQgAYACAAwEiAAIRAQMRAf/dAAQACP/EAT8AAAEFAQEBAQEBAAAAAAAAAAMAAQIE
BQYHCAkKCwEAAQUBAQEBAQEAAAAAAAAAAQACAwQFBgcICQoLEAABBAEDAgQCBQcGCAUDDDMBAAIR
AwQhEjEFQVFhEyJxgTIGFJGhsUIjJBVSwWIzNHKC0UMHJZJT8OHxY3M1FqKygyZEk1RkRcKjdDYX
0lXiZfKzhMPTdePzRieUpIW0lcTU5PSltcXV5fVWZnaGlqa2xtbm9jdHV2d3h5ent8fX5/cRAAIC
AQIEBAMEBQYHBwYFNQEAAhEDITESBEFRYXEiEwUygZEUobFCI8FS0fAzJGLhcoKSQ1MVY3M08SUG
FqKygwcmNcLSRJNUoxdkRVU2dGXi8rOEw9N14/NGlKSFtJXE1OT0pbXF1eX1VmZ2hpamtsbW5vYn
N0dXZ3eHl6e3x//aAAwDAQACEQMRAD8A9StsFbZ5kwO+qG26wPbXa0Ne7iDIMc7dEb3eA+9NBndA
niZTJRmZWJ1t6a0/rLgRVEfVqfb79uI77M8jJgWxu/QzHus3Vtdt3O9P/Sb/APB/Z/tGRjtd1C+u
n1GYllz/AFjUa2chjXHfkHe1n+BZ6lbG/wA8/wBOmv8AnFZFNYAAY0AagD/cpbBEbGxM/PmeE9a1
usVWXdJzaaml9ttFjK2Dkuc1zGN1/ecV5/8A82vrB/3As/zq/wD0qvSnBzhGg1B+4ypKHLgjkIJJ
FdmbDzEsQIiAb7vmf/Nr6wf9wLP86v8A9Kpf82vrB/3As/zq/wD0qvTElH9yx/vS/wCb/wB6y/fs
n7sf+d/3z53hfV7rtb3l+E9oLQB7q/HysVr9h9Y/7iP+9n/k13SSZL4fiJsyn/zf+9V9+yfux/53
/fPC/sPrH/cR/wB7P/JpfsPrH/cR/wB7P/JrukkP9G4v3p/83/vVffsn7sf+d/3zyuD0vqNeOG2Y
7mu3OMEt7/Bysfs/O/0Lvw/vXRJKrP4By05GRnluRveH/eK+/ZP3Y/j/AN887+z87/Qu/D+9L9n5
3+hd+H966JJD/k9yv+cy/bD/ALxX37J+7H8f++f/0PVUkkklKSSSSUxe4NaXHsnExrE+Shd/N/Nv
5QiJKUkkkkpSSSSSlJJJJKUkkkkpSi1xJLXCCNZHgVJRH84fgPyuSU//0fVC4D4+CiHFx8AnDQB8
VEgjVJTOB8U6FvKcAu5KSlXfzfzb+UIiDbWBWde7fyhT9MeKSmaShDxwZTtcD5HwSUySSSSUpJJJ
JSkkkklKUR/OH4D8rlJRH84fgPyuSU//0vVCQBKHq8pGXFEAACSlgwAJjX4KaSSkFriKyD2Lf+qC
MCDwoXgGsz4j8oTOBaZ+4pKSqLx+cOQk10/FSSUsDIlOoV/RU0lKSSSSUpJJJJSlEfzh+A/K5SUR
/OH4D8pSU//T9TaICkkkkpSSSSSliAQQeDymDYbBJd8VJJJSIgtPwUy72z4prOyiJdA7BJTNghvx
UkkklKSSSSUpJJJJSlFrA2TJJPJKkkkp/9T1VJQ2H9934f8AkUth/fd+H/kUlM0lDYf33fh/5FLY
79934f3JKZplHa/94/h/5FN6RPL3Hy0/8ikpRl504Uw0AaKOw/vu/D/yKWw/vu/D/wAikpmkobD+
+78P/IpbD++78P8AyKSmaShsP77vw/8AIpbD++78P/IpKZpKGw/vu/D/AMiq4vucDtqumDG7aJIB
d/DYgSBukAnZtpKpXffY0n0bWQRAftEgj6Xt3fRRK3WO3eoHVgcTBn/opgywMhHWz/Vnw/43DwpM
CN608Q//2QA4QklNBCEAAAAAAFUAAAABAQAAAA8AQQBkAG8AYgBlACAAUABoAG8AdABvAHMAaABv
AHAAAAATAEEAZABvAGIAZQAgAFAAaABvAHQAbwBzAGgAbwBwACAANwAuADAAAAABADhCSU0EBgAA
AAAABwAIAAAAAQEA/+ESSGh0dHA6Ly9ucy5hZG9iZS5jb20veGFwLzEuMC8APD94cGFja2V0IGJl
Z2luPSfvu78nIGlkPSdXNU0wTXBDZWhpSHpyZVN6TlRjemtjOWQnPz4KPD9hZG9iZS14YXAtZmls
dGVycyBlc2M9IkNSIj8+Cjx4OnhhcG1ldGEgeG1sbnM6eD0nYWRvYmU6bnM6bWV0YS8nIHg6eGFw
dGs9J1hNUCB0b29sa2l0IDIuOC4yLTMzLCBmcmFtZXdvcmsgMS41Jz4KPHJkZjpSREYgeG1sbnM6
cmRmPSdodHRwOi8vd3d3LnczLm9yZy8xOTk5LzAyLzIyLXJkZi1zeW50YXgtbnMjJyB4bWxuczpp
WD0naHR0cDovL25zLmFkb2JlLmNvbS9pWC8xLjAvJz4KCiA8cmRmOkRlc2NyaXB0aW9uIGFib3V0
PSd1dWlkOjg0ZTViMTcyLTE5NDQtMTFkOC05NmRmLWNhNmY5N2Y2MWMyZicKICB4bWxuczp4YXBN
TT0naHR0cDovL25zLmFkb2JlLmNvbS94YXAvMS4wL21tLyc+CiAgPHhhcE1NOkRvY3VtZW50SUQ+
YWRvYmU6ZG9jaWQ6cGhvdG9zaG9wOjU3MjNlZTRhLWNkYzQtMTFkNy05YjRjLWFhNDRjYjQzYTUx
OTwveGFwTU06RG9jdW1lbnRJRD4KIDwvcmRmOkRlc2NyaXB0aW9uPgoKPC9yZGY6UkRGPgo8L3g6
eGFwbWV0YT4KICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAg
ICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgIAogICAg
ICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAg
ICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgCiAgICAgICAgICAgICAgICAg
ICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAg
ICAgICAgICAgICAgICAgICAgICAgICAgICAKICAgICAgICAgICAgICAgICAgICAgICAgICAgICAg
ICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAg
ICAgICAgICAgICAgIAogICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAg
ICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAg
CiAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAg
ICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAKICAgICAgICAgICAg
ICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAg
ICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgIAogICAgICAgICAgICAgICAgICAgICAgICAg
ICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAg
ICAgICAgICAgICAgICAgICAgCiAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAg
ICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAg
ICAgICAKICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAg
ICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgIAogICAgICAg
ICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAg
ICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgCiAgICAgICAgICAgICAgICAgICAg
ICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAg
ICAgICAgICAgICAgICAgICAgICAgICAKICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAg
ICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAg
ICAgICAgICAgIAogICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAg
ICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgCiAg
ICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAg
ICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAKICAgICAgICAgICAgICAg
ICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAg
ICAgICAgICAgICAgICAgICAgICAgICAgICAgIAogICAgICAgICAgICAgICAgICAgICAgICAgICAg
ICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAg
ICAgICAgICAgICAgICAgCiAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAg
ICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAg
ICAKICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAg
ICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgIAogICAgICAgICAg
ICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAg
ICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgCiAgICAgICAgICAgICAgICAgICAgICAg
ICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAg
ICAgICAgICAgICAgICAgICAgICAKICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAg
ICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAg
ICAgICAgIAogICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAg
ICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgCiAgICAg
ICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAg
ICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAKICAgICAgICAgICAgICAgICAg
ICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAg
ICAgICAgICAgICAgICAgICAgICAgICAgIAogICAgICAgICAgICAgICAgICAgICAgICAgICAgICAg
ICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAg
ICAgICAgICAgICAgCiAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAg
ICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAK
ICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAg
ICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgIAogICAgICAgICAgICAg
ICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAg
ICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgCiAgICAgICAgICAgICAgICAgICAgICAgICAg
ICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAg
ICAgICAgICAgICAgICAgICAKICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAg
ICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAg
ICAgIAogICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAg
ICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgCiAgICAgICAg
ICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAg
ICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAKICAgICAgICAgICAgICAgICAgICAg
ICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAg
ICAgICAgICAgICAgICAgICAgICAgIAogICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAg
ICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAg
ICAgICAgICAgCiAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAg
ICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAKICAg
ICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAg
ICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgIAogICAgICAgICAgICAgICAg
ICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAg
ICAgICAgICAgICAgICAgICAgICAgICAgICAgCiAgICAgICAgICAgICAgICAgICAgICAgICAgICAg
ICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAg
ICAgICAgICAgICAgICAKICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAg
ICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAg
IAogICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAg
Cjw/eHBhY2tldCBlbmQ9J3cnPz7/7gAOQWRvYmUAZEAAAAAB/9sAhAABAQEBAQEBAQEBAQEBAQEB
AQEBAQEBAQEBAQEBAQEBAQEBAQEBAQEBAQEBAgICAgICAgICAgIDAwMDAwMDAwMDAQEBAQEBAQEB
AQECAgECAgMDAwMDAwMDAwMDAwMDAwMDAwMDAwMDAwMDAwMDAwMDAwMDAwMDAwMDAwMDAwMDAwP/
wAARCAJYAyADAREAAhEBAxEB/90ABABk/8QBogAAAAYCAwEAAAAAAAAAAAAABwgGBQQJAwoCAQAL
AQAABgMBAQEAAAAAAAAAAAAGBQQDBwIIAQkACgsQAAIBAwQBAwMCAwMDAgYJdQECAwQRBRIGIQcT
IgAIMRRBMiMVCVFCFmEkMxdScYEYYpElQ6Gx8CY0cgoZwdE1J+FTNoLxkqJEVHNFRjdHYyhVVlca
ssLS4vJkg3SThGWjs8PT4yk4ZvN1Kjk6SElKWFlaZ2hpanZ3eHl6hYaHiImKlJWWl5iZmqSlpqeo
qaq0tba3uLm6xMXGx8jJytTV1tfY2drk5ebn6Onq9PX29/j5+hEAAgEDAgQEAwUEBAQGBgVtAQID
EQQhEgUxBgAiE0FRBzJhFHEIQoEjkRVSoWIWMwmxJMHRQ3LwF+GCNCWSUxhjRPGisiY1GVQ2RWQn
CnODk0Z0wtLi8lVldVY3hIWjs8PT4/MpGpSktMTU5PSVpbXF1eX1KEdXZjh2hpamtsbW5vZnd4eX
p7fH1+f3SFhoeIiYqLjI2Oj4OUlZaXmJmam5ydnp+So6SlpqeoqaqrrK2ur6/9oADAMBAAIRAxEA
PwDf49+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+6
91737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3X
vfuvde9+691737r3XvfuvdaMv8w7/stv5Kf+JNy3/Wik94He8/8A08rmT/qH/wC0WDror7E/9Oq5
V/6if+0y46Jl7i/qXeve/de697917r3v3Xuve/de697917r3v3Xuve/de697917r3v3Xuve/de69
7917r3v3Xuve/de697917r3v3Xuve/de697917r3v3Xuve/de697917r3v3XujE9B/8AMV/+QL/5
M+475+/5ZP8Azd/6x9e6MR7jvrXXvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737
r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3QsdH/8
zR2x/wCRr/3nst7hj7wf/Toebv8AqF/7Tbbqr/CerBffM3pjr3v3Xuve/de697917r3v3Xuve/de
697917r3v3Xuve/de697917r3v3Xuve/de697917r3v3Xuve/de697917r3v3Xuve/de697917r3
v3Xuve/de697917r3v3Xuv/Q3+Pfuvde9+691737r3Xvfuvde9+691737r3XF3WNWd2VEUFmdyFV
QPqWYkAAe6SSRxI8srhY1FSSQAB6knAHW1VnYKqkseAHHqDT5bFVU5pqXJ4+pqAus09PW0004T/V
GKORpAv+Nreyqz5i5f3C6NjYb7Zz3oXV4cc0bvT10KxanzpTpVLt9/BEJp7KZIa01MjBa+lSKdOH
s46Sde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+
691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3XvfuvdaMv8w7/stv5Kf+JNy3/Wik94He8/
/TyuZP8AqH/7RYOuivsT/wBOq5V/6if+0y46Jl7i/qXeve/de697917r3v3Xuve/de697917r3v3
Xuve/de697917r3v3Xuve/de697917r3v3Xuve/de697917r3v3Xuve/de697917r3v3Xuve/de6
97917r3v3XujE9B/8xX/AOQL/wCTPuO+fv8Alk/83f8ArH17oxHuO+tde9+691737r3Xvfuvde9+
691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3
Xvfuvde9+691737r3XvfuvdCx0f/AMzR2x/5Gv8A3nst7hj7wf8A06Hm7/qF/wC0226q/wAJ6sF9
8zemOve/de697917r3v3Xuve/de697917r3v3Xuve/de697917r3v3Xuve/de697917r3v3Xuve/
de697917r3v3Xuve/de697917r3v3Xuve/de697917r3v3Xuve/de6//0d/j37r3Xvfuvde9+691
737r3XTMqKzuwVVBZmYhVVVFyzE2AAA5PurukaNJIwWNQSSTQADJJJ4AeZ62AWIVRVjwHQKVfZmX
3VXV+C6mxdPnJqBnp8jvHKmWDaGLqVVtUFNJEBPna5WsBHCRGL6i5X64vbj76cx+4G67xyn93jYI
d1ubRmjud5uy6bPayAGscTKPEv5waARwlYxUO0hTjJlvyTt+w2tpuvP989rHKA0dnFRruVa/EwPb
Ah/iereQWvAv3WvY+GzG4M3j+98rkE3JTZFYcZj86ZaPa9AFAjmp/wCF0yxUFNXrUX/cnQo0ZGlh
Y3w59jve3lnmTnHmnZ/va8wXi87QXgS2t7/VDtcFKK8f0sQWCO4Elf1J1KNEV0OKMWlznXkzctu2
ja7v2qsITsrw1kkgo909chvFasjRlfwoQQwNRwoOGV7/AOoNqu+Px2QTJVEYMa0e2MY1RE8kbeNY
EqIkgomYfizlbfQ+8q+Yfvhfdu9v5JNn2beVvrxO0Q7XamRCynSEEirHAT6UcinAnh1F9h7Se4m/
Kt3eWZhiOddzLpIBFdRUlnA9aqD1CHyD84jloequz6ykkVXFUm3yqMjfR4h5HEqkcgg8+ytfvjm6
EM+1fd959ududQwlXbyAVP4kGo6xTIIOelJ9ovCLpdc+7HHcA00m4qQfQ4FP2dOWO+RGw5q5Mbn4
dwbLrZHCRx7qw1RjozqW4LzJ5o4VJ4u+kc3vbn2d7J98/wBo7ndY9j5wtd55X3R2AVd1spLdTUVB
LjWqA8KvpGQa0qQjvPZ7muO1a92mSz3O2AqTazLIfyB0k/7Wp/Pocqapp6yCGqpJ4aqmqI1lgqKe
VJoJonF0kiljZo5I2BuCCQfeVtle2e5Wlvf7ddxT2MyB45I2V43VhUMjqSrKRkEEg+XUXTQzW8sk
FxEyToSGVgVZSOIINCCPQ9Zvarprovvffyj6Q+MOFj3N3luzIbG2saSatqt1PszfG4NtYimhqqWi
8ueze1dt5zH4BJautijjNY8AkZgFv791sCvDpm+PXzF+OvyspajJfH3f0/ZOCpoauV9z4zZu+8Xt
SZ6Crhoa2kotz7i2zh8HkchSVM6rJBTzyypzdRpa3uvEEcejN+/da6CrtbvLpzorF4rOdz9nbH6t
wucyRw+JzG/Nx4zbGLr8qIHqv4dT5DLVFLSPWGmiaQR69RRWIFgbe69ToTKKto8lR0mRx1XTV+Pr
6aCtoa6iniqqOto6qJJ6arpKmB5IKmmqYJFeORGKupBBIPv3Xugx/wBO3S/+lYdFr2nsOXub+HNl
36tg3PiZ99wYtKFMm2QqtsQ1UmWo6T+HSpPrliRTC6uPSyk+69Q9Cv7917oAe9/k/wBK/GbDruTu
3dGS2VtcUNTkqzdP9y987i23h6Gknp6aWpz+a2ptvOUGAiM9XGqtWPCHLcXAJHutgV4dJ34+/Mr4
5/KiJqzoDftV2ThVp62dd0YvZG/8btGc42rjoq+lpN17g2tiNv11fSVMoSSCGoklUg3X0tb3XiCO
PRoPfutde9+690E+6u+Oldjb/wBpdVbz7X6+2t2Xv0Ux2VsLP7swuK3buoVlZNjqP+A4GtrIcjk/
vMhTvBD4o28syMi3YEe/de6Fj37r3Xvfuvde9+691737r3Xvfuvde9+691oy/wAw7/stv5Kf+JNy
3/Wik94He8//AE8rmT/qH/7RYOuivsT/ANOq5V/6if8AtMuOiZe4v6l3r3v3Xuve/de697917r3v
3Xuve/de697917r3v3Xuve/de697917r3v3Xuve/de697917r3v3Xuve/de697917r3v3Xuve/de
697917r3v3Xuve/de697917oxPQf/MV/+QL/AOTPuO+fv+WT/wA3f+sfXujEe47611737r3Xvfuv
de9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+6917
37r3Xvfuvde9+691737r3Xvfuvde9+690LHR/wDzNHbH/ka/957Le4Y+8H/06Hm7/qF/7Tbbqr/C
erBffM3pjr3v3Xuve/de697917r3v3Xuve/de697917r3v3Xuve/de697917r3v3Xuve/de69791
7r3v3Xuve/de697917r3v3Xuve/de697917r3v3Xuve/de697917r3v3Xuv/0t/j37r3Xvfuvde9
+691737r3Rd96VeZ7Q3jUdYbfr58XtXAx08/Y+bo30VNS1Vd6fa1DOt9ElREpM5/AuDwpR8MPc/c
eZffr3KvfYfk7d5rD2/2hI5OZL6E6ZJTLmPaoHHwtIgJnPkNQaojMcsw8tW+28jcuQ88bvaJPv12
WXboXFVXThrp18wppo/KmWDKLFTUbR6x2k0zijwG2sDSgLHEgVQBwkUUa/uVVbVSGw/VJLI1ySST
7yGvbz269iPbt7mVbbZ+Rtot6BUFAKYCoo7pZ5WwPiklkapJJJ6AEMPMHPHMCxqZLve7uTiT+0k8
FRR9iqoxjHRJpMfuL5R7zOQp8XS7Y2VhZTTyZn7KB8lJCdDCnlrAqyZHKTRAFYtfgpla5vxr5aTb
Nzp9/j3ObebLYbfYfa/a5DG174CNcsmD4bzABri6daFYg/gWytU1JBlybS82f2L5aFnNfSX3M1yu
oQ62EYOe4JwjiBwWprkIoKfhXFb8d95deZH+83UG446uqhjAkxGdp6FqmojUiR4YamaBqGbyMg4Z
YGF+JPcrbn9zH3M9md6/r1927nVLjcI0o1nfxwGSRQdRRJXQwPqKgUZYGFTplB6C9t7w8t84Wf7k
9xNmMcDHE0DPpUnAYqG1ilfIuD5p0qtmfJCBMkNq9rYebZO44WWCStmhmhxMsn6Q1RHNqmxyyEXD
3kgP11qPcge2X327SLex7f8A3guWpOVudIiEaZ0dLR24AyK9XtgxFQ9ZIDx8RFp0Q8yezErWf7+5
C3Fdz2ZhqCAgygce0jtkp5rRXHDST0Y7JYjA7nxxpsrj8ZnMZWQghKqCnraaaKVQVkidldbMpBV0
N/oQfebG+ct8o897MbHmDZ7HddiuY6hZY454nRhUMhIYZBBV0IPAqeB6hqy3HdtjvBPYXc9rextx
VmRgQcggU+wg/YR0A9HRy9I7zwuIoqqpm6x33kDjaOhrZ3nO0NzzBnpYaOolcv8AwvKsNIRjdX5J
JF2xJ2zbLj7rHudyvy5td/PL7Ec23v00MEzmT9z7o4JiSGRyT9LdntCMaq+SSy1eVbm5j9zuWtz3
C5gReeNqh8R3RQv1dsMMXUCnixcajiPIA0UyPvNzqGOiI/zPwD/Lw+ZoIBH+y8dl8MARxt2rI4II
4Pv3WxxH29Fz/kPhR/Kr+K2lVW+G30TpULdj2ZvEljYC7E/U/X3ocOtt8R6t6976r0CHyL+OvUfy
r6g3j0d3dtOi3fsDeuOeir6OoREr8XWoC+N3Dt7IFHnw25MHWBaijq4rPDKgvqUsre62CRw61faD
5xfLT+T0m/P5aO9trV/yK7AycOFo/wCWx2VUV+K+zze2t87im2tt7AdnRZLLUctFQbMrZP8AJ4Sy
olTSy0RkSgNPURa4Y6vQN3ft6uv/AJbH8vaD4h7W3H2r3Hmk7X+anfFTJuv5D91ZOY5XIVOYyk4y
D7H2rkKiNJKPaGAkKR2iWJa2eISlViSmhg91UmvDh1aF731Xoiv8zlEk/l6/MhJESRD8fOyCUkRX
Qldv1TKSrAqSrAEf0Iv78etrxHRYP5B/H8qb4vAAAfa9k8AW+vbG92J4/JJuf8fehw62/wAXVxPv
fVem/L5bG4HE5PO5qupsZh8Lj63LZbJVsqU9Hj8bjqaWsr66rnkKxw01JSwvJI7EBVUk8D37r3Wm
Rm/jL2j/ADOervn5/NUwNFnKDs3E9ibZy/8AL3kSSohydH1v8XszU1uTfCURej1NvqhppIoFmjBG
bp5GFwzatfPpyoFF62b/AOXj8vsB85fiT1R8g8T9vS5vPYlsF2JgoWBbbPZe2iuM3jhZIyEkhh/i
Mf3VJrVWkoKqCWwVx731QihI6Ox791rr3v3Xuve/de697917r3v3XutGX+Yd/wBlt/JT/wASblv+
tFJ7wO95/wDp5XMn/UP/ANosHXRX2J/6dVyr/wBRP/aZcdEy9xf1LvXvfuvde9+691737r3Xvfuv
de9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+6917
37r3Xvfuvde9+691737r3Rieg/8AmK//ACBf/Jn3HfP3/LJ/5u/9Y+vdGI9x31rr3v3Xuve/de69
7917r3v3Xuve/de697917r3v3Xuve/de697917r3v3Xuve/de697917r3v3Xuve/de697917r3v3
Xuve/de697917r3v3Xuve/de697917oWOj/+Zo7Y/wDI1/7z2W9wx94P/p0PN3/UL/2m23VX+E9W
C++ZvTHXvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3X
vfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvdf//T3+Pfuvde9+691737
r3XvfuvdFq6Lz2AxHV+Q3zn8rQ0Uuf3BuDO5+uqaldQqmrZooqZrnyvMlNCuiJQWOr0g3HvBz7p3
N3KPLnsLvPuvzfzBaWtxvG87hf7hPLKK+KZ3VYzXvLiJF8OJQWbV2KdQrNXuntW7bhzzacrbTYSy
x2lnbwQIqmmnQCW9ACxOpiaCmTjoFMlkdy/J/fiYbFNWYrrbb9Ss087JotBcoa2oXmOXMZBAy00T
EiFCSRw98Xd83rnj7+Xu3Hyzy+9zt/sfs84eRyumifCZ5BlWvLgBltomJECEsRiUtJllZ7L7HcqN
uV+I5+dLtCqrWvdx0L5iGM0MjCmtqAH4aHl27t3D7Uw9FgcDRRY/GUEQjggiHJP1kmmc+uaome7O
7EszG599XeTOTOWvb7lra+UuUdqjs9itI9McaftZ3Y5eRzVndiWZiST1i5vG8bjv243O67rdNNfS
tVmP8gBwCgYVRgDA6e/Yo6LOg67F6x2v2ViXoM5SIlbHE4xuap0RcljZSCUaKW15afWbvC943H4B
sRC/vR7Eche+PL0u0c17cq7okZFtexqBc2z8QUfi8erLwvWNxXAajAY8nc8b7yVfrd7XcE2xYeJC
xPhyDzqPJqcHHcPmMEoGyt9bv+P28/8AR/v6War2jNIv21Qxknio6SZ2jps1h5GLOKBmW09PzoIa
wDqdXNv2t92Pcj7nfud/rPe71xJce3Erjw5DqkSGF2KxXtmxq305IpPb50EOAolQ68iOZuVuXfdz
lv8ArbynGsfMKjuXCl3UVaGYcPEz2SedRUlTgfvkNlIDszbMFDJHPkszvXazbdkjcMTVR1P3UVZT
sLqwEdgD9LSD3mD98zfrRvbHkW12mZJd83PmjajtzKQayrL4qTRngRpooPCkg8j1Evs/YyjmXe5b
pGWyttsuvqAR+ErpKMPtzT+j0Yb3mX1EHVbX82rszrvYf8v35XYzem+NrbXym6+jN94Pa2JzWaoa
LL7lzOWxpxOOxmAxMswyWYrKrJV0UQSnikKlwW0qCR49bUZHRdv5A3ZHX24/5anx92Pgd67Zy29N
k4/fFFu/aFHmKOTc+2qluxNyViLmcCZVylDFLS5KnkSV4hFIsy6WN/eh1tuJ6uu976r1X3/MV/mB
9c/y/wDpc7zzlFNvXtne01Rtrozp3ELU1O4eyd9SJHHSUqU1BFUVtPt/GT1UUlfUqhYIywwh6iWK
NvdbAqeqq+pP5LGU+WHRPcnd38xbMZXKfOn5RUdJujCbograqCb4px42+R672jsrHUlV9jQvhX8C
ZeiXyRLSr9kjB0lqJdU6tqpQDh0Ov8sH51dsYDsLM/yzvn8ajAfMLp2CWj6833lnZsR8jutMfTGb
Cbgw2bmSOLN7ogwkHmM9/LlKOMyyAVsFag8OtMBxHDq+P3vqvVb/APNk7M692F8AflZj95b021tv
Kbn6N33h9s4fK5igpM1uPKZPHfwmhoMBiJp0yOYqp8hXRR6aeOQqXu1gCffj1teI6LF/wn67I69z
v8tToHYOG3vtXJb72fD2LDuvZdJm6CTdm3Hl7N3TXQnMbe84y1DDPRZGnljleIRSRzIVY396HDrb
8ervfe+q9UZfz1vkZuzafx92V8NulWq675D/ADv3hQ9JbOxWNdkq6bY+VyGOxu/MrVTRsGo8dXw5
amxU0rWjSnrp5HISJyNHq6DNfTrn1x/I62R1vsHaOxNufNv547Ww+2sFS41dv7J71O3NnUtZJG0+
cbA7dg289Pi8ZksvU1FQtOS+jzEFmNyfU60Wr5DooXwLw038pv8Amhdk/wAu/N7i3Plvjj8tsBi+
2fjPufeMi11bL2JR4+WHM4TIZWnhpaF8xkVxWRx1QyRI9TJQY6R1QzgH3A9bPctfPraH976p1737
r3Xvfuvde9+691737r3WrR8oP5Zfyp+QnyL7t7f63wWz6zZe7uzd4fwapym8sbiq+T+AZqr2xkfP
QVCman0ZbCzqt/1oAw4I940e4Hs1zPzXzdu+/wC3X9glnceFpWR5Q40QxxnUFgdfiQkUY4pWhwMr
fbX305S5N5K2Xlvc9u3GS+tvG1NFHC0Z8SeWVdJe4RjRXANVGa0qKEgT/wAMyfOL/nmev/8A0YeH
/wCjPYN/4HjnT/o6bX/zkn/7Zuh1/wAE3yH/ANGjd/8AnFb/APbV17/hmT5xf88z1/8A+jDw/wD0
Z79/wPHOn/R02v8A5yT/APbN17/gm+Q/+jRu/wDzit/+2rr3/DMnzi/55nr/AP8ARh4f/oz37/ge
OdP+jptf/OSf/tm69/wTfIf/AEaN3/5xW/8A21de/wCGZPnF/wA8z1//AOjDw/8A0Z79/wADxzp/
0dNr/wCck/8A2zde/wCCb5D/AOjRu/8Azit/+2rr3/DMnzi/55nr/wD9GHh/+jPfv+B450/6Om1/
85J/+2br3/BN8h/9Gjd/+cVv/wBtXXv+GZPnF/zzPX//AKMPD/8ARnv3/A8c6f8AR02v/nJP/wBs
3Xv+Cb5D/wCjRu//ADit/wDtq69/wzJ84v8Anmev/wD0YeH/AOjPfv8AgeOdP+jptf8Azkn/AO2b
r3/BN8h/9Gjd/wDnFb/9tXXv+GZPnF/zzPX/AP6MPD/9Ge/f8Dxzp/0dNr/5yT/9s3Xv+Cb5D/6N
G7/84rf/ALauvf8ADMnzi/55nr//ANGHh/8Aoz37/geOdP8Ao6bX/wA5J/8Atm69/wAE3yH/ANGj
d/8AnFb/APbV17/hmT5xf88z1/8A+jDw/wD0Z79/wPHOn/R02v8A5yT/APbN17/gm+Q/+jRu/wDz
it/+2rr3/DMnzi/55nr/AP8ARh4f/oz37/geOdP+jptf/OSf/tm69/wTfIf/AEaN3/5xW/8A21de
/wCGZPnF/wA8z1//AOjDw/8A0Z79/wADxzp/0dNr/wCck/8A2zde/wCCb5D/AOjRu/8Azit/+2rr
3/DMnzi/55nr/wD9GHh/+jPfv+B450/6Om1/85J/+2br3/BN8h/9Gjd/+cVv/wBtXXv+GZPnF/zz
PX//AKMPD/8ARnv3/A8c6f8AR02v/nJP/wBs3Xv+Cb5D/wCjRu//ADit/wDtq69/wzJ84v8Anmev
/wD0YeH/AOjPfv8AgeOdP+jptf8Azkn/AO2br3/BN8h/9Gjd/wDnFb/9tXXv+GZPnF/zzPX/AP6M
PD/9Ge/f8Dxzp/0dNr/5yT/9s3Xv+Cb5D/6NG7/84rf/ALauvf8ADMnzi/55nr//ANGHh/8Aoz37
/geOdP8Ao6bX/wA5J/8Atm69/wAE3yH/ANGjd/8AnFb/APbV17/hmT5xf88z1/8A+jDw/wD0Z79/
wPHOn/R02v8A5yT/APbN17/gm+Q/+jRu/wDzit/+2rr3/DMnzi/55nr/AP8ARh4f/oz37/geOdP+
jptf/OSf/tm69/wTfIf/AEaN3/5xW/8A21de/wCGZPnF/wA8z1//AOjDw/8A0Z79/wADxzp/0dNr
/wCck/8A2zde/wCCb5D/AOjRu/8Azit/+2rr3/DMnzi/55nr/wD9GHh/+jPfv+B450/6Om1/85J/
+2br3/BN8h/9Gjd/+cVv/wBtXXv+GZPnF/zzPX//AKMPD/8ARnv3/A8c6f8AR02v/nJP/wBs3Xv+
Cb5D/wCjRu//ADit/wDtq6FXrL+U78y9l/xv+KbQ2hUfxL+G+D7Df23ZdH2f3/l8v3FRS6dX3S6b
ar2N7cXCvM33XPcDevofpd42dfC111y3I+LRSlLRv4TXh5de/wCCb5D/AOjTu/8Azit/+2roVf8A
htb5a/8APEYH/wBDjan/ANdPYU/4ED3L/wCj5sX/ADmuv+2Lr3/BN8h/9Gnd/wDnFb/9tXXv+G1v
lr/zxGB/9Djan/109+/4ED3L/wCj5sX/ADmuv+2Lr3/BN8h/9Gnd/wDnFb/9tXXv+G1vlr/zxGB/
9Djan/109+/4ED3L/wCj5sX/ADmuv+2Lr3/BN8h/9Gnd/wDnFb/9tXXv+G1vlr/zxGB/9Djan/10
9+/4ED3L/wCj5sX/ADmuv+2Lr3/BN8h/9Gnd/wDnFb/9tXXv+G1vlr/zxGB/9Djan/109+/4ED3L
/wCj5sX/ADmuv+2Lr3/BN8h/9Gnd/wDnFb/9tXXv+G1vlr/zxGB/9Djan/109+/4ED3L/wCj5sX/
ADmuv+2Lr3/BN8h/9Gnd/wDnFb/9tXXv+G1vlr/zxGB/9Djan/109+/4ED3L/wCj5sX/ADmuv+2L
r3/BN8h/9Gnd/wDnFb/9tXXv+G1vlr/zxGB/9Djan/109+/4ED3L/wCj5sX/ADmuv+2Lr3/BN8h/
9Gnd/wDnFb/9tXXv+G1vlr/zxGB/9Djan/109+/4ED3L/wCj5sX/ADmuv+2Lr3/BN8h/9Gnd/wDn
Fb/9tXXv+G1vlr/zxGB/9Djan/109+/4ED3L/wCj5sX/ADmuv+2Lr3/BN8h/9Gnd/wDnFb/9tXXv
+G1vlr/zxGB/9Djan/109+/4ED3L/wCj5sX/ADmuv+2Lr3/BN8h/9Gnd/wDnFb/9tXXv+G1vlr/z
xGB/9Djan/109+/4ED3L/wCj5sX/ADmuv+2Lr3/BN8h/9Gnd/wDnFb/9tXXv+G1vlr/zxGB/9Dja
n/109+/4ED3L/wCj5sX/ADmuv+2Lr3/BN8h/9Gnd/wDnFb/9tXXv+G1vlr/zxGB/9Djan/109+/4
ED3L/wCj5sX/ADmuv+2Lr3/BN8h/9Gnd/wDnFb/9tXXv+G1vlr/zxGB/9Djan/109+/4ED3L/wCj
5sX/ADmuv+2Lr3/BN8h/9Gnd/wDnFb/9tXXv+G1vlr/zxGB/9Djan/109+/4ED3L/wCj5sX/ADmu
v+2Lr3/BN8h/9Gnd/wDnFb/9tXXv+G1vlr/zxGB/9Djan/109+/4ED3L/wCj5sX/ADmuv+2Lr3/B
N8h/9Gnd/wDnFb/9tXXv+G1vlr/zxGB/9Djan/109+/4ED3L/wCj5sX/ADmuv+2Lr3/BN8h/9Gnd
/wDnFb/9tXXv+G1vlr/zxGB/9Djan/109+/4ED3L/wCj5sX/ADmuv+2Lr3/BN8h/9Gnd/wDnFb/9
tXXv+G1vlr/zxGB/9Djan/109+/4ED3L/wCj5sX/ADmuv+2Lr3/BN8h/9Gnd/wDnFb/9tXXv+G1v
lr/zxGB/9Djan/109+/4ED3L/wCj5sX/ADmuv+2Lr3/BN8h/9Gnd/wDnFb/9tXXv+G1vlr/zxGB/
9Djan/109+/4ED3L/wCj5sX/ADmuv+2Lr3/BN8h/9Gnd/wDnFb/9tXS365/l9/KfaG8sNuLJbDxk
9Fj/AOIeaKh3ps6Wqb7vFV1DH4kqM3TRNplqVLXdbKDa5sDH/ul9xX3b535E33lfauYuXI7+68HQ
0txerGPDuIpW1FNvkYVWMgUQ9xANBUirfea5DII/dO7/APOK3/7aujR/7LR35/z7Ou/9Crr3/wCz
H3iB/wAmlPvG/wDTa8k/9lm6f96fpv8A4JfkT/o07v8A84rf/tq69/stHfn/AD7Ou/8AQq69/wDs
x9+/5NKfeN/6bXkn/ss3T/vT9e/4JfkT/o07v/zit/8Atq69/stHfn/Ps67/ANCrr3/7Mffv+TSn
3jf+m15J/wCyzdP+9P17/gl+RP8Ao07v/wA4rf8A7auvf7LR35/z7Ou/9Crr3/7Mffv+TSn3jf8A
pteSf+yzdP8AvT9e/wCCX5E/6NO7/wDOK3/7auvf7LR35/z7Ou/9Crr3/wCzH37/AJNKfeN/6bXk
n/ss3T/vT9e/4JfkT/o07v8A84rf/tq69/stHfn/AD7Ou/8AQq69/wDsx9+/5NKfeN/6bXkn/ss3
T/vT9e/4JfkT/o07v/zit/8Atq69/stHfn/Ps67/ANCrr3/7Mffv+TSn3jf+m15J/wCyzdP+9P17
/gl+RP8Ao07v/wA4rf8A7auvf7LR35/z7Ou/9Crr3/7Mffv+TSn3jf8ApteSf+yzdP8AvT9e/wCC
X5E/6NO7/wDOK3/7auvf7LR35/z7Ou/9Crr3/wCzH37/AJNKfeN/6bXkn/ss3T/vT9e/4JfkT/o0
7v8A84rf/tq69/stHfn/AD7Ou/8AQq69/wDsx9+/5NKfeN/6bXkn/ss3T/vT9e/4JfkT/o07v/zi
t/8Atq69/stHfn/Ps67/ANCrr3/7Mffv+TSn3jf+m15J/wCyzdP+9P17/gl+RP8Ao07v/wA4rf8A
7auvf7LR35/z7Ou/9Crr3/7Mffv+TSn3jf8ApteSf+yzdP8AvT9e/wCCX5E/6NO7/wDOK3/7auvf
7LR35/z7Ou/9Crr3/wCzH37/AJNKfeN/6bXkn/ss3T/vT9e/4JfkT/o07v8A84rf/tq69/stHfn/
AD7Ou/8AQq69/wDsx9+/5NKfeN/6bXkn/ss3T/vT9e/4JfkT/o07v/zit/8Atq69/stHfn/Ps67/
ANCrr3/7Mffv+TSn3jf+m15J/wCyzdP+9P17/gl+RP8Ao07v/wA4rf8A7auvf7LR35/z7Ou/9Crr
3/7Mffv+TSn3jf8ApteSf+yzdP8AvT9e/wCCX5E/6NO7/wDOK3/7auvf7LR35/z7Ou/9Crr3/wCz
H37/AJNKfeN/6bXkn/ss3T/vT9e/4JfkT/o07v8A84rf/tq69/stHfn/AD7Ou/8AQq69/wDsx9+/
5NKfeN/6bXkn/ss3T/vT9e/4JfkT/o07v/zit/8Atq69/stHfn/Ps67/ANCrr3/7Mffv+TSn3jf+
m15J/wCyzdP+9P17/gl+RP8Ao07v/wA4rf8A7auvf7LR35/z7Ou/9Crr3/7Mffv+TSn3jf8ApteS
f+yzdP8AvT9e/wCCX5E/6NO7/wDOK3/7auvf7LR35/z7Ou/9Crr3/wCzH37/AJNKfeN/6bXkn/ss
3T/vT9e/4JfkT/o07v8A84rf/tq69/stHfn/AD7Ou/8AQq69/wDsx9+/5NKfeN/6bXkn/ss3T/vT
9e/4JfkT/o07v/zit/8Atq69/stHfn/Ps67/ANCrr3/7Mffv+TSn3jf+m15J/wCyzdP+9P17/gl+
RP8Ao07v/wA4rf8A7auv/9Tf49+691737r3Xvfuvde9+690R7KfEWsqtyVTUG66ai2lU1z1kVK1N
US5Kjhlcs1LFCClHK8IYokhYXQC4vf3yo3/+7k3LcOeNwk2j3Agtfbqe7aZYjHI9zCjmpiVKiFil
SkchcVQAstag5Q2P3hbaDZYFu9heXmBIghYMojcgUDE5cBuLKAc1oadG12XsvAbCwNLt7b1L9vRw
XkllkIerrqpwomra2YKvmqJdIubBVUBVAUADor7Ye2HKHtFylYcm8mbf4O2w9zu1GlnlIGuad6DX
I9BU0CqoVEVUVVGPvMvMu7c2brPu+8T67l8ADCIo4Ig8lH7Sakkkk9Kz3IXRB1737r3XvfuvdFV+
Wm3KKv2DRbiZY0yGAy1NFDMQBJLR5Q/bVFKD9WXzLHJY/TQbfU++fv8AeJclbXu/tDtfOjoi7zs+
4xoj/iaG6PhyRA+Y1iOSh4aDTiep5+7/ALzc2nNlzs6kmzu7diR5B4u5W/ZqX/bD06DXpunznbOX
6+myUMq7T6jxccTTVHqjyu4Fld6COO4ZXNJTJT3vyiQfgyD3B33ZrPmr7xHMfs7c75bSD279ubBU
LyZW73AMzQKtagmKJbetcokGaGZehr7kTbX7f7fzdHZSKd/5hnJouDFBQCQn01sZKepfz0Ho+nvr
n1ij0H2+c11ZhDjajsnJ7DxjStMmIl3nU4Gld2UK1SuObNMrMVBBfxfTi/49+690j8d2r8cMRUS1
eJ3/ANOYuqnjEM9TjtxbPoqiaJSGWKWamqopJIwwBCkkXHv3W6HoUNtbu2rvKhlye0dx4Pc+OhqX
o5q/AZSiy1HFVxokklNJU0M08KTokqkoTqAYcc+/da6cKzEYmvnpauvxeOraqhbyUVVWUVNUz0bh
1k10s00TyU7B0VroQbgH8e/de6Q+X7k6jwEogzfZ/X+KnJYeGv3hgKWW6MUYGOWvVwVcEG4+o9+6
91hxO/umt45OjrsJvDrbcuZhkjpaCqx+d21lcrFIxk8VPRyw1M1YjsZn0qhBJZrDk+/de6E/37r3
SZ3JSbNMMGR3hTbZMFJIIqav3JDijDTS1DALHBVZRdEMkzAABWBYj8+/de6TmPzXUGIqZK3FZbrb
F1k0fhmq8fX7YoqmWEEN4pJ6aWKV4wwB0kkXHv3Xulris5hM7FLPhMxi8xDBJ4Z5sVkKTIRQylQ4
ilkpJpkjkKEHSSDY39+691mnxeNqqulr6nHUNRXUOv7KtnpKearo/J+v7Wpkjaan1250ML+/de6a
qneO0aOompKzdO3KSqppDFUU1TnMZBUQSrYtFNDLVLJFIAeVYA+/de6bznOvMxksc5zGzMpl4plj
xLnIYOtyUdRI2pI8c3mlqkmdluBFZiR7917pZ+/de697917r3v3Xuve/de697917oMupP+PVyv8A
4k3uv/38u/ffuvdCb7917r3v3Xuve/de697917r3v3Xuve/de697917r3v3Xuve/de697917r3v3
Xuve/de697917r3v3Xuve/de697917r3v3Xuve/de697917r3v3Xuve/de697917r3v3Xuve/de6
97917r3v3Xuve/de697917r3v3Xuve/de697917r3v3Xuve/de697917r3v3Xuve/de697917r3v
3Xuve/de697917r3v3Xuve/de697917r3v3Xuve/de697917r3v3Xuve/de697917r3v3Xuve/de
697917r3v3Xuve/de697917r3v3Xuve/de697917r3v3Xuve/de697917r3v3Xuve/de697917r3
v3Xuve/de697917r3v3Xuve/de6//9Xf49+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r
3SXzu9dq7aRmzOdx9JIL6aQTCoyErC3ogx1MJq6eQk2CpGT7AXNnuh7f8jxu3M/NdnbTitIdfiXD
n+GO2i1zyNkUVIyej3auWd+3pgNt2uaRP46aYx82kaiKPmWA6Abde3N2d9VuPx9Xj8hsnrTF1f3z
z5SFYNybmqlUxxSU+Lk1NjaRIZG8bTi/rLFWNlXEf3C5K9xPvdbps+z7hs17yt7G2Fx45kukEe5b
nKAVRo7Vqm2hCM3htOAe8uyOwEaStsG88v8AtRbXd3b3kO587Tx6AsR1W1spNSGlGJHJA1BPSgIF
WYwe2ds4XaGFosBt+hjoMZQppihS5eR25lqKiVrvPUzv6ndiSx/wsPeY/I3I3K/tvyxtnJ/J21JZ
7FaJREXJZjlpJHPdJLIe53YksfkABEO973ufMW5XO7bvdNLeympJ4AeSqOCqowFGAOn72LuirosX
eOBrBufbm6cFtrs7M5v+B5Hb9TV7C2/1huWhgxTVtNkUp8rQ9l5GjhpKh6xNUU1IC7LqWQ20+/db
8j0D/wDxkH/nhvkP/wCir+K3/wBfvfutfn0Y/oyDfcGC3B/fTGVWLpJdxyT7SizWJ2jg92SYGTF4
3ytunGbFqKrbMFdHmRVJAYXMj0ixGUByffutnp97r2vuPenVO+dr7SqVptw5nBzUuPVq+fFJXFZY
ZqrDSZSmBqMZFnqKKSiepT1QLUFxyvv3WugswW6tiYTC0lI/xr39tAY5Ex0eBoeo8bmEokgURiOj
qdnvm8ZU0QIISWOUq49XF/fut/n0xdh1m2d97Rym2sD8bt47gzG48fW0eHkzPX2O2Tj8LmGp5UxW
aye4s9Pia7AJjK0pMtVRrLWwlNcCGQKD7r359Gp27Q5DGbfwWNy1ecplMfh8ZQ5LJnVfI5CkooIK
yvOuzXq6iNpOefV791roDu7Ovd1773f0rUbdOPp6Ha+591ZXPZLK4nHbgx+Ogq9lZfF4+WTB5Kpg
hrKiWvq1SKRQ7wMdQAFz791sefTptzqbOY3MU1ZuDP7M3BiY0nWqxMPVe2MPLUmSJlhZcjTSTTQ+
GUhiApDDg+/de8uhlx2IxWISSLE4zH4yOZxLNHjqKmoklkChBJIlNFEruEAFzc2FvfutdOHv3Xui
n7F2btXH5jcW1989KDJZ2t39urJQ7yqtgYbcOBzWL3DmKrM4vKNubwVckSQ0dUtPPHV+OeGaIrpK
aGb3W+h3ousetcbWUuRx3XuxqDIUM8dVRV1FtPAUtZR1MR1RVFLUwY+OennjblXRgwP0Pv3Wq9Ln
37r3Xvfuvde9+691737r3XvfuvdBl1J/x6uV/wDEm91/+/l377917oTffuvde9+691737r3Xvfuv
de9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+6917
37r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfu
vde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691
737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvf
uvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3X//1t/j37r3
Xvfuvde9+691737r3Xvfuvde9+691737r3XCSOOVDHKiSI3DJIqujD/FWBB9tzQw3EbQzxK8R4qw
BB+0GoPVkd42DoxVh5g0PTbSYHB0EzVNDhsVRVDEs09JjqOmmYt+otLDCjkt+eefZHt3KXKuz3T3
208s7fa3rEkyQ28MbkniS6IrEnzqc9Lbjdd0u4hDdblcSwjgryOy/sJI6dfYg6Qde9+691737r3X
vfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+691737r3Xvfuvde9+
691737r3Xvfuvde9+691737r